No full-text available
To read the full-text of this research,
you can request a copy directly from the author.
Grading of Angina Pectoris
... Nonetheless, the prevalence of ACS and its manifestations (ST-elevated myocardial infarction (STEMI), non-ST elevated myocardial infarction (NSTEMI), and unstable angina) has been reported higher among men in four studies [35,37,49]. For stable angina, the prevalence among genders varied between men and women depending on the severity when assessed by the Canadian Cardiovascular Society Grading Scale [53]. In this respect, women showed more class II and less class I symptoms in mild-to-moderate angina [44]. ...
... It is worth mentioning that class II symptoms were more severe than class I symptoms. Patients with class II symptoms experienced limitations in carrying out normal everyday activities such as walking or taking stairs [53]. ...
... Consequently, by including further diagnosis and treatment, this review added to the previous literature and provided useful insight for both patients and healthcare professionals working with CVDs. It is noteworthy to mention that the review did not show selection bias in the women-to-men ratios in the individual studies that showed almost equal ratios with a median of [53][54][55][56][57][58][59][60][61][62][63][64]. ...
Cardiovascular disease (CVDs) has been perceived as a ‘man’s disease’, and this impacted women’s referral to CVD diagnosis and treatment. This study systematically reviewed the evidence regarding gender bias in the diagnosis, prevention, and treatment of CVDs. Preferred Reporting Items for Systematic Reviews and Meta-analyses (PRISMA) guidelines were followed. We searched CINAHL, PubMed, Medline, Web of Science, British Nursing Index, Scopus, and Google Scholar. The included studies were assessed for quality using risk bias tools. Data extracted from the included studies were exported into Statistical Product and Service Solutions (SPSS, v26; IBM SPSS Statistics for Windows, Armonk, NY), where descriptive statistics were applied. A total of 19 studies were analysed. CVDs were less reported among women who either showed milder symptoms than men or had their symptoms misdiagnosed as gastrointestinal or anxiety-related symptoms. Hence, women had their risk factors under-considered by physicians (especially by male physicians). Subsequently, women were offered fewer diagnostic tests, such as coronary angiography, ergometry, electrocardiogram (ECG), and cardiac enzymes, and were referred to less to cardiologists and/or hospitalisation. Furthermore, if hospitalised, women were less likely to receive a coronary intervention. Similarly, women were prescribed cardiovascular medicines than men, with the exception of antihypertensive and anti-anginal medicines. When it comes to the perception of CVD, women considered themselves at lower risk of CVDs than men. This systematic review showed that women were offered fewer diagnostic tests for CVDs and medicines than men and that in turn influenced their disease outcomes. This could be attributed to the inadequate knowledge regarding the differences in manifestations among both genders.
... Table 4. Baseline characteristics for study population classi ed according to Gensini tertiles. * Severe symptoms of CCS -symptoms classi ed to III and IV grade of Canadian Cardiovascular Society (19); **p value < 0.05 considered as statistically signi cant; values with normal distribution and homogenous variation presented as "mean ± SD (standard deviation)", F-ANOVA statistics test (with Scheffè post-hoc analysis) applied; values with rejected distribution normality or unequal variances presented as "median [interquartile range]", ANOVA Kruskal-Wallis test applied; quantitative values presented as "number (percentage in group)", χ 2 test applied. 3p (TCACCGGGTGTAAATCAGCTTG), internal control miRNAs hsa-mir-191-5p (CAACGGAATCCCAAAAGCAGCTG) and hsa-mir-93-3p (ACTGCTGAGCTAGCACTTCCCG) as well as study miRNA particles -hsa-mir-92a-3p (TATTGCACTTGTCCCGGCCTGT), hsa-miR-10b-5p (TACCCTGTAGAACCGAATTTGTG), hsa-miR-126-3p (TCGTACCGTGAGTAATAATGCG), hsa-miR-98-5p (TGAGGTAGTAAGTTGTATTGTT) and hsa-miR-29b-3p (TAGCACCATTTGAAATCAGTGTT) All qPCRs were conducted in MicroAmp Fast Optical 96 Well Reaction Plates (Thermo Fisher Scienti c) in total volume of 20µl. ...
... signi cant atherosclerotic lesions in the main branches). * Severe symptoms of CCS -symptoms classi ed to III and IV grade of Canadian Cardiovascular Society (19); *p value < 0.05 considered as statistically signi cant; values with normal distribution presented as "mean ± SD (standard deviation)", t-test or Cochrane-Cox test applied (according to the presence of homogenous variances); values with rejected distribution normality presented as "median [interquartile range]", U-Mann-Whitney test applied; quantitative values presented as "number (percentage in group)", χ 2 test applied. ...
... Gensini Score (GS) ranges according to tertiles. * Severe symptoms of CCS -symptoms classi ed to III and IV grade of Canadian Cardiovascular Society(19); **p value <0.05 considered as statistically signi cant; values with normal distribution and homogenous variation presented as "mean ± SD (standard deviation)", F-ANOVA statistics test (with Scheffè post-hoc analysis) applied; values with rejected distribution normality or unequal variances presented as "median [interquartile range]", ANOVA Kruskal-Wallis test applied; quantitative values presented as "number (percentage in group)", χ 2 test applied. ...
Background
Atherosclerotic plaque progression is regulated by different factors – both atherogenic and atheroprotective. Atheroprotective pathways involve factors like KLF2, KLF4, Mert-K, IL-10 and TGF-β. These factors are down-regulated by microRNA particles – miR-92a downregulates KLF-2, miR-10b – KLF4, miR-126 – Mert-K, miR-98 – IL10 and miR-29b – TGFβ.
Methods
A number of 44 patients with chronic coronary syndrome and atherosclerotic lesions confirmed by coronary angiography were enrolled to the study. Patients were classified according to atherosclerosis burden (assessed by Gensini Score) and presence of advanced atherosclerotic lesions. The relative expression levels in plasma of miR-92a, miR-10b, miR-126, miR-98 and miR-29b were measured by quantitative RT-PCR.
Results
The study revealed that patients with the lowest burden of atherosclerosis presented significantly increased miR-126, whereas patients with advanced atherosclerosis (i.e. presence of significant atherosclerotic lesion qualified for intervention in main coronary artery branch or chronic occlusion) presented significantly increased level of miR-92a, an inhibitor of atheroprotective KLF2.
Conclusions
The obtained results demonstrated that microRNA which down-regulate atheroprotecive pathways might differ according to atherosclerotic plaque burden and advancement.
... Rannsóknin náði til 748 sjúklinga sem gengust undir ósaeðarlokuskipti vegna ósaeðarlokuþrengsla á Landspítala 2003-2020. Sjúklingum var skipt í fjóra hópa eftir líkamsþyngdar stuðli (LÞS): kjörþyngd (18,(5)(6)(7)(8)(9)(10)(11)(12)(13)(14)(15)(16)(17)(18)(19)(20)(21)(22)(23)(24)9 kg/m 2 , n=190), ofþyngd (25)(26)(27)(28)(29)9 kg/m 2 , n=339), offita (30-34,9 kg/m 2 , n=165) og mikil offita (≥35 kg/m 2 , n=54). Sex sjúklingum með LÞS <18,5 kg/m 2 var sleppt við útreikninga. ...
... Klínískar upplýsingar fengust úr sjúkraskrám og aðgerðalýsingum, en samtals voru skráðar um 200 breytur fyrir hvern sjúkling, þar á meðal aldur, kyn, haeð og þyngd. Út frá þessum upplýsingum var LÞS reiknaður fyrir alla sjúklingana og þeim skipt í flokka samkvaemt flokkun Alþjóðaheilbrigðisstofnunarinnar, en þeir eru undirþyngd (<18,5 kg/m 2 ), kjörþyngd (18,(5)(6)(7)(8)(9)(10)(11)(12)(13)(14)(15)(16)(17)(18)(19)(20)(21)(22)(23)(24)9 kg/m 2 ), ofþyngd (25)(26)(27)(28)(29)9 kg/m 2 ), offita (30-34,9 kg/m 2 ) og mikil offita (≥35 kg/m 2 ). 14 Samtals uppfylltu 756 sjúklingar inntökuskilyrði rann sóknarinnar, en sleppa varð tveimur sjúklingum þar sem upplýsingar um haeð og þyngd vantaði. ...
... Hjartaöng var metin með CCS-flokkun (Canadian Cardiovascular Society) og hjá sjúklingum með hjartabilun var notast við NYHA-flokkun (New York Heart Association). 15,16 EuroSCORE II (European System for Cardiac Operative Risk Evaluation) var reiknað fyrir alla sjúklingana, en það er alþjóðlegt áhaettulíkan sem metur líkurnar á dauða á fyrstu 30 dögum eftir hjartaaðgerð. 17 Hjartalyf sjúklings fyrir aðgerð voru skráð, meðal annars beta-hemlar, blóðflöguhemjandi og blóðfitulaekkandi lyf og blóðþynningarlyf. ...
Introduction:
Our objective was to investigate the effect of obesity on short-term complications and long-term survival after surgical aortic valve replacement (SAVR) for aortic stenosis (AS).
Material and methods:
A retrospective study on 748 patients who underwent SAVR for AS in Iceland 2003-2020. Patients were divided into groups based on body mass index (BMI): normal (18.5-24.9 kg/m2, n=190), overweight (25-29.9 kg/m2, n=339), obese (30-34.9 kg/m2, n=165) and severely obese (≥35 kg/m2, n=54). Six patients with BMI p<18,5 kg/m2 were excluded. Clinical information regarding patient history, risk factors, together with complications and 30-day mortality were collected from patient records. The four BMI groups were compared and long-term survival estimated with Kaplan-Meier plots and risk factors for long-term survival evaluated with Cox multivariate analysis.
Results:
Severely obese patients were on average four years younger than patients with normal BMI, more often had risk factors for cardiovascular disease, and their EuroSCORE II was higher (5.3 vs. 4.4%, p=0.03). On the other hand, severely obese patients bled less the first 24 hours post-surgery, compared to normal BMI-patients (558 vs. 1091 ml, p<0.001), stroke was less frequent (0 vs 6.4%, p=0.03), but they more often experienced sternum dehiscence (5.6 vs 2.7%, p=0.04), deep sternal wound infection (3.7 vs 0%, p=0.04) and acute kidney injury (26.4 vs 15.2%, p=0.005). Thirty-day mortality and long-term survival did not differ significantly between the groups and BMI was not an independent predictor of long-term survival in multivariate analysis.
Conclusions:
The outcome for obese patients undergoing SAVR for AS is good and both short-term complications and long-term survival do not differ significantly from patients with a normal BMI. Therefore, a high BMI itself should not be a contraindication for SAVR due to AS.
... Therefore, the severity of symptoms is crucial in guiding treatment decisions and in evaluating treatment effect [1]. Canadian Cardiovascular Society (CCS) grading is the most used tool to describe the severity of angina pectoris symptoms [2]. However, CCS is usually assessed by the treating physician, not by the patient. ...
... Both physician-and patient-reported CCS scores were recorded with four-class accuracy [2]. Class I represents angina only in strenuous exertion, class II angina in moderate and class III in mild exertion. ...
The primary aim of revascularization in stable coronary artery disease (CAD) is symptom relief. The severity of symptoms is usually evaluated by the physician, not by the patient. We examined the agreement between physician- and patient-reported Canadian Cardiovascular Society (CCS) scores among patients scheduled for elective coronary angiography in a cross-sectional study. Patients (n = 650) and cardiologists evaluated the severity of angina symptoms by filling the CCS questionnaire before coronary angiography. Patients were divided into those without CAD (stenosis diameter <50%, n = 445) and those with CAD (stenosis diameter >50%, n = 205). CAD patients were further divided into three groups according to disease severity (single-, double- or triple-vessel disease). The mean age of the patients was 67.6 (9.9) years and 50.6% were women. In 51.8% (95% CI 44.5%–59.0%) of patients with CAD and 51.9% (95% CI 47.0%–56.8%) of those without, physician- and patient reported CCS scores agreed. The physician reported better CCS scores in 33.9% (95% CI 27.6%–40.7%) of patients with CAD and 36.2% (95% CI 31.8%–41.0%) of patients without CAD. The proportions of full or partial agreement between physician- and patient reported CCS scores were similar across the CAD severity groups. To summarize, we observed a significant discrepancy between the physician- and patient-reported symptom severity in patients with or without CAD scheduled for angiography. The physician underestimated the symptoms in third of the cases. Thus, patient-reported symptom severity, rather than physician’s evaluation, should be the cornerstone of treatment decisions.
... Signs can be classified as particular of common angina, atypical angina, or noncardiac chest pain, depending on whether the chest pain qualities meet all 3, 2, or less than 2 of the aforementioned requirements, respectively (Diamond classification) (29) . The Canadian Cardiovascular Society (CCS)'s grading for angina severity has actually gotten widespread popularity ( Table 1) (30) . Anginal "equivalents," such as epigastric discomfort, fatigue, faintness, or dyspnea, might be the dominant sign in some patients, particularly elderly ones. ...
... Modified Canadian Cardiovascular Society Grading for Angina Severity(30) ...
Our main goal of this study was to examine the effective screening methods used in primary care for diagnosis of Coronary artery disease (CAD) (coronary heart disease (CHD)), and demonstrating also the prevention methods as well. We carried out a computerized searched via Cochrane Central Register of Controlled Trials (CENTRAL); MEDLINE (PubMed); and EMBASE, databases for studies reporting coronary heart disease screening and prevention in primary care any studies match these criteria and published up to December 2016 were included. Coronary artery disease (CAD) is the single most common cause of death in the developed world. Although private requirements for evaluating for CHD in medical care just reasonably efficient, in mix they can assist to decide about further management of patients with CHD in primary care.
... Angina and breathless symptoms were clinically assessed using the Canadian Cardiovascular Society score (Campeau 1976) ...
Objective: The purpose of this study was primarily to examine patients’ health related quality of life (HRQoL) and secondarily to examine the effect of comorbid illness on HRQoL five years after coronary artery bypass graft surgery (CABGS). Design: A prospective study using the Short‑Form 36 health survey (SF‑36) was performed. Setting: The study was performed at a central London hospital, United Kingdom. Subjects: From a previous study with 162 patients enrolled, one hundred and twenty‑eight (79%) agreed to participate in a follow‑up study five years after cardiac surgery by either a face‑to‑face or postal method. Intervention: Participants were asked to complete questionnaires about their HRQoL, current illnesses and medication five years after CABGS. Main outcome measures: Physical and mental HRQoL was recorded using a self report and the effect that comorbid illness has onHRQoL five years post CABGS was determined. Results: Fifty five percent of the sample reported concomitant illness at the time of follow‑up and lower scores were observed in the physical domains of the SF‑36 reflecting poorer HRQoL. The domains of physical functioning, physical role limitations, social functioning and bodily pain and the summary physical score were significantly lower in those with comorbid illness (p<0.001). Significantly higher rates of hospitalisation following CABGS were also noted. However no significant differences were observed in mental HRQoL (p=0.593) compared to those with no comorbid illness. Conclusion: The presence of comorbid illness impacts significantly on physical HRQoL five years after CABGS but no such effect is noted in mental wellbeing. From a nursing perspective, the importance of comorbid illness should be taken into account when planning physical activities after CABGS, when educating patients about the benefits of CABGS and when setting realisticexpectations after surgery.
... Angina class is assigned according to the Canadian Cardiovascular Society Classification (CCSC) [41]. ...
Background: Type A acute aortic dissection (TAAAD) is a deadly condition that demands immediate surgery, because it involves a patient in critical, unstable condition. The mortality and morbidity associated with it are significant, and it is vital that the patient's conditions and treatment strategies are fully understood to ensure the appropriate management of TAAAD. This study will definitively answer whether hemiarch repair (HAR) versus extended arch repair (EAR) with or without descending aortic intervention results in better perioperative and late outcomes for patients with TAAAD.
Methods: Four leading centers of cardiac surgery from two European countries have joined forces to create a groundbreaking multicenter observational registry (AoArch). This registry will enroll consecutive patients who underwent surgery for TAAAD from January 2005 to March 2024. We will analyze how patient comorbidities, referral conditions, and surgical strategies involving hemiarch repair (HAR) and extended arch repair (EAR) impact early and late adverse events. We have developed a procedure urgency algorithm based on the severity of preoperative hemodynamic conditions and malperfusion due to TAAAD, and we will use it to assess the primary clinical outcomes: in-hospital mortality, late mortality, and reoperations on the aorta. We will define secondary outcomes as permanent neurologic deficit, the need for new dialysis, respiratory failure, a composite of major adverse events (myocardial infarction, cerebrovascular accidents, the need for dialysis, or the need for tracheostomy), and a composite of major adverse pulmonary events (intubation over 48 hours, pneumonia, reintubation, tracheostomy), and reoperation due to bleeding.
Discussion: This multicenter registry will definitively determine the prognostic significance of critical preoperative conditions and the efficacy of extended arch interventions and hemiarch repair in reducing the risk of early adverse events after surgery for TAAAD. This registry will provide insights into the long-term durability of different strategies of surgical repair for TAAAD.
... Additionally, the interviewing research nurse or investigator evaluated the presence and severity of angina and dyspnea. Angina severity was assessed using the Canadian Cardiovascular Society (CCS) angina grading system, 16 • In this 10-year follow-up of the randomized controlled EXPLORE (Evaluating Xience and Left Ventricular Function in PCI on Occlusions After STEMI) trial, percutaneous coronary intervention for concurrent chronic total occlusion in patients with ST-segment-elevation myocardial infarction, compared with medical therapy for the chronic total occlusion, did not improve major adverse cardiovascular events or overall prognosis and was associated with higher cardiovascular mortality. • In contrast, percutaneous coronary intervention of a concurrent chronic total occlusion seemed to be associated with a reduction of dyspnea. ...
Background
The EXPLORE (Evaluating Xience and Left Ventricular Function in PCI on Occlusions After STEMI) trial was the first and only randomized trial investigating chronic total occlusion (CTO) percutaneous coronary intervention (PCI) early after primary PCI for ST‐segment–elevation myocardial infarction, compared with medical therapy for the CTO. We performed a 10‐year follow‐up of EXPLORE to investigate long‐term safety and clinical impact of CTO PCI after ST‐segment–elevation myocardial infarction, compared with no‐CTO PCI.
Methods and Results
In EXPLORE, 302 patients post‐ST‐segment–elevation myocardial infarction with concurrent CTO were randomized to CTO PCI within ≈1 week or no‐CTO PCI. We performed an extended clinical follow‐up for the primary end point of major adverse cardiac events, consisting of cardiovascular death, coronary artery bypass grafting, or myocardial infarction. Secondary end points included all‐cause death, angina, and dyspnea. Median follow‐up was 10 years (interquartile range, 8–11 years). The primary end point occurred in 25% of patients with CTO PCI and in 24% of patients with no‐CTO PCI (hazard ratio [HR], 1.11 [95% CI, 0.70–1.76]). Cardiovascular mortality was higher in the CTO PCI group (HR, 2.09 [95% CI, 1.10–2.50]), but all‐cause death was similar (HR, 1.53 [95% CI, 0.93–2.50]). Dyspnea relief was more frequent after CTO PCI (83% versus 65%, P =0.005), with no significant difference in angina.
Conclusions
This 10‐year follow‐up of patients post‐ST‐segment–elevation myocardial infarction randomized to CTO PCI or no‐CTO PCI demonstrated no clinical benefit of CTO PCI in major adverse cardiac events or overall mortality. However, CTO PCI was associated with a higher cardiovascular mortality compared with no‐CTO PCI. Our long‐term data support a careful weighing of effective symptom relief against an elevated cardiovascular mortality risk in CTO PCI decisions.
Registration
URL: https://www.trialregister.nl ; Unique identifier: NTR1108.
... Patients with a comorbidity identified as metastatic cancer process were grouped to the Metastatic Cancer variable. CABG patients whose CCS angina grade [12] was classified as Class 4A, 4B, or 4C in the CSBC cardiac surgery registry were grouped to Class 4. ...
Background: Prior research has shown that patients with stable ischemic heart disease who undergo delayed coronary artery bypass graft (CABG) surgery face higher mortality rates than those who receive CABG within the time recommended by physicians. However, this research did not account for percutaneous coronary intervention (PCI), a widely available alternative to delayed CABG in many settings. We sought to establish whether there was a difference in mortality between timely PCI and delayed CABG.
Methods: We identified 25,520 patients 60 years or older who underwent first-time non-emergency revascularization for angiographically-proven, stable left main or multi-vessel ischemic heart disease in British Columbia between January 1, 2001, and December 31, 2016. We estimated unadjusted and adjusted mortality after index revascularization or last staged PCI for patients undergoing delayed CABG compared to timely PCI.
Findings: After adjustment with inverse probability of treatment weights, at three years, patients who underwent delayed CABG had a statistically significant lower mortality compared with patients who received timely PCI (4.3% delayed CABG, 13.5% timely PCI; risk ratio 0.32, 95% CI 0.24 – 0.40).
Interpretation: Patients who undergo CABG with delay have a lower risk of death than patients who undergo PCI within appropriate time. Our results suggest that patients who wish to receive CABG as their revascularization treatment will receive a mortality benefit over PCI as an alternative strategy.
... Cardiac risk factors including smoking, obesity, hypertension, hyperlipidemia, diabetes, and positive family history as well as the presence of any further cardiac or somatic comorbidity were assessed. The severity of cardiac symptoms was measured through the New York Heart Association (NYHA) classification (24) and the Canadian Cardiovascular Society Classification (CCSC) (25). Both are selfreporting questionnaires: in the NYHA classification, patients rate the severity of their dyspnea, whereas the CCSC assesses chest pain. ...
Objective
Randomized controlled trials demonstrate the effectiveness of expectation-focused interventions in improving recovery outcomes following cardiac surgery. For dissemination in routine health care, it is important to capture the perspective of affected individuals. This qualitative study explores the perceived benefits and intervention-specific needs of patients who received expectation-focused intervention in the context of heart valve surgery. In addition, it explores potential barriers and adverse effects.
Methods
As part of an Enhanced Recovery After Surgery (ERAS) program within a multicentered randomized controlled trial, patients undergoing minimally invasive heart valve surgery received an intervention focused on their expectations. Six weeks after the intervention, semi-structured interviews were conducted with 18 patients to assess its feasibility, acceptance, barriers, benefits, and side effects. The transcribed interviews were analyzed using qualitative content analysis.
Results
The results indicate that both the intervention and the role of the patient and psychologist are key aspects in evaluating the expectation-focused intervention. Five key themes emerged from the patients’ perspective: personal needs, expectations and emotions, relationship, communication, and individuality. Patients valued the preparation for surgery and recovery and the space for emotions. Establishing a trustful relationship and addressing stigmatization were identified as primary challenges within the intervention.
Conclusion
Overall, patients experienced the expectation-focused intervention as helpful and no adverse effects were reported. Perceived benefits included enhanced personal control throughout the surgery and recovery, while the potential barrier of stigmatization towards a psychologist may complicate establishing a trustful relationship. Addressing personal needs, as a relevant topic to the patients, could be achieved through additional research to identify the specific needs of different patient subgroups. Enhancing the expectation-focused intervention could involve the implementation of a modular concept to address individual needs better.
... Data management, quality assurance and quality control Data management and quality assurance/quality control are conducted by a professional data management team and in cooperation with the Clinical Study Center of the See table 2 Concomitant medication See table 2 Clinical course See table 3 Clinical scales and scores Gender questionnaire (modified from Gender index) 40 See table 2 Modified Rankin Scale 41 See table 2 Barthel Index 52 See table 3 Canadian Cardiovascular Society Score (CCS) 53 See table 3 New York Heart Association classification (NYHA) See ...
Introduction
The Berlin Long-term Observation of Vascular Events is a prospective cohort study that aims to improve prediction and disease-overarching mechanistic understanding of cardiovascular (CV) disease progression by comprehensively investigating a high-risk patient population with different organ manifestations.
Methods and analysis
A total of 8000 adult patients will be recruited who have either suffered an acute CV event (CVE) requiring hospitalisation or who have not experienced a recent acute CVE but are at high CV risk. An initial study examination is performed during the acute treatment phase of the index CVE or after inclusion into the chronic high risk arm. Deep phenotyping is then performed after ~90 days and includes assessments of the patient’s medical history, health status and behaviour, cardiovascular, nutritional, metabolic, and anthropometric parameters, and patient-related outcome measures. Biospecimens are collected for analyses including ‘OMICs’ technologies (e.g., genomics, metabolomics, proteomics). Subcohorts undergo MRI of the brain, heart, lung and kidney, as well as more comprehensive metabolic, neurological and CV examinations. All participants are followed up for up to 10 years to assess clinical outcomes, primarily major adverse CVEs and patient-reported (value-based) outcomes. State-of-the-art clinical research methods, as well as emerging techniques from systems medicine and artificial intelligence, will be used to identify associations between patient characteristics, longitudinal changes and outcomes.
Ethics and dissemination
The study was approved by the Charité—Universitätsmedizin Berlin ethics committee (EA1/066/17). The results of the study will be disseminated through international peer-reviewed publications and congress presentations.
Study registration
First study phase: Approved WHO primary register: German Clinical Trials Register: https://drks.de/search/de/trial/DRKS00016852 ; WHO International Clinical Registry Platform: http://apps.who.int/trialsearch/Trial2.aspx?TrialID=DRKS00016852 . Recruitment started on July 18, 2017.
Second study phase: Approved WHO primary register: German Clinical Trials Register DRKS00023323, date of registration: November 4, 2020, URL: http://www.drks.de/ DRKS00023323. Recruitment started on January 1, 2021.
... A modified six-item version of the Canadian Cardiovascular Society's classification system for chest pain (Campeau, 1976) was used to assess self-reported chest pain during light to prolonged physical activities (e.g., dressing, carrying heavy objects). Higher scores indicate greater levels of chest pain. ...
The aim of this study was to determine whether learned helplessness, cognitive distortions, self-efficacy, and dispositional optimism assessed at Time 1 (T1; questionnaires mailed at 1 month postdischarge) would predict depressive symptoms at Time 2 (T2; questionnaires mailed at 1-year follow-up) in a sample of 86 patients hospitalized with ischemic heart disease. Multiple regression results indicated that optimism and cognitive distortions at T1 were significantly associated with T1 depressive symptoms after controlling for confounding variables. When the T1 psychological factors were analyzed with T2 depressive symptoms, only optimism continued to predict depressive symptoms after controlling for confounds and T1 depressive symptoms. The global expectancies that optimism assessed appeared to be more stable over time than the statelike beliefs of cognitive distortions and may have accounted for why optimism predicted T2 depressive symptoms.
... This places a patient in one of four categories based on how limited a patient is by breathlessness during physical activity (1 being no limitation and 4 representing limitation even at rest) [13]. The Canadian Cardiovascular Score used for angina is similar, with 4 grades based on the degree of activity that induces symptoms of angina [14]. Decisions on treatment (such as whether to alter medication or perform surgery) are often based on such categorisation despite their subjective and inaccurate nature. ...
Physical activity and cardiovascular disease (CVD) are intimately linked. Low levels of physical activity increase the risk of CVDs, including myocardial infarction and stroke. Conversely, when CVD develops, it often reduces the ability to be physically active. Despite these largely understood relationships, the objective measurement of physical activity is rarely performed in routine healthcare. The ability to use sensor-based approaches to accurately measure aspects of physical activity has the potential to improve many aspects of cardiovascular healthcare across the spectrum of healthcare, from prediction, prevention, diagnosis, and treatment to disease monitoring. This review discusses the potential of sensor-based measurement of physical activity to augment current cardiovascular healthcare. We highlight many factors that should be considered to maximise the benefit and reduce the risks of such an approach. Because the widespread use of such devices in society is already a reality, it is important that scientists, clinicians, and healthcare providers are aware of these considerations.
... Patients with a LRP and PE-DCB treatment will undergo clinical follow-up by an outpatient visit including repeat CAG after 9 months. During all follow-up moments, clinical evaluation of the angina class using the Canadian Cardiovascular Score (CCS) for angina pectoris [22], as well as the New York Heart Association (NYHA) class for heart failure [23] will be performed. All medications will be registered, with a specific focus on lipid-lowering medication. ...
Patients with non-obstructive lipid-rich plaques (LRPs) on combined intravascular ultrasound (IVUS) and near-infrared spectroscopy (NIRS) are at high risk for future events. Local pre-emptive percutaneous treatment of LRPs with a paclitaxel-eluting drug-coated balloon (PE-DCB) may be a novel therapeutic strategy to prevent future adverse coronary events without leaving behind permanent coronary implants. In this pilot study, we aim to investigate the safety and feasibility of pre-emptive treatment with a PE-DCB of non-culprit non-obstructive LRPs by evaluating the change in maximum lipid core burden in a 4 mm segment (maxLCBImm4) after 9 months of follow up. Therefore, patients with non-ST-segment elevation acute coronary syndrome underwent 3-vessel IVUS-NIRS after treatment of the culprit lesion to identify additional non-obstructive non-culprit LRPs, which were subsequently treated with PE-DCB sized 1:1 to the lumen. We enrolled 45 patients of whom 20 patients (44%) with a non-culprit LRP were treated with PE-DCB. After 9 months, repeat coronary angiography with IVUS-NIRS will be performed. The primary endpoint at 9 months is the change in maxLCBImm4 in PE-DCB-treated LRPs. Secondary endpoints include clinical adverse events and IVUS-derived parameters such as plaque burden and luminal area. Clinical follow-up will continue until 1 year after enrollment. In conclusion, this first-in-human study will investigate the safety and feasibility of targeted pre-emptive PE-DCB treatment of LRPs to promote stabilization of vulnerable coronary plaque at risk for developing future adverse events.
... • Angina de reposo prolongada (más de 20 minutos) • Angina de reciente comienzo que limite marca damente la capacidad física (al menos capacidad funcional III de la clasificación canadiense) (5) . ...
Coronary heart disease can manifest as stable or unstable forms, being these variations differentiated mainly by the underlying pathophysiological cause, their clinical presentation and the risk associated to each of these clinical presentations. In the unstable form, nowadays known as acute coronary syndrome, recommendations over its characterization and particularly its management are periodically updated in published international guidelines about this topic. Their epidemiological relevance makes important that these aspects should be known by anyone that sees patients in their practices, motivating this review in which we will summarize aspects of the clinical presentation, initial studies and management of the acute coronary syndrome without ST segment elevation emphasizing novelties from the last few years.
... The Canadian Cardiovascular Society classification was used to grade angina symptoms. 8 Written and oral consent was obtained for each participant before the examination. ...
We investigated whether prediabetes diagnosed by hemoglobinA1c (HbA1c) or oral glucose tolerance test (OGTT) could predict presence and severity of coronary artery disease (CAD) in symptomatic patients. The presence of plaque, stenosis, plaque characteristics, and coronary artery calcium (CAC) were evaluated by coronary CT angiography in 702 patients with suspicion of CAD. Patients were classified by glycemic status using the American Diabetes Association criteria for HbA1c and OGTT, and compared to their respective normal ranges. Prediabetes was observed in 24% by HbA1c and 72% by OGTT. Both prediabetes classifications were associated with increased presence of plaque, stenosis, calcified plaques, CAC >400, and a lower frequency of zero CAC compared to their respective normal range (all, p < 0.05). After adjusting for potential confounders, patients with HbA1c-prediabetes had an odds ratio of 2.1 (95% CI: 1.3-3.5) for CAC >400 and 1.5 (95% CI: 1.0-2.4) for plaque presence, while none of the associations for OGTT-prediabetes were significant. The receiver operating characteristic-curve for HbA1c-prediabetes showed an area under the curve of 0.81 for CAC >400 and 0.77 for plaque presence. Prediabetes defined by HbA1c predicts presence and severity of CAD. Although OGTT identified more patients with prediabetes, their risk of CAD were not explained by prediabetes using these diagnostic-criteria.
... See • Major [9] • Unstable coronary syndromes ...
Management of the patient who underwent trauma involves simultaneous interaction buy different physicians and surgeons. The physician, surgeon and anesthesiologist usually form a team, all of whom bring their different perspective and expertise for treatment of the patient. This starts a series of events that culminates in medical evaluation, anesthetic assessment, preoperative assessment, perioperative management and post operative management of the patient as a whole. The evaluation of any trauma patient begins with evaluating the airway, accessing the breathing, and managing the circulation. After deep initial management of the patient either surgical or medical, prognosis of patient depends on follow up monitoring and care, as mortality in such patients is very high due to complications as listed below, whose early diagnosis and management will be discussed in detail in our chapter: inadequate resuscitation; delays in diagnosis and treatment; intra-abdominal sepsis; deep vein thrombosis, pulmonary embolism and thromboembolic events; hematological disorders like anemias, bleeding disorders, thrombocytopenia etc.; cardiac complications like arrhythmias, stress cardiomyopathy etc.; pulmonary and gastrointestinal complications like HAP, paralytic ileus, GERD etc.; metabolic disorders like acidosis, alkalosis, dyselectrolemia etc.; trauma complicated due to pregnancy, addictions and comorbid conditions like DM, HTN etc.
... Complete revascularization was defined as successful treatment of the subject vessel and presence of no lesion of more than 70% stenosis in the remaining coronary arteries or grafted vessel supplying a territory with severe stenosis. Angina class was defined as the Canadian Cardiovascular Society grading of angina pectoris (CCS Functional Classification of Angina) which classified the severity of exertional angina (Campeau, 1976). For statistical analysis, SPSS 21 was used, and comparisons were performed using Chi square, student t-test, logistic regression, and categorical variable comparison tests. ...
After coronary artery bypass graft surgery (CABGs), repeat revascularization is often necessary due to progressive atherosclerosis of coronary arteries and grafts, poor patency, limited longevity, and higher risk of redo CABGs. However, data regarding percutaneous revascularization among post-CABGs patients are limited. In this cohort study, 83 subjects with a history of CABGs and recent percutaneous coronary intervention (PCI) at Ekbatan
... Stable angina severity was assessed according to the Canadian Cardiovascular Society angina (CCSA) classification. (10) The diagnosis of coronary artery disease included angina pectoris CCSA classes II-IV and documented history of previous myocardial infarction. ...
The aim of this study was to assess the prevalence, structure, and influence of anemic syndrome on the main health indicators of patients with coronary heart disease (CHD), including the main QOL parameters. Methods and Results: The study included 1210 patients (309 men and 901 women) with an average age of 67.57±9.35 years who were registered at the dispensary with CHD (angina pectoris CCSA classes II-IV) in 2 Regional Hospitals. With the help of the computer program “Monitoring system for patients with anemia syndrome,” medical records from 2 randomly selected primary care areas were analyzed. The data directly related to anemia, comorbid pathology, and previous treatment formed the main part of the statistical data. The QOL was evaluated using the 36-Item Short Form Survey (SF-36) questionnaire. The FACT-An questionnaire was used to account for the characteristic symptoms, and their severity, accompanying anemia. Our findings indicate the presence of anemia in 500(41.3%) patients (355/71% women and 145/29% men). The average age of the patients with diagnosed anemia was 65.34±6.37 years in men and 63.49±7.05 years in women. Anemia of mild severity was observed in 410(82%) patients, moderate severity in 75(15%) patients, and severe anemia in 15(3%) patients. IDA was detected in 467(93.4%) cases and B12-deficiency anemia in 33(6.6%) cases. We found a negative correlation between the blood iron level and age (r=-0.56, P<0.05), which can indirectly indicate the progression of latent iron deficiency with age in CHD patients. All 500 CHD patients with anemia were included in Group 1. Group 2 included 710 CHD patients without anemia. In Groups 1 and 2, angina severity according to CCSA classification was as follows: CCSA class II - 186(37.2%) and 456(64.2%) cases (P=0.000), CCSA class III – 248(49.6%) and 196(27.6%) cases (P=0.000), and CCSA class IV - 66(13.2%) and 58(8.2%) cases (P=0.005), respectively. Group 1 patients, in contrast to Group 2 patients, had the following characteristic clinical features: palpitation (48.2% vs. 35.0%, P=0.000), higher HR (81±9.5 bpm vs. 71.8±8.7 bpm, P=0.000) and respiratory rate (18.9±1.1 vs 18.3±1.2 per minute, P=0.000). The assessment of the impact of anemia on QOL by FACT-An revealed a statistically lower score in Group 1 than in Group 2 (32.0±5.7 vs. 44.0±6.5, P=0.000). We found a positive correlation between the Hb level and the average FACT-An score (r=0.54, P<0.05) Patients in Group 1 demonstrated a low level of QOL in the physical and mental domains, according to SF-36, in comparison with Group 2. Correlation analysis revealed a direct relationship between the Hb level and the average score of the PF (physical functioning) scale (r=0.52, P<0.05)) and PCS (physical component summary) (r=0.38, P<0.05)) of the SF-36 questionnaire. The observed high incidence of anemic syndrome in CHD patients with angina pectoris (CCSA class II-IV) requires special attention due to the high impact on the QOL of patients and aggravation of the course of the underlying disease.
... Impaired kidney function was defined as a preoperative estimated glomerular filtration rate (eGFR) < 60 ml/ min/1.73m 2 , regardless of the stage of albuminuria. Clinical symptoms of heart failure and angina were classified according to the New York Heart Association (NYHA) functional classification [13] and Canadian Cardiovascular Society (CCS) grading system [14], respectively. As almost all patients had received a preoperative echocardiograph, we could estimate the 30-day mortality by calculating the EuroSCORE II [15]. ...
Introduction
Non-infectious sternal dehiscence (NISD) is a known complication following coronary artery bypass grafting (CABG), with previous studies estimating an incidence of 0.4–1% of surgeries. We aimed to study the incidence of NISD together with short- and long-term outcomes in a whole-nation cohort of patients.
Materials and methods
A retrospective study on consecutive CABG patients diagnosed with NISD at Landspitali from 2001 to 2020. Patients diagnosed with infectious mediastinitis (n = 20) were excluded. NISD patients were compared to patients with an intact sternum regarding patient demographics, cardiovascular risk factors, intra- and postoperative data, and estimated overall survival. The median follow-up was 9.5 years.
Results
Twenty out of 2280 eligible patients (0.88%) developed NISD, and the incidence did not change over the study period (p = 0.98). The median time of diagnosis was 12 days postoperatively (range, 4–240). All patients were re-operated using a Robicsek-rewiring technique, with two cases requiring a titanium plate for fixation. Patients with NISD were older, had a higher BMI and EuroSCORE II, lower LVEF, and more often had a history of COPD, MI, and diabetes compared to those without NISD. Length of stay was extended by 15 days for NISD patients, but short and long-term survival was not statistically different between the groups.
Conclusions
The incidence of NISD was low and in line with previous studies. Although the length of hospital stay was extended, both short- and long-term survival of NISD patients was not significantly different from patients with an intact sternum.
... The inclusion criteria for this study were as follows: (a) a history of PCI, (b) symptoms of recurrent angina, graded by Canadian Cardiovascular Society (CCS) Angina Classes of CCS I to III [9], (c) resting left ventricular ejection fraction (LVEF) ≥ 35 %, (d) positive symptoms in myocardial perfusion scanning, (e) a positive symptom in TET, (f) a normal coronary angiogram (the residual stenosis in epicardial coronary artery < 30 %). ...
Purpose: To analyze intravenous administration of anisodamine’s impact on coronary microvasculardysfunction (CMD) in obstructive epicardial coronary artery disease (CAD) patients who had undergone percutaneous coronary intervention (PCI).Methods: Enrollment of 210 patients in Shanghai Chest Hospital, Shanghai Jiaotong University with CMD was done in a randomized-controlled study. They were divided randomly into groups, viz, anisodamine (A) group and nitrate (N) group. A 14-day course of treatment was carried out in each group. 99mTc-MIBI myocardial perfusion imaging (MPI), treadmill exercise test (TET) and two dimensional echocardiography (TDE) were performed, and the symptoms of angina pectoris were recorded before and after treatment according to the classification, frequency, and duration of angina, as defined by Canadian Cardiovascular Society (CCS).Results: After treatment, summed stress score (SSS) and summed rest score (SRS) of MPI in group A significantly decreased after treatment (p < 0.001, respectively) and were remarkably lower than those in group N (p < 0.001, respectively). The CCS class in group A improved after treatment (p < 0.001) and was also better than in group N (p < 0.001). The frequency and duration of angina attack in group A significantly reduced after treatment (p < 0.001, respectively) and were notably lower than in group N (p < 0.001, respectively). Left ventricular ejection fraction in group A after treatment was higher than that before treatment (p = 0.046) and than that in group N (p = 0.048). Furthermore, the side effects of anisodamine were slight and tolerable.Conclusion: Intravenous administration of anisodamine is a potentially suitable optional treatment for CMD in patients with obstructive epicardial CAD who have undergone PCI.
... Symptoms and functional capacity were assessed using the Canadian Cardiovascular Society angina grading system, 17 the New York Heart Association classification system, 18 the Nottingham Extended Activities of Daily Living Scale, 19 and the 6-minute walk test. 20 Cognitive function was assessed using the Mini-Mental State Examination. ...
Importance: transcatheter aortic valve implantation (TAVI) is a less invasive alternative to surgical aortic valve replacement and is the treatment of choice for patients at high operative risk. The role of TAVI in patients at lower risk is unclear.
Objective: to determine whether TAVI is noninferior to surgery in patients at moderately increased operative risk.
Design, Setting, and Participants: in this randomized clinical trial conducted at 34 UK centers, 913 patients aged 70 years or older with severe, symptomatic aortic stenosis and moderately increased operative risk due to age or comorbidity were enrolled between April 2014 and April 2018 and followed up through April 2019.
Interventions : TAVI using any valve with a CE mark (indicating conformity of the valve with all legal and safety requirements for sale throughout the European Economic Area) and any access route (n = 458) or surgical aortic valve replacement (surgery; n = 455).
Main Outcomes and Measures: the primary outcome was all-cause mortality at 1 year. The primary hypothesis was that TAVI was noninferior to surgery, with a noninferiority margin of 5% for the upper limit of the 1-sided 97.5% CI for the absolute between-group difference in mortality. There were 36 secondary outcomes (30 reported herein), including duration of hospital stay, major bleeding events, vascular complications, conduction disturbance requiring pacemaker implantation, and aortic regurgitation.
Results: among 913 patients randomized (median age, 81 years [IQR, 78 to 84 years]; 424 [46%] were female; median Society of Thoracic Surgeons mortality risk score, 2.6% [IQR, 2.0% to 3.4%]), 912 (99.9%) completed follow-up and were included in the noninferiority analysis. At 1 year, there were 21 deaths (4.6%) in the TAVI group and 30 deaths (6.6%) in the surgery group, with an adjusted absolute risk difference of −2.0% (1-sided 97.5% CI, −∞ to 1.2%; P < .001 for noninferiority). Of 30 prespecified secondary outcomes reported herein, 24 showed no significant difference at 1 year. TAVI was associated with significantly shorter postprocedural hospitalization (median of 3 days [IQR, 2 to 5 days] vs 8 days [IQR, 6 to 13 days] in the surgery group). At 1 year, there were significantly fewer major bleeding events after TAVI compared with surgery (7.2% vs 20.2%, respectively; adjusted hazard ratio [HR], 0.33 [95% CI, 0.24 to 0.45]) but significantly more vascular complications (10.3% vs 2.4%; adjusted HR, 4.42 [95% CI, 2.54 to 7.71]), conduction disturbances requiring pacemaker implantation (14.2% vs 7.3%; adjusted HR, 2.05 [95% CI, 1.43 to 2.94]), and mild (38.3% vs 11.7%) or moderate (2.3% vs 0.6%) aortic regurgitation (adjusted odds ratio for mild, moderate, or severe [no instance of severe reported] aortic regurgitation combined vs none, 4.89 [95% CI, 3.08 to 7.75]).
Conclusions and Relevance: among patients aged 70 years or older with severe, symptomatic aortic stenosis and moderately increased operative risk, TAVI was noninferior to surgery with respect to all-cause mortality at 1 year.
Background—The AAMS open-label clinical study demonstrated safety and feasibility of epicardial transplantation of autologous right atrial appendage micrografts (AAMs) during coronary artery bypass grafting (CABG) surgery. Delivered in an extracellular matrix patch, the study also provided first indications of reduced ischemic scar and increased live ventricular wall thickness associated with AAMs therapy. To further evaluate the initial beneficial effects observed in the AAMS study, we designed the randomized, double-blinded, and placebo-controlled AAMS2 trial. Focusing on patients with ischemic heart failure with reduced ejection fraction (iHFrEF), the AAMS2 trial aims to generate state-of-the-art structural and functional imaging data on the myocardium treated with an AAMs-patch during CABG.
Methods—The AAMS2 trial recruits iHFrEF patients who are set to undergo non-urgent CABG and present with a myocardial scar in preoperative cardiac magnetic resonance (CMR) with late gadolinium enhancement. Patients are randomized evenly (1:1) to receive an collagen-based matrix patch (Hemopatch®), with or without AAMs, epicardially onto the scar border. The primary endpoints at 6 months post-operatively are the effect change on the myocardial scar size by the AAMs-patch transplantation site, as assessed by CMR with late gadolinium enhancement and change in blood N-terminal-pro-BNP in the timeframe. The trial’s secondary endpoints address feasibility, safety, echocardiography, quality of life, symptom scaling, and 6-minute walk test.
Discussion—Data from the AAMS2 trial provide the first randomized, blinded, and placebo-controlled evaluation of efficacy on epicardial AAMs transplantation for iHFrEF. This data then enables the rational design of larger AAMs therapeutic efficacy-addressing trial(s).
Trial Registration: ClinicalTrials.gov, NCT05632432, registered 30 November 2022, https://clinicaltrials.gov/study/NCT05632432
Introducción: La angina crónica refractaria es definida como el dolor torácico por insuficiencia coronaria que no puede ser controlada por la medicación habitual ni por las técnicas de revascularización, pero sí por la estimulación medular. Material y método: Entre 1999 y 2000 a tres pacientes con edades entre 52 y 62 años y ubicados en las clases III y IV, según la Clasificación Funcional de la New York Heart Association (NYHA-FC), se les sometió a estimulación medular con un electrodo tetrapolar tipo placa colocado en el espacio epidural a nivel de T1, paramediano izquierdo, a través de una minilaminectomía medial; luego, en ese mismo tiempo quirúrgico, se conectó el electrodo a un generador de pulsos programable. Todos habían tenido por lo menos una cirugía de puente aorto coronario. Una de los pacientes era portadora del síndrome X coronario; los otros dos, varones, tenían dolor anginoso severo. Resultados: En un seguimiento a largo a largo plazo se observó una mejoría según la NYHA-FC (de 3,5 a 2,2) y los puntajes de la EVA. No hubo complicaciones y los exámenes clínicos demostraron claramente una mejoría en la calidad de vida y en la realización de actividad física, mejoría del segmento ST en el ECG, disminución significativa de la ingesta de nitratos y reducción en el tiempo y frecuencia de los períodos e internamiento hospitalario. Conclusiones: Aunque pequeño este estudio, demuestra el efecto beneficioso de la EM para la angina crónica refractaria. Este procedimiento es considerado como tratamiento adicional de primera línea para estos pacientes por la European Society of Cardiology y un comité conjunto de la American College of Cardiology y la American Heart Association le asigna un nivel de evidencia Clase IIB.
Cardiovascular diseases (CVDs) are the leading cause of death and include several vascular and cardiac disorders, such as atherosclerosis, coronary artery disease, cardiomyopathies, and heart failure. Multiple treatment strategies exist for CVDs, but there is a need for regenerative treatment of damaged heart. Stem cells are a broad variety of cells with a great differentiation potential that have regenerative and immunomodulatory properties. Multiple studies have evaluated the efficacy of stem cells in CVDs, such as mesenchymal stem cells and induced pluripotent stem cell-derived cardiomyocytes. These studies have demonstrated that stem cells can improve the left ventricle ejection fraction, reduce fibrosis, and decrease infarct size. Other studies have investigated potential methods to improve the survival, engraftment, and functionality of stem cells in the treatment of CVDs. The aim of the present review is to summarize the current evidence on the role of stem cells in the treatment of CVDs, and how to improve their efficacy.
BACKGROUND
Hypertrophic cardiomyopathy (HCM) is an important cause of sudden cardiac death associated with heterogeneous phenotypes, but there is no systematic framework for classifying morphology or assessing associated risks. Here, we quantitatively survey genotype-phenotype associations in HCM to derive a data-driven taxonomy of disease expression.
METHODS
We enrolled 436 patients with HCM (median age, 60 years; 28.8% women) with clinical, genetic, and imaging data. An independent cohort of 60 patients with HCM from Singapore (median age, 59 years; 11% women) and a reference population from the UK Biobank (n=16 691; mean age, 55 years; 52.5% women) were also recruited. We used machine learning to analyze the 3-dimensional structure of the left ventricle from cardiac magnetic resonance imaging and build a tree-based classification of HCM phenotypes. Genotype and mortality risk distributions were projected on the tree.
RESULTS
Carriers of pathogenic or likely pathogenic variants for HCM had lower left ventricular mass, but greater basal septal hypertrophy, with reduced life span (mean follow-up, 9.9 years) compared with genotype negative individuals (hazard ratio, 2.66 [95% CI, 1.42–4.96]; P <0.002). Four main phenotypic branches were identified using unsupervised learning of 3-dimensional shape: (1) nonsarcomeric hypertrophy with coexisting hypertension; (2) diffuse and basal asymmetrical hypertrophy associated with outflow tract obstruction; (3) isolated basal hypertrophy; and (4) milder nonobstructive hypertrophy enriched for familial sarcomeric HCM (odds ratio for pathogenic or likely pathogenic variants, 2.18 [95% CI, 1.93–2.28]; P =0.0001). Polygenic risk for HCM was also associated with different patterns and degrees of disease expression. The model was generalizable to an independent cohort (trustworthiness, M 1 : 0.86–0.88).
CONCLUSIONS
We report a data-driven taxonomy of HCM for identifying groups of patients with similar morphology while preserving a continuum of disease severity, genetic risk, and outcomes. This approach will be of value in understanding the causes and consequences of disease diversity.
BACKGROUND
Ischemic heart disease is a leading cause of death worldwide, and coronary artery bypass grafting (CABG) is a major treatment. Landiolol is an ultra–short-acting beta-antagonist known to prevent postoperative atrial fibrillation. However, the effectiveness of intraoperative landiolol on mortality remains unknown. This study aimed to evaluate the association between intraoperative landiolol use and the in-hospital mortality in patients undergoing CABG.
METHODS
To conduct this retrospective cohort study, we used data from the Japanese Diagnosis Procedure Combination inpatient database. All patients who underwent CABG during hospitalization between July 1, 2010, and March 31, 2020, were included. Patients who received intraoperative landiolol were defined as the landiolol group, whereas the other patients were defined as the control group. The primary outcome was in-hospital mortality. Propensity score matching was used to compare the landiolol and control groups.
RESULTS
In total, 118,506 patients were eligible for this study, including 25,219 (21%) in the landiolol group and 93,287 (79%) in the control group. One-to-one propensity score matching created 24,893 pairs. After propensity score matching, the in-hospital mortality was significantly lower in the landiolol group than that in the control group (3.7% vs 4.3%; odds ratio 0.85; 95% confidence interval 0.78 to 0.94; P = .010).
CONCLUSIONS
Intraoperative landiolol use was associated with decreased in-hospital mortality in patients undergoing CABG. Further randomized controlled trials are required to confirm these findings.
We present the rationale and design of a master protocol study that clarifies the effectiveness and safety of Chinese herbal formulas on -stagnation and blood-stasis pattern (QBP). Three randomized controlled trials (RCTs) and real-world observational studies. Based on three registry cohorts of stable angina, tension-type headache and primary dysmenorrhea, patients with QBP will be enrolled in RCTs to receive either Xuefu Zhuyu (, XFZY) oral liquid or a placebo, while patients with non-QBP will be enrolled in the observational studies and experience follow-up. 1414 patients (RCTs: 574; observational studies: 840) will be recruited at seven centers in China over a 3-year period. The primary outcome is the visual analog scale of pain intensity. Adverse events will also be reported. The analysis will be undertaken separately in each sub-study, and then an overall analysis combining multiple subgroups will be performed to comprehensively investigate the effect of XFZY oral liquid. This study will provide high-quality evidence of XFZY oral liquid for QBP patients and show a paradigm of post-marketing evaluation of the effectiveness and safety for Chinese medicine following the notion of the pattern dominating different disease research models.
Angina pectoris is the leading symptom of coronary artery disease: it is described as an acute chest pain, or pressure, or burning; typical angina is characterized by a retrosternal chest discomfort radiating to the left arm, both arms, the right arm, the neck, or the jaw. Medical history and physical examination are essential to establish the clinical likelihood of ischaemic heart disease: clinical findings, together with laboratory and instrumental tests, help in stratifying the patient’s risk and defining the subsequent diagnostic and therapeutic options. In this chapter, we evaluate the standard clinical procedures of anginal syndromes, including acute and chronic coronary syndromes.KeywordsAngina pectorisAnginal syndromesClinical evaluation
Background:
This study aimed to determine whether a high level of high-sensitivity troponin T (hsTnT) predicts a positive treadmill test in patients with suspected stable ischemic heart disease (SIHD).
Methods:
In all, 366 patients with suspected SIHD were included in the study. We measured the serum hsTnT levels before the treadmill test. The treadmill test was performed according to the Bruce protocol.
Results:
Of the 366 patients, 97 had positive treadmill tests. The hsTnT levels were significantly higher in the positive group than in the negative group. In the binary logistic regression analysis, hsTnT, pretest probability, metabolic equivalents (METs), target heart rate (THR) percentage, and Duke treadmill score (DTS) were independent predictors of a positive treadmill test [hsTnT odds ratio (OR): 2.178, P < 0.001; pretest probability OR: 1.036, P = 0.007; METs OR: 0.755, P = 0.008; THR OR: 0.773, P < 0.001; DTS OR: 2.661, P = 0.012]. In the receiver operating characteristic (ROC) curve analysis, the area under the curve (AUC) value of the model with the combined parameters of hsTnT, pretest probability, METs, THR, and DTS was statistically significant in predicting a positive treadmill test [combined model AUC: 0.945 (0.922-0.968), P < 0.001].
Conclusions:
In sum, high pretest hsTnT levels predicted a positive treadmill test in patients with suspected SIHD. Analysis of the hsTnT levels before the treadmill test can increase the sensitivity and specificity of the treadmill test. The methods for measuring hsTnT levels are cheap and easily accessible and can be used before the treadmill test in patients with suspected SIHD.
Coronary artery disease (CAD) is a serious health problem that causes a considerable number of mortality in a number of affluent nations throughout the world. The estimated death encountered in many developed countries includes including Pakistan, reached 111,367 and accounted for 9.87% of all deaths, despite the mortality rate being around 7.2 million deaths per year, or 12% of all estimated deaths accounted annually around the globe, with improved health systems. Atherosclerosis progressing causes the coronary arteries to become partially or completely blocked, which results in CAD. Additionally, smoking, diabetes mellitus, homocystinuria, hypertension, obesity, hyperlipidemia, and psychological stress are risk factors for CAD. The symptoms of CAD include angina which is described as a burning, pain or discomfort in the chest, nausea, weakness, shortness of breath, lightheadedness, and pain or discomfort in the arms or shoulders. Atherosclerosis and thrombosis are the two pathophysiological pathways most frequently involved in acute coronary syndrome (ACS). Asymptomatic plaque disruption, plaque bleeding, symptomatic coronary blockage, and myocardial infarction are the prognoses for CAD. In this review, we will focus on medicated therapy which is being employed for the relief of angina linked with CAD including antiplatelet medicines, nitrates, calcium antagonists, blockers, catheterization, and the frequency of recanalized infarct-related arteries in patients with acute anterior wall myocardial infarction (AWMI). Furthermore, we have also enlightened the importance of biomarkers that are helpful in the diagnosis and management of CAD.
The Task Force on the Management of Stable Angina Pectoris of the European Society of Cardiology
Objective:
to determine which changes of cardiovascular system clinical, and structural, and functional state in emergency workers (EW) of the accident at the Chornobyl nuclear power plant (CNNP) can be associated with COVID-19 they suffered from and not with the natural progression of coronary heart disease (CHD).
Materials and methods:
The study included 16 male EW who fell ill with mild and medium-severe COVID-19 (EWC group) in 2020-2021, which was confirmed by a PCR test (polymerase chain reaction). All these patients were observed in the NRCRM cardiology department before infection with the coronavirus. The comparison group consisted of 32 EW who did not suffer from COVID-19 and their age and examination dates corresponded to EWC. General clinical, laboratory, statistical methods and Doppler echocardiography were used for patients examination.
Results:
In the post-covid period, EW-C observed a worsening of CHD clinical course, which consisted in an increase in the number of patients with severe functional class angina pectoris, with ventricular and supraventricular extrasystoles, as well as with more severe heart failure (HF). Since similar changes in the state of the cardiovascular system were found among EW who did not suffer from COVID-19, they can be attributed to the natural progression of CHD. In the EW-C group, there was an increase in the number of patients with atrial fibrillation (AF) by 4 times (up 37.5 %), while in the comparison group EW only by 1.1 times (up 3.1 %). The progression of CHD and HF in the examined patients was accompanied by an increase in the end-diastolic and end-systolic volumes of the left ventricle and the mass of the myocardium, the severity of which was not significantly different in patients with and without COVID-19. The number of post-covid patients with reduced ejection fraction (EF) during examination after COVID-19 increased by 31.3 %, and in the group of EW, which were examined at the same time, by 6.32 %.
Conclusions:
A significant increase in the number of patients with AF and a reduced EF in the EW-C compared with the EW can be attributed to the results of the SARS-CoV-2 virus influence on cardiovascular system.
Introduction
Coronary artery bypass grafting can be conducted using the radial artery as a bypass graft. However, it remains unclear which harvesting method is superior, i.e. endoscopic or open radial artery, and which site for proximal anastomosis of the radial artery has the greatest benefits?
Methods
The NEO Trial is a single site randomised clinical trial with a 2 × 2 factorial design. The first comparison assesses endoscopic versus open radial artery harvest with a primary outcome of hand function and secondary outcomes of neurological deficits through clinical exams and neurophysiological studies. The primary outcome is postoperatively hand function at three months. We anticipate a mean difference of 3 points with a standard deviation of 8 points, a power of 90%, and a type I error of 5%, resulting in a required sample size of 300 participants randomised 1:1. Secondary outcomes are neurological deficits (based on nerve conduction measurements, algometry test and von Frey hair test), clinical neurological examination of cutaneous sensibility, and registration of complications in the donor arm (haematoma formation, wound dehiscence, and/or infection).
The second comparison assesses two different proximal anastomotic sites, i.e. aorto-radial anastomosis versus mammario-radial anastomosis. The primary outcome is a composite of cerebrovascular events and the secondary outcome is graft patency evaluation by multi-slice computer tomography-scan. These outcomes will be assessed at 1 year postoperatively, and the results of this comparison will be exploratory only. Both comparisons will be analysed using intention-to-treat and intervention groups will be compared using linear regression, logistic regression, or Mann–Whitney U test depending on data type.
Two independent statisticians will follow the present plan and conduct the analyses which will hereafter be fused into a final analysis based on consensus.
Conclusion
This detailed analysis plan will increase the validity of the NEO trial results by predefining the statistical analysis in detail.
Trial registration
ClinicalTrials.gov identifier: NCT01848886 . Registered 25 February 2013. Danish Ethics committee number: H-3–2012-116. Danish Data Protection Agency: 2007–58-0015/jr. n:30–0838.
Objective:
Surgical aortic valve replacement (SAVR) has been the standard of care for severe aortic stenosis. In 2019, annual transcatheter aortic valve replacement (TAVR) implantations surpassed SAVR. We compared in-hospital costs and outcomes between these two procedures.
Methods:
A single-center retrospective review was performed of patients who underwent isolated SAVR or TAVR from October 2013 to December 2019. Baseline patient characteristics, operating room (OR) time, intensive care unit (ICU) length of stay (LOS), total LOS, cumulative cost, and complication rates were collected. Propensity matching was performed to identify differences in costs and outcomes between comparable groups.
Results:
There were 515 patients who met inclusion criteria. TAVR was performed in 402 patients, while SAVR was performed in 113. Propensity matching resulted in 82 matched pairs. The SAVR cohort more frequently spent >1 day in the ICU, had longer total hospital LOS, longer OR time, and higher hospitalization cost. However, TAVR was associated with higher mean OR cost and higher valve cost. The cumulative index admission costs were not significantly different between groups. TAVR patients had less postoperative atrial fibrillation but more frequent pacemaker placement. One-year mortality was similar between SAVR (2.4%) and TAVR (3.8%), but 3-year (5.8% vs 19.2%) and 5-year (5.8% vs 37.2%) mortality favored SAVR.
Conclusions:
In propensity-matched groups, TAVR was associated with shorter ICU and hospital LOS and OR times but increased permanent pacemaker rates. In addition, while 1-year survival was similar between groups, SAVR had significantly improved 3-year and 5-year survival.
This resource contains a series of challenging concepts in cardiovascular medicine covering all subspecialty areas. Each case provides an in-depth review of current practice, the application of national and international guidelines and a summary of evidence from the medical literature, and is punctuated by 'Clinical Tips', 'Learning Points' and 'Landmark Trial Summaries' to enhance the learning process alongside an 'Expert Commentary' written by internationally-renowned leaders in the field of cardiology.
Background: Intravascular lithotripsy (IVL) delivers acoustic pressure waves to modify calcium, enhance vessel compliance, and optimize stent deployment. The Disrupt CAD IV study enrolled patients with severe coronary artery calcification and demonstrated low 30-day major adverse cardiovascular events (MACE) and high procedural success following IVL with no final serious angiographic complications. To date, long-term outcomes have not been reported. This analysis evaluates 1-year outcomes of Disrupt CAD IV.
Methods and Results: Disrupt CAD IV was a prospective single-arm multicenter study of IVL performed in a Japanese population with severe coronary artery calcification. Main outcomes included MACE (a composite of cardiac death, myocardial infarction [MI], or target vessel revascularization [TVR]), and target lesion failure (TLF; a composite of cardiac death, target vessel MI, and target lesion revascularization [TLR]) at 1 year. Compliance with patient follow-up at 1 year was 100%. MACE occurred in 9.4% of patients (cardiac death 0.0%, MI 6.3%, TVR 4.7%) and TLF occurred in 6.3% of patients, with both rates driven by non-Q wave MIs (6.3%). The TLR rate at 1 year was 1.6% and no stent thrombosis events were reported.
Conclusions: Treatment of severely calcified coronary lesions with IVL was associated with low rates of 1-year MACE and TLR, suggesting durable safety and effectiveness of IVL-facilitated coronary stent implantation in severely calcified lesions in a Japanese population.
Introduction
Coronary artery bypass grafting can be conducted using the radial artery as a bypass graft. However, it remains unclear, which harvesting method is superior, i.e. endoscopic or open radial artery, and which site for proximal anastomosis of the radial artery has the greatest benefits?
Methods
The NEO Trial is a single site randomised clinical trial with a 2x2 factorial design. The first comparison assesses endoscopic versus open radial artery harvest with a primary outcome of hand function and secondary outcomes of neurological deficits through clinical exams and neurophysiological studies. The primary outcome is postoperatively hand function at three months. We anticipate a mean difference of 3 points with a standard deviation of 8 points, a power of 90%, and a type I error of 5%, resulting in a required sample size of 300 participants randomised 1:1. Secondary outcomes are neurological deficits (based on nerve conduction measurements, algometry test, von Frey hair test), clinical neurological examination of cutaneous sensibility, and registration of complications in the donor arm (haematoma formation, wound dehiscence, and/or infection).
The second comparison assesses two different proximal anastomotic sites, i.e. aorto-radial anastomosis versus mammario-radial anastomosis. The primary outcome is a composite of cerebrovascular events and the secondary outcome is graft patency evaluation by multi-slice computer tomography-scan. These outcomes will be assessed at 1 year postoperatively and the results of this comparison will be exploratory only.
Two independent statisticians will follow the present plan and conduct the analyses which will hereafter be fused into a final analysis based on consensus.
Conclusion
This detailed analysis plan will increase the validity of the NEO trial results by predefining the statistical analysis in detail.
Trial registration
ClinicalTrials.gov identifier: NCT01848886. Registered 25th of February 2013, https://clinicaltrials.gov/ct2/show/NCT01848886
Danish Ethics committee number: H-3-2012-116
Danish Data Protection Agency: 2007-58-0015/jr. n:30-0838
This book constitutes the proceedings of the 2nd International Conference on Information Communication Technologies in Health (ICICTH), held in Samos, Greece, in July 2004.
Background
There is an ongoing controversy regarding the necessity of single-photon emission computed tomography (SPECT) for patients with ischemic heart diseases after the publication of the results of the ISCHEMIA trial. We aimed to evaluate the association of the extent of myocardial ischemia with outcomes in patients with suspected coronary artery disease in Japan.
Methods
From the data of 2780 patients with stable angina who were enrolled prospectively between January 2006 and March 2008 in Japan and had undergone physician-referred non-invasive imaging tests (Japanese Coronary-Angiography or Myocardial Imaging for Angina Pectoris Study), 1205 patients managed with SPECT were stratified by 10 % myocardial ischemia. Major adverse cardiac events (MACEs), including death, myocardial infarction, hospitalization for heart failure, and late revascularization, were followed-up for 1 year.
Results
Patients with ≥10 % myocardial ischemia (n = 173) were less likely to be women than patients with <10 % myocardial ischemia (n = 1032) and had a significantly higher 1-year cumulative incidence of MACEs (6.9 % vs. 1.8 %, p < 0.0001). After adjusting for confounders, the risk of ≥10 % myocardial ischemia relative to <10 % myocardial ischemia for MACEs remained significant [adjusted hazard ratio (95 % confidence interval), 2.40 (1.09–5.26), p = 0.029]. After adjusting including treatments, the risk of MACEs became insignificant between the ≥10 % myocardial ischemia group and the <10 % myocardial ischemia group [adjusted hazard ratio (95 % confidence interval), 1.04 (0.45–2.45), p = 0.92].
Conclusion
The presence of ≥10 % myocardial ischemia at diagnosis was significantly associated with the 1-year risk for MACEs in Japanese patients with suspected coronary artery disease.
The novel coronavirus infection (COVID-19) is caused by the SARS-CoV-2 virus. First registered at the end of December 2019 in Wuhan, China. Due to the high contagiousness of the virus, the infection quickly spread throughout the world, and on March 11, 2020, the World Health Organization announced the beginning of the COVID-19 pandemic. During the pandemic, the number of cardiac surgeries was sharply reduced due to the repurposing of hospitals to receive and treat patients with COVID-19. Today, however, diseases of the circulatory system remain the leading cause of death in the developed world. At the same time, there are more and more reports of extremely unfavorable outcomes of cardiac surgery in patients with active infection. Unfavorable outcomes were associated with the development of acute respiratory distress syndrome in the early postoperative period and high hospital mortality. Two years after the beginning of the COVID-19 pandemic, 98 % of the patients had an infection, and today this group of patients is increasingly common in cardiac surgery practice. At the same time, there is evidence that the transferred COVID-19 has long-term adverse effects, including pathological effects on the cardiovascular and respiratory systems. This retrospective study was aimed at studying and analyzing the immediate results of surgical myocardial revascularization, namely coronary artery bypass grafting on a beating heart, in patients with COVID-19 convalescents with coronary heart disease.
Background and objectives: A prospective study performed in Ibn-Albitar hospital a tertiary center to assess the effect of ischemic heart disease on heart rate variability. Methods: Thirty nine consecutive patients all with history of chronic stable angina &with positive treadmill test underwent 24 hours holter test to assess heart rate variability. Compared it with 25 age & sex matched control volunteer group. Results: Thirty one (79.48%) male of patients group& 20 (80%) male of control group . heart rate variability expressed as (SDNN) standard deviation of normal to normal interval, (RMSSD) square root of the mean squared differences of successive normal to normal intervals& (pNN50) the proportion derived by dividing (NN50) the number of interval differences of successive normal to normal intervals greater than 50 milliseconds (ms.) by the total number of normal to normal intervals all were significantly lower in patients group. Conclusion: This study showed that heart rate variability significantly lower in patients with chronic stable angina.
ResearchGate has not been able to resolve any references for this publication.