Content uploaded by Giuseppina Campisi
Author content
All content in this area was uploaded by Giuseppina Campisi
Content may be subject to copyright.
Available via license: CC BY 2.0
Content may be subject to copyright.
RESEARCH ARTIC LE Open Access
Evaluation of a combined triple method to detect
causative HPV in oral and oropharyngeal
squamous cell carcinomas: p16
Immunohistochemistry, Consensus PCR HPV-DNA,
and In Situ Hybridization
Giuseppe Pannone
1
, Vito Rodolico
2
, Angela Santoro
1*
, Lorenzo Lo Muzio
3
, Renato Franco
4
, Gerardo Botti
4
,
Gabriella Aquino
4
, Maria Carmela Pedicillo
1
, Simona Cagiano
1
, Giuseppina Campisi
5
, Corrado Rubini
6
,
Silvana Papagerakis
7
, Gaetano De Rosa
8
, Maria Lina Tornesello
9
, Franco M Buonaguro
9
, Stefania Staibano
8
and
Pantaleo Bufo
1
Abstract
Background: Recent emerging evidences identify Human Papillomavirus (HPV) related Head and Neck squamous
cell carcinomas (HN-SCCs) as a separate subgroup among Head and Neck Cancers with different epidemiology,
histopathological characteristics, therapeutic response to chemo-radiation treatment and clinical outcome.
However, there is not a worldwide consensus on the methods to be used in clinical practice. The endpoint of this
study was to demonstrate the reliability of a triple method which combines evaluation of: 1. p16 protein
expression by immunohistochemistry (p16-IHC); 2. HPV-DNA genotyping by consensus HPV-DNA PCR methods
(Consensus PCR); and 3 viral integration into the host by in situ hybridization method (ISH). This triple method has
been applied to HN-SCC originated from oral cavity (OSCC) and oropharynx (OPSCC), the two anatomical sites in
which high risk (HR) HPVs have been clearly implicated as etiologic factors. Methylation-Specific PCR (MSP) was
performed to study inactivation of p16-CDKN2a locus by epigenetic events. Reliability of multiple methods was
measured by Kappa statistics.
Results: All the HN-SCCs confirmed HPV positive by PCR and/or ISH were also p16 positive by IHC, with the latter
showing a very high level of sensitivity as single test (100% in both OSCC and OPSCC) but lower specificity level
(74% in OSCC and 93% in OPSCC).
Concordance analysis between ISH and Consensus PCR showed a faint agreement in OPSCC (= 0.38) and a
moderate agreement in OSCC (= 0.44). Furthermore, the addition of double positive score (ISHpositive and
Consensus PCR positive) increased significantly the specificity of HR-HPV detection on formalin-fixed paraffin
embedded (FFPE) samples (100% in OSCC and 78.5% in OPSCC), but reduced the sensitivity (33% in OSCC and
60% in OPSCC). The significant reduction of sensitivity by the double method was compensated by a very high
sensitivity of p16-IHC detection in the triple approach.
Conclusions: Although HR-HPVs detection is of utmost importance in clinical settings for the Head and Neck Cancer
patients, there is no consensus on which to consider the ‘golden standard’among the numerous detection methods
available either as single test or combinations. Until recently, quantitative E6 RNA PCR has been considered the
‘golden standard’since it was demonstrated to have very high accuracy level and very high statistical significance
* Correspondence: angelasantoro1@hotmail.it
1
Department of Surgical Sciences - Section of Anatomic Pathology and
Cytopathology, University of Foggia, Viale Luigi Pinto 1, 71122 Foggia, Italy
Full list of author information is available at the end of the article
Pannone et al.Infectious Agents and Cancer 2012, 7:4
http://www.infectagentscancer.com/content/7/1/4
© 2012 Pannone et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative
Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly cited.
associated with prognostic parameters. In contrast, quantitative E6 DNA PCR has proven to have very high level of
accuracy but lesser prognostic association with clinical outcome than the HPV E6 oncoprotein RNA PCR. However,
although it is theoretically possible to perform quantitative PCR detection methods also on FFPE samples, they reach
the maximum of accuracy on fresh frozen tissue. Furthermore, worldwide diagnostic laboratories have not all the
same ability to analyze simultaneously both FFPE and fresh tissues with these quantitative molecular detection
methods. Therefore, in the current clinical practice a p16-IHC test is considered as sufficient for HPV diagnostic in
accordance with the recently published Head and Neck Cancer international guidelines. Although p16-IHC may serve
as a good prognostic indicator, our study clearly demonstrated that it is not satisfactory when used exclusively as the
only HPV detecting method. Adding ISH, although known as less sensitive than PCR-based detection methods, has
the advantage to preserve the morphological context of HPV-DNA signals in FFPE samples and, thus increase the
overall specificity of p16/Consensus PCR combination tests.
Keywords: Head and neck squamous cell carcinoma, HN-SCC, OSCC, OPSCC, Human papillomavirus, HPV, DNA
consensus PCR, Immunohistochemistry, IHC, p16-IHC, Epigenetic, Methylation-Specific PCR
Background
Oral and oropharyngeal squamous cell carcinomas
(OSCCs and OPSCCs, respectively) represent a major
health issues, with over 200,000 new cases reported world-
wide annually. Though improvements in screening and
early diagnosis have dramatically reduced the incidence of
these neoplasms in recent years, the 5-year disease-free
survival is still poor, despite significant scientific and finan-
cial efforts. Recently, several studies have shown that HPV
are clearly involved in the pathogenesis of a subgroup of
OSCC and OPSCC [1,2]. This distinct subgroup of Head
and Neck Cancers is characterized by distinctive histo-
pathological features: HPV infection, distinctive epidemiol-
ogy, better response to induction chemotherapy and
concurrent chemo-radiation protocol and an overall better
clinical outcome, as compared to HPV negative HN-SCC
[3-6]. The proportion of OPSCCs that are potentially
HPV-related (cancers of the tongue-based and tonsils,
including lingual tonsil and Waldeyer’s ring) increased in
the USA from 1973 to 2004, perhaps as a result of chan-
ging sexual behaviours. Nevertheless, OPCCs associated
with HPV infection show a better prognosis and seems to
occur predominantly in unmarried younger patients ( < 40
yrs), especially males. Therefore, there is a need to prop-
erly assess OPSCC subgroups: 1) HPV-unrelated/classic
OPCCs that are less responsive to conventional anti-
cancer therapies; 2) HPV associated OPSCCs with less
mortality and recurrence rates with mutiple management
options. Since Syrjanen’s initial observations in 1983 [7],
there have been numerous reports on HPV-DNA detec-
tion in HN-SCC with rates varying from 0% to 100% of
tumors studied [8,9]. These differences in detection rate
are due to at least two principal factors: a) differences in
the epidemiological distribution of oncogenic HR-HPVs in
the world; b) different analytical methods utilized [10,11].
The p16INK4A gene functions as a negative regulator
of the cell cycle progression through its inhibition of
cdk4/6 which in turn determines the blockage of the
cyclin-dependent phosphorylation of the Retinoblastoma
protein (Rb). Loss of heterozygosity (LOH), hypermethy-
lation, deletion, mutation of the p16INK4A locus are
common events in Head and Neck carcinogenesis
[12-16]. Therefore, p16INK4A expression loss defines a
subgroup of OPSCC patients with worse clinical outcome
[17]. Furthermore, as with female genital (or cervical)
carcinogenesis, the immunohistochemical detection of
p16 protein (p16-IHC) has been proposed as surrogate
marker of HPV infection in Head and Neck Cancer [18].
However, although recent publication of Guidelines for
Head and Neck Cancer [National Comprehensive Cancer
Network (NCCCN) Guidelines™Version 1.2011 Head
and Neck Cancers] suggests p16-IHC as a screening
method for HPV detection [19], some questions remain
regarding the accuracy of the test when used alone, with-
out molecular detection of HPV-DNA. The HPV-DNA
test may be used in Head and Neck Pathology depart-
ments with the following diagnostic and prognostic pur-
poses: a) distinguish HPV positive from HPV negative
HN-SCC and thus providing additional prognostic infor-
mation; b) distinguish HPV positive metastases to the
loco-regional lymph nodes derived from oropharyngeal
cancers versus metastases of other origins [20,21]; c) fur-
nish potentially useful indications for cancer treatment
options; d) contribute to the differential diagnosis of
rhino-pharynx undifferentiated carcinoma (WHO type I
potentially related to HPV infection whereas Type II and
III potentially related to EBV); e) provide valuable infor-
mation for Head and Neck Cancer research.
The aim of this study is to demonstrate the relationship
among p16 protein expression, HPV-DNA detection- and
virus integration status into the host DNA in HN-SCC at
different anatomical levels, i.e., oral cavity (OSCC) and
oropharyngeal cavity (OPSCC). In this study p16-IHC
has been used as the initial screening method followed by
ISH/PCR to show the morphological context of HPV-
DNA sequences detected by Consensus PCR.
Pannone et al.Infectious Agents and Cancer 2012, 7:4
http://www.infectagentscancer.com/content/7/1/4
Page 2 of 14
Results
p16-IHC expression and promoter methylation of CDKN2a
locus in HN-SCC
p16-IHC expression has been evaluated in a total of 86
Head and Neck squamous cell carcinomas. In summary,
22 cases of OPSCC and 11 cases of OSCC have been
evaluated using individual specimens by whole section
method and 53 cases have been evaluated on TMA cores.
P16 is normally expressed in restricted basal-parabasal
layers of oral epithelium whereas it is over-expressed in
OSCC and OPSCC (Figures 1 and 2). The protein expres-
sion in positive OSCCs was diffusely distributed in
almost all cancer cells and localized in nuclei and/or
cytoplasms. Remarkably, all the HPV positive cases by
Consensus PCR analysis were also p16-IHC positive; in
particular, also LR-HPV positive cases showed p16 pro-
tein expression in cancer cells although mainly distribu-
ted in cytoplasms. However, with the p16 antibody used
in our study, the p16 sub-cellular localization by immu-
nostaining was not predictive of HR-HPV detection as
we observed HR-HPV type 16 positive OPCCs exhibiting
cytoplasmic p16 staining. OPCCs with negative p16
staining were mainly observed in the patient cohort with
a known history of alcohol-tobacco consumption and
low HR-HPVs prevalence [22,23]. These latter cases were
further analyzed by Methylation-Specific PCR and
showed a high frequency (75%) of CDKN2a promoter
methylation, which may explain the negative p16 protein
expression (Figures 1 and 3).
Analysis of HPV-DNA detection in controls
Fifteen cases of normal oral (5 cases), oropharyngeal ( 5
cases) and laryngeal (5 cases) specimens were negative for
HPV-DNA by ISH assay using Inform HPV family-III
(Ventana - Roche) and Inform HPV family-II (Ventana -
Roche) and consensus primer PCR. We have also included
in our study three control cases of HR-HPV positive cervi-
cal SCC lesions (two cases of HSIL - High grade Squa-
mous Intraepithelial Lesion - and one case of invasive
cervical carcinoma), along with one control case of Juve-
nile Onset Recurrent Respiratory Papillomatosis (JO-RRP)
positive for low risk LR-HPV. All these controls cases
were previously characterized for HPV status by PCR fol-
lowed by direct sequencing.
Combined HPV-DNA detection by ISH and PCR techniques
The combined HPV-DNA and ISH results are reported
in Table 1.
OSCC analysis
Out of the 64 total OSCCs cases analyzed by ISH, in
only one case we were unable to diagnosed the infective
status of the oral mucosa. Furthermore, we found 2
Figure 1 IHC expression of p16 protein in representative HPV
positive (DNA type 16) and HPV negative OSCCs. P16 is
expressed only at basal-parabasal levels in epithelium surrounding
OSCC, whereas it is over-expressed in OSCC. The figure in the
middle page depicted p16 expression according different HR and
LR-HPVs. The figure in the bottom represent a p16 negative OSCC;
the p16 under-expression is due to promoter methylation od
Pannone et al.Infectious Agents and Cancer 2012, 7:4
http://www.infectagentscancer.com/content/7/1/4
Page 3 of 14
cases positive for HPV-DNA by Inform HPV family-III
(Ventana - Roche) and no case positive for DNA by
Inform HPV family-II (Ventana - Roche) with a total of
2 HPV positive oral cancers.
Our IHC results were confirmed by the Consensus
PCR; similarly, we could not diagnosed the HPV infec-
tion status of the epithelium in only one case out of the
total 64 OSCCs.
Furthermore, our Consensus PCR analysis performed
on OSCCs indicated HR-HPV status not exclusively
restricted to HPV 16. In more detail, out of the total 63
cases diagnosed as HPV positive by both IHC and Con-
sensus PCR, we found three cases positive for HPV
types 16 and 16/56 (which represents 4.76% of the HPV
positive OSCCs). Furthermore, two additional HR-HPVs
were found, the HPV types 53 and 31, the HPV 53 posi-
tive case was not valuable by ISH with our antibody,
while the HPV 31 was found by ISH as non integrated.
As regard with the LR-HPV types, the analysis by ISH
alone was delusive because 2/3 (in particular, HPV 44
and HPV 70) (66.66%; SE ± 0.273) of LR-HPVs detected
by PCR in our OSCCs collection were not included in
the commercially available Inform HPV family-II probe
Ventana - Roche.
Concordance analysis of HPV-DNA detection by p16
immunhistochemistry and HPV-DNA molecular methods
(ISH and PCR techniques) in OSCC
All HPV positive OSCCs showed p16-IHC positivity
with high and diffuse levels of p16 immunostaining.
Therefore, the p16 immunohistochemical method (p16-
IHC)provenarateof100%sensitivityasadetection
method of HPV positive OSCC cases with no false nega-
tive (p16 negative; HPV positive) cases. On the other
hand, our results demonstrate that a specificity rate of
74%, with a false positive subgroup (26%) of OSCC
Figure 2 IHC expression of p16 protein in OPSCC showed at increasing magnification. Note intense nucleo-cytoplasmic expression (LSAB-
HRP, nuclear counterstaining with haematoxylin).
Pannone et al.Infectious Agents and Cancer 2012, 7:4
http://www.infectagentscancer.com/content/7/1/4
Page 4 of 14
Figure 3 The role of CDKN2a promoter methylation in p16 down-regulation. A) Percentage of CDKN2a promoter methylation in OSCC and
in oral epithelia exposed to alcohol and tobacco risk factors. B) Representative examples of Methylation-Specific PCR (MSP) for CDKN2a/INK4a
locus (p16) in OSCC. Legend. K, cancer samples; N, normal samples; M, CDKN2a methylated; U, CDKN2a unmethylated.
Table 1 Interaction between HPV virus detection as evaluated by molecular methods and in situ hybridization signals.
Case Year Age-
Sex
Italian
Region
Site HistologicalGrade pTNM
stage
In situ hybridization Consensus PCR
based method
OPSCC-1 2004 69 F Puglia Tonsil G1 Biopsy Negative negative
OPSCC-2 2006 79 F Puglia Tonsil G3 Biopsy Negative negative
OPSCC-3 2007 55 M Puglia Tonsil G2 Biopsy Negative negative
OPSCC-4 ND 51 F Puglia Tonsil G2 Biopsy Negative negative
OPSCC-5 2008 47 M Puglia Tonsil G2 Biopsy Negative negative
OPSCC-6 2008 63 M Puglia Tonsil G3 Biopsy Negative negative
OPSCC-7 2009 46 M Puglia Tonsil positive
Uvula
G2 Biopsy Negative negative
OPSCC-8 2006 54 M Puglia Tonsil G2 Biopsy HR-HPV: nuclear clusters negative
OPSCC-9 2008 45 M Campania Tonsil G2 pT2NxM x HR-HPV: integration
positive clusters
HPV16
OPSCC-10 2007 60 F Campania Tonsil G3 pT1NxM x negative HPV16
OPSCC-11 2007 62 M Campania Tonsil ND pT2NxM x negative HPV16
OPSCC-12 2007 51 M Campania Tonsil G3 pT1NxMx negative negative
OPSCC-13 2008 67 M Campania Tonsil G3 pT1NxMx HR-HPV: clusters HPV16
OPSCC-14 2006 55 F Campania Tonsil G3 pTxNxMx negative negative
OPSCC-15 2009 69 F Campania Tonsil G3 pT2NxMx HR-HPV: focal clusters HPV16
OPSCC-16 2008 79 F Campania Tonsil G2 pT4aNxMx negative negative
OPSCC-17 2008 87 M Campania Tonsil G3 pT1NxMx HR-HPV: focal clusters negative
OPSCC-18 2009 62 M Campania Tonsil G3 pT4aNxMx ND HPV16
OPSCC-19 2009 66 M Campania Lingual tonsil -
vallecula
G3 pT2N2bM0 negative ND
OPSCC-20 2007 61 M Sicilia Tonsil G3 pT2N0Mx HR-HPV integrative negative
OPSCC-21 2009 42 M Sicilia Tonsil G2 pTxNxMx negative negative
OPSCC-22 2011 60 M Sicilia Tonsil G3 pT2N0Mx HR-HPV: focal nuclear
clusters
ND
Pannone et al.Infectious Agents and Cancer 2012, 7:4
http://www.infectagentscancer.com/content/7/1/4
Page 5 of 14
cases which were p16-IHC positive but HPV-DNA
negative.
OPSCC analysis
By ISH, in only one case out of the total 22 individual
OPSCCs sections(4.5%; SE ± 0.044) we analyzed, we
could not determine the infection status of the epithe-
lium. Out of the 21 HPV positive cases diagnosed by
IHC, we found that 7 cases were also positive for HPV-
DNA by Inform HPV family-III (33.3%; SE ± 1.103), but
none was positive for DNA by Inform HPV family-II. Of
these total of 7 cases found HPV positive OPSCCs by
Inform HPV family-III, 6 were also positive by the PCR
techniques.
ByConsensusPCR,wewereunabletodeterminethe
infection status of the oropharynx epithelium in only 2
cases out of the total analyzed 22 OPSCC (9%; SE ±
0.061). Six cases (30%; SE ± 0.102) out of the 20 posi-
tively diagnosed cases of OPSCC were PCR positive and
all these six cases were type HPV16.
By using PCR method in combination with ISH we
were able to detect four additional HR-HPVs ISH posi-
tive cases among the PCR-negative group (3 PCR-HPV-
DNA negative and 1 PCR beta-globin negative on
FFPE); with a final count of 10 HPV positive OPSCCs
considering also single positivity by at least one DNA
detection method. OPSCCs evaluated by ISH showed
positive nuclear signals in 6/21 (28.5%; SE ± 0.099) with
integrative punctuate stain detected in 2/21 cases (9.5%;
SE ± 0.064). Consensus PCR detected 3 additional cases
not detected by ISH (2 cases ISH-negative and 1 case
ISH failed).
Concordance analysis of HPV-DNA detection by p16
immunhistochemistry and HPV-DNA molecular methods
(ISH and PCR techniques) in OPSCC
The p16-IHC method also proved a 100% sensitivity rate
in OPSCC cases; all HPV positive OPSCCs showed p16-
IHC positivity with high levels of p16 immunostaining.
Its specificity rate of 93.5%, was much higher in OPSCC
than in OSCCs, with a smaller false positive subgroup
(of only 9%) in OPSCCs cases which were p16-IHC
positive but HPV-DNA negative.
Overall, the agreement between the ISH and Consensus
PCR techniques as methods of detection for HPV-DNA is
shown in Table 2. It was not technically possible to per-
form the two test together in 3/22 OPSCCs (13.63%; SE ±
0.079) and in 2/64 OSCCs (3%; SE ± 0.021) which bring
these to a total of only 5 HN-SCC cases (5.8%; SE ± 0.025)
from the initial 86 cases included in our analysis. The tests
were concordant in 14/19 OPSCCs (73.68%) and in 58/62
OSCCs (93.5%). Regarding oral malignancies (OSCC col-
lection) the Fleiss’kappa coefficient (= 0.44) suggested
moderate concordance according to the method of Landis
and Koch [24]. As regards oropharyngeal malignancies
(OPSCC collection) the concordance was fair (= 0.38)
according to the above mentioned method.
Site by site distribution of HPV positive cells and HPV ISH
signal patterns
In situ hybridization for HR-HPV in oral cancer (OSCC)
The OSCC case, HPV 16 positive by PCR, showed preva-
lent discreet dot spot signal of integration with only focal
clusters and has been categorized as integrated (Table 1
andFigure4).Inacharacteristicdoubleinfectedoral
Table 1 Interaction between HPV virus detection as evaluated by molecular methods and in situ hybridization signals.
(Continued)
OSCC-1 1999 75 F Marche Tongue G2 pT1N0M0 cytoplasmic signals HPV31/44
OSCC-2 2000 59 M Marche Oral cavity
(WRA)
G3 pT2N2bM0 negative (not available
probes)
HPV 53
OSCC-3 2001 48 M Marche Tongue base
(WRA)
G1 pT1N0M0 negative (not available
probes)
HPV 70
OSCC-4 2002 63 M Marche Tongue G3 pT2N1M0 ND HPV 6
OSCC-5 1999 74 M Marche Oral cavity
(WRA)
G3 pT2N0M0 HR-HPV: integration
positive focal clusters
HPV 16
OSCC-6 2009 72 M Sicilia Oral cavity G1 pT1N0M0 HR-HPV: faint focal nuclear
clusters
HPV16/56
OSCC-7 2009 49 M Sicilia Tongue G2 pT2N1Mx negative negative
OSCC-8 2010 41 M Sicilia Tongue G2 pT1N0Mx negative negative
OSCC-9 2008 37 M Sicilia Hard palate G1 pT2N0Mx negative negative
OSCC-10 2009 72 M Sicilia Oral cavity G1 pT1N0M0 negative HPV16/56
OSCC-11 2010 74M Puglia Tongue G1 pT2N0M0 negative ND
TMA OSCC
(53 cases)
1997-
2008
20 F/
33 M
Campania Oral cavity-
multiple sites
All G available All TNM
available
negative negative
The results are compared to clinic-pathologic parameters and demographic data
TMA: tissue microarray; ND: non determined data; F: female; M: male; WRA: Waldeyer Ring Area
Pannone et al.Infectious Agents and Cancer 2012, 7:4
http://www.infectagentscancer.com/content/7/1/4
Page 6 of 14
cancer (HPV31 and 44), we have not observed a nuclear
integration (Figure 5) using ISH, although the two HPV
viruses have been detected by PCR. Unfortunately, it has
not been possible to determine the integration status of
HPV type 53 by PCR because probes for this HPV variant
have not been commercially available nor have they been
standardized for clinical laboratory use.
In situ hybridization for HR-HPV in oropharyngeal cancer
(OPSCC)
Our study showed that 7 of 21 (33.3%; SE ± 1.103) of the
OPSCCs, all of them originated from the tonsil region,
were HPV positive when ISH was used as single test;.
Interestingly, only 1 out of 7 cases in the female popula-
tion was ISH positive (14.2%; SE ± 0.132) whereas we
found 6 out of 15 cases in male population were ISH posi-
tive (40%; SE ± 0.126). With the addition of the Consensus
PCR test all cases HPV positive by ISH demonstrated type
specific restriction for the HR-HPV type 16. The distribu-
tion of integrative and episomal signals is shown in Table
1. One case showed the typical integrative (I) dot-spot sig-
nals as evaluated by ISH; one case demonstrated a mixed
episomal-integrative (E-I) pattern, while the other 5 cases
showed exclusively episomal pattern (E) of HPV-DNA as
demonstrated by nuclear cluster observation.
Two cases were negative by ISH but HPV positive by
PCR, while five out six PCR positive cases where also ISH
positive. In one PCR positive case we could not establish
the ISH result. Therefore, the ISH technique demonstrated
a sensitivity of 60% when used in combination with PCR
(see Table 2). We have observed three cases in positive
agreement by ISH for HR-HPV and PCR for HR-HPV
type 16, with a specificity of 78.5% for ISH technique
when used in combination with PCR. This specificity rate
has been obtained with a careful exclusion of false positive
staining as described in the methods for evaluation.
In situ hybridization for LR-HPV in OSCC and OPSCC and
its relationship with haematoxylin and eosin coilocytosis
detection and HPV-DNA techniques
Techniques directed to detect HPV-DNA in OSCC and
OPSCC have shown different mucosal HPV low risk
types (LR-HPV 6, LR-HPV 44, LR-HPV 70). According
to our previous observations and to the current literature
these low risk viruses may be detected alone or together
with high risk viruses in multiple infection. Interestingly
only squamous cell carcinomas of the oral and orophar-
yngeal cavities infected by LR-HPV showed coilocytosis
as evaluated by classical histological haematoxylin and
eosin staining. This explains the low power of coilocytes
demonstration in detection of HPV-related Head and
Neck Cancer since it can detect only single LR-HPV,
associated to SCC but not causative of cancer, or double/
multiple HPV infection including a LR-HPV. In a repre-
sentative double infected oral cancer case (HR-HPV 31
and LR-HPV 44), by ISH we have observed neither
nuclear integration nor nuclear clusters, but cytoplasmic
localization in cancer cells although the PCR DNA
method has revealed the effectivepresenceofthetwo
HPV viruses (See Figure 5). In other cases with LR-HPV
positive HPV-DNA based methods, in situ hybridization
was not applicable as the probes were not included in the
commercially available probe sets we used; these com-
mercial probes have been standardized to detect the
most common HPV types currently recognized as etiolo-
gic factors in female genital carcinogenesis.
Discussion
Thep16INK4agene(CDKN2a/INK4a)functionsas
negative regulator of the cell cycle progression through
its inhibition of cdk4/6 and subsequent blockage of the
cyclin-dependent phosphorylation of the Retinoblastoma
gene (Rb). CDKN2a/INK4a located on 9p21 is fre-
quently inactivated in oral epithelial pre-cancer and can-
cer via the following events: LOH, hypermethylation,
deletion, mutation. The loss of p16INK4A expression
defines a subgroup of oropharyngeal cancer patients
with worse clinical outcome [16] whereas p16 protein
over-expression has been proposed as surrogate marker
of HPV infection initially in cervical cancer by Amorte-
gui et al., [25,26], followed by squamous cell carcinomas
from other sites than uterine cervix [27], and especially
in Head and Neck Cancers [28,29].
In order to further explain differences between p16
expression and HPV-DNA in oropharyngeal cancer we
performed Methylation-Specific PCR (MSP) to evaluate
CDKN2a/INK4a promoter inactivation. Finally, MSP
showed that the methylation of CDKN2a/INK4a is a fre-
quent epigenetic alteration in oropharyngeal cancer and
Table 2 Agreement between ISH and Consensus PCR to detect HPV-DNA in OSCC and OPSCC
ISH results Including LR
and HR
No. of cases
examined by PCR (%)
Sensitivity Specificity K Total observed agreement
(ISH/PCR)
Total expected agreement
(ISH/PCR)
Diagnosis Negative Positive
Negative 56(90.3%) 4(6.5%) 33.3% 100% 0.44 58(93.5%) 83%
Positive 0(0%) 2(3.2%)
Negative 11(57.9%) 2(10.5%) 60% 78.5% 0.38 14(73.7%) 58%
Positive 3(15.8%) 3(15.8%)
Pannone et al.Infectious Agents and Cancer 2012, 7:4
http://www.infectagentscancer.com/content/7/1/4
Page 7 of 14
revealed that p16 was inactivated in 75% of OPSCCs
associated to alcohol and tobacco risk factors. Therefore,
we can conclude that OPSCC should be ideally subdi-
vided in two groups: a) alcohol-tobacco-associated/
HPV-DNA negative/CDKN2a-MSP methylated/p16-IHC
negative or faint; b) alcohol-tobacco-unassociated HPV-
DNA/HPV-DNA-positive/CDKN2a-MSP unmethylated/
p16-IHC positive. However, the situation in clinical set-
ting is more complex because different risk factors fre-
quently overlapped i.e. in HN-SCCs of young
population, alcohol/tobacco consumption and HPV
infection may be also associated. HPV positive OPSCC
mostly occurs in younger patients and may also arise in
people without a history of tobacco use. Furthermore,
there are some cases showing discrepancy between pro-
moter methylation and protein expression; i.e. cancer
cases in which promoter is methylated (as evaluated by
qualitative analysis) and the protein is unexpectedly
expressed. Therefore, in these cases quantitative tests
should be performed in order to establish the propor-
tion of methylated/unmethylated alleles in the cancer
cells clearly distinguishing the latter from alleles of non-
cancerous cells. Although the microdissection-based
quantitative tests are important research tools they can-
notbeeasilyperformedincurrent clinical practice.
Furthermore, we observed different levels of p16-IHC
accuracy in the different cancer subpopulation studied.
In details, in a cohort of prevalently alcohol/tobacco
associated cancers from the south-west of Italy (Napoli)
p16-IHC test showed a lower level of specificity in
detecting HPV positive cases. In this cohort, there was
an unacceptable large group of p16-IHC positive cancers
that were diagnosed as negative by the combined ISH
and PCR methods. It is possible that up-regulated p16
expression we observed in cancers was due to other
molecular events not related to HPV. On the other
hand, in a cohorts with higher number of HPV positive
cases, i.e. the cohort from middle-east Italy (Ancona)
the p16-IHC test increases its specificity in detecting
HPV cases. This observation is confirmed by our analy-
sis of OPSCCs cases which showed higher level of HPV
infection than that of OSCC, in parallel with higher
p16-IHC specificity levels as method of detection of
HPV positive cases. In agreement with this hypothesis, a
recent literature report demonstrates different p16 accu-
racy according to different anatomical sub-sites of the
Head and Neck region [30]. In this complex scenario
the p16-IHC test alone or in association to CDKN2a
promoter methylation could be used only as a screening
method and need to be associated with molecular tests
in order to detect HPV-DNA and to assess its integra-
tion status.
Integration of HPV-DNA into the host DNA is a well
known topic in cervical cancer but there are few
Figure 4 HR HPV ISH in Head and Neck squamous cell
carcinomas. Note the clear nuclear staining with tetrazole blue as
punctuate signals and clusters, corresponding to integration and
episomic status respectively A, B) Control cases of cervical HSIL. C)
Integration and episomal clusters are uniformly distributed in tonsil
cancer (OPSCC) harboring type 16 HPV-DNA; note integrative
punctuate signals and cluster spot throughout the entire tumor. D)
Heterogeneous integration signals in oral cancer harboring type 16
HPV-DNA. (In situ hybridization; tetrazole blue signals stain the viral
DNA; nuclear counterstaining with fast red; original magnifications a,
b, ×10; c, ×40; d ×60).
Pannone et al.Infectious Agents and Cancer 2012, 7:4
http://www.infectagentscancer.com/content/7/1/4
Page 8 of 14
investigations in Head and Neck Cancers. Integration of
HPV 16 DNA correlates with dysfunction of HPV E1 or
E2 open reading frames (ORF), which are active during
HPV replication.. E2 loss of function allows up-regula-
tion of E6 and E7 oncoproteins, because E2 is a repres-
sor of E6 and E7. The great percentage of cervical
cancers harbors HPV in the integrated form, however,
recently has emerged that cervical cancers may contain
HPV episomic DNAs as well. It has been also demon-
strated that HR-HPV episomal DNAs up-regulate the
activity of E6/E7 promoter, which in turn gives rise to
elevated E6 and E7 protein expression in cancer cells.
As regard to HN-SCC HPV-DNA integration there are
numerous interesting points to discuss. On the one
hand current literature describes the HPV-related HN-
SCC as almost exclusively HPV type 16 restricted can-
cers [31] and HPV type 16 is considered to have the
highest capability to integrate into the host DNA in
cervical high grade squamous intraepithelial lesions
(HSILs) and invasive carcinomas [32,33]. On the other
hand, HN-SCCs, in particular tonsillar cancers (TCs),
have been described as tumors with elevated frequency
of HPV-DNA type 16 in integrated or episomal form
producing E6 and E7 oncogenic proteins, since the early
observations of Sniders PJF at al. [34]. These observa-
tions have been further confirmed by Mellin H. et al.
concluding that in oropharyngeal cancers HPV is almost
exclusively not integrated and its carcinogenic activity is
due to E6/E7 oncoproteins expressed from episomal
viral sequences [35]. Recently, some bias in the interpre-
tation of HPV prevalence in HN-SCCs have been
emerged since oral cancers (OSCCs) have not been
clearly distinguished from oropharyngeal ones (OP-
SCCs). Aim of this study was to demonstrate the inte-
grative versus episomic HPV status as a diagnostic tool
separating OSCC from OP-SCC in order to furnish site
Figure 5 ISH techniques for HPV show the morphological context of viral DNA location. Representative case of HPV-DNA positive
tumor without virus integration in cancer cells. In spite of positivity for two HPV viruses (HR-HPV 31 and LR-HPV 44 viruses) this case of
OSCC showed no integration but cytoplasmic localization in cancer cells as evaluated by two commercially available in situ hybridization
techniques; note the cytoplasmic virus location in autolytic cancer cells (All the pictures in this panel were selected from different fields of a single
case. A, x40), B, x40), DAKO ISH, brown DAB signals stain the viral DNA; C, x60), D, x60), Ventana ISH, tetrazole blue signals stain the viral DNA).
Pannone et al.Infectious Agents and Cancer 2012, 7:4
http://www.infectagentscancer.com/content/7/1/4
Page 9 of 14
by site information regarding percentage and distribu-
tion of viral integration in host cancer cells.
For this purpose, the ISH technique for HPV is able to
reveal the morphological context of viral DNA location.
Our ISH study showed heterogeneous status of HPV
integration in cancers originated from different Head
and Neck regions. Among the HPV positive OSCCs
onlythecaseinfectedbyHPVtype16DNAshowed
clear integration signals, although not uniformly distrib-
uted throughout the entire tumor but restricted to some
cancer fields. Other fields of the same tumor specimen
showed clusters signals demonstrating episomal status.
Therefore, the HR-HPV type 16 OSCC harbor both
integrated and episomic HPV-DNA into the host trans-
formed cells but with an heterogeneous distribution.
Interestingly, the OSCC case with double LR-HPV type
44 and HR-HPV type 31 infection showed no signals of
integration; however, the viruses have been localized
exclusively in the cytoplasms of the cancer cells.
Remarkably, we found a case of OSCC infected by the
HPV type 53, recently included in a phylogenetic group
of HR-viruses unrelated to HR-HPV 16 and HR-HPV 18
[36]. Unfortunately this case with type 53 HPV virus has
been not determined by ISH because commercially
available systems do not include this type 53 in the HR-
HPV probe panel. This is because most detection sys-
tems for HPV detection are tailored for female genital
system and not for other organ systems.
As regard to OPSCC we found the most HPV-DNA
positive cases in tonsillar cancers (TCs). As described in
literature HPV16 is the almost unique HPV-DNA found
in this anatomical sub-site of the OP region. We
demonstrated that TC cancers had intense integrative
and clusters signals of HR-HPV diffuse throughout the
whole cancer specimen and not focally distributed as we
have observed in the OSCC where the integrative signals
were focally restricted to some fields of the cancer spe-
cimen. This is a further demonstration that HPV 16
plays a significant role in the pathogenesis of a subgroup
of OPSCC and that the HPV 16 virus integration into
the host genome begins in the tonsillar cripts leading to
indirect stimulation of CDKN2a locus and p16INK4a
over-expression [37-39].
Schache AG et al. [40] assessed the sensitivity, specifi-
city, and prognostic ability of eight possible assays and
assay combinations for HPV16, including the gold stan-
dard of RNA qPCR, in 108 cases of OPSCC from the
United Kingdom. The investigators found that HPV16-
positive patients with OPSCC were younger and smoked
less than HPV negative patients, and the proportion of
HPV16-positive cases increased from 15% to 57%
between 1988 and 2009. When compared to RNA
qPCR, p16-IHC/DNA qPCR showed sensitivity and spe-
cificity of 97% and 94%, respectively, and proved to be
the best discriminator of favorable outcome. The p16-
IHC/HR-HPV ISH had a specificity of 90%, but reduced
sensitivity of 88% affected the prognostic utility. Used in
isolation, p16-IHC, HR-HPV ISH, or DNA qPCR were
not specific enough to be recommended for use in clini-
cal trials. In agreement with our findings, the authors
recommended “caution [...] in applying HPV 16 diagnos-
tic tests because of significant disparities in accuracy and
prognostic value”[40].
Conclusions
Although HR-HPV detection is of utmost importance in
clinical setting of HN-SCCs there is no agreement about
the ‘golden standard’considering the number of mole-
cular methods or combinations available. Quantitative
E6 RNA PCR has been considered as the gold standard
thanks to the very high accuracy and very high statistical
significant association with prognostic parameters.
Quantitative E6 DNA PCR has a very high level of accu-
racy but lower prognostic association with clinical out-
come compared to E6 RNA PCR. However, while it is
possible to perform quantitative PCR on FFPE samples
the maximum accuracy is found using fresh frozen tis-
sue. Furthermore, not all laboratories have the same
ability to perform quantitative molecular methods on
both FFPE and fresh tissues. Therefore, in clinical prac-
tice and according to the recently published Head and
Neck Cancer international guidelines a p16-IHC test is
currently performed. Our study has demonstrated that
although p16-IHC is a good prognostic indicator when
used in combination with HPV-DNA molecular meth-
ods, it is not satisfactory when evaluated as HPV detect-
ing test as used alone (specificity less than 75%). Adding
ISH, although it is a method known to be less sensitive
than PCR based ones, has the advantage to preserve the
morphological context of HPV-DNA signals in FFPE
samples and, unexpectedly, increased the sensitivity of
p16/Consensus PCR combination.
Methods
Population and study design
The study group was composed of 33 patients with SCC
of the oral cavity (n = 11 cases with OSCC) or of the
oropharynx (n = 22 cases with OPSCC)(see Table 1). To
further increase the number of cases, a Tissue Microar-
ray (TMA) composed of 53 OSCC cases from National
Cancer Institute of Napoli, Italy, has employed. The
study included also 15 negative control cases of normal
oral (n = 5), pharyngeal (n = 5) and laryngeal (n = 5)
mucosa; 3 control cases of cervical HR-HPV positive
lesions (n = 2 cases of HSIL and n = 1 case of invasive
cervical carcinoma), and 1 positive LR-HPV positive
control case of Juvenile Onset Recurrent Respiratory
Papillomatosis (JO-RRP), all of them previously
Pannone et al.Infectious Agents and Cancer 2012, 7:4
http://www.infectagentscancer.com/content/7/1/4
Page 10 of 14
characterised for HPV by PCR followed by direct
sequencing. Informed consent was obtained from all
participants or from their relatives. The histopathologi-
cal diagnosis of OSCC/OPSCC was made at the Section
of Anatomic Pathology of the University of Foggia -
Foggia, Italy. Microscopic evaluation was performed by
two oral pathologists (GP and PB) determining the
degree of differentiation according to WHO grading sys-
tem, and establishing tumor extent according to the
TNM system [41]. The collection of representative cases
of OSCCs and OPSCCs has been made available for this
study through the active collaboration between multiple
Italian Universities and Cancer Research Centres (Uni-
versity of Foggia, University of Napoli Federico II,
Napoli National Cancer Institute, University of Palermo,
University of Ancona). Consecutive cases have been ran-
domly chosen from cohorts known for their HPV preva-
lence as previously published [22,23] and were analyzed
for HPV-DNA using FFPE specimens obtained from
surgery with curative intention; in addition some cases
have been also analysed using cytological brushing
materials in preoperative setting. In situ hybridization
was performed using commercially available panels of
LR-HPV and HR-HPV probe and automated chromo-
genic ISH detection for HPV-DNA on serial sections
FFPE blocks. On consecutive serial section from FFPE
p16 immunohistochemistry was performed using p16
monoclonal Ab and standard LSAB-HRP technique.
Methylation-Specific PCR (MSP) on consecutive serial
20 micron sections was performed to study inactivation
of p16CDKN2a locus.
Immunohistochemistry to detect p16 expression (p16-
IHC)
Four μm serial sections from formalin-fixed paraffin-
embedded blocks were cut and mounted on poly-L-lysine
coated glass slides. Immunostaining was performed by
linked streptavidin-biotin horseradish peroxidase techni-
que (LSAB-HRP). After sequential deparaffinization and
rehydration, the slides were treated with 0.3% H
2
O
2
for
15 min to quench endogenous peroxidase. Antigen
retrieval was performed by microwave heating - a 1
st
time for 3 min at 650 W, a 2
nd
and a 3
rd
time at 350 W -
of the slides immersed in 10 mM citrate buffer pH 6.
After microwaving, the sections were blocked for 60 min
with 1.5% normal horse serum (Santa Cruz Biotechnol-
ogy, Santa Cruz, CA) diluted in PBS buffer before the
reaction with primary antibody (Ab). Primary monoclo-
nal anti-p16 antibody (BD-Pharmingen; clone G175-405)
was diluted 1: 150 with 0.05 M Tris-HCl buffer pH 7.4
containing 1% bovine serum albumin and incubated
overnight. After two washes with PBS, the slides were
treated with biotinylated species-specific secondary anti-
bodies and streptavidin-biotin enzyme reagent (DAKO,
Glostrup, Denmark), and the color developed by 3,3’-
diaminobenzidine tetrahydrochloride chromogen solu-
tion (DAB). Sections were counterstained with Mayer’s
haematoxylin and mounted using xylene-based mounting
medium. Negative control slides without primary anti-
body were included for each staining. The results of the
immunohistochemical staining were evaluated separately
by two investigators. Stained cells were counted in at
least 10 high powered (40×) fields using an Olympus
BX41 microscope. For each case, the cumulative percen-
tage of positive cells among all sections examined was
determined.
Tissue microarray based immunohistochemistry
For tissue microarray construction, areas of interest rich
in non-necrotic tumor cells, were identified on corre-
sponding haematoxylin and eosin-stained sections and
marked on the source paraffin block. The source block
was cored and a 0.6 mm core transferred to the recipient
master block using Galileo TMA CK 3500 Tissue Micro-
arrayer; ISE TMA Software (Integrated System Engineer-
ing, Milan, Italy). Two cores from different areas (one
representative of superficial and one deep invasion) and
whenever possible one core of normal mucosa of the
same tissue block were arrayed for each case. All the
donor cores were formatted into one recipient block.
H&E staining of a 4-μm TMA section was used to verify
all samples. Immunohistochemical analysis on 4-μm
TMA serial sections was performed by using Ventana
Benchmark
®
autostainer and/or manual standard linked
streptavidin-biotin horseradish peroxidase technique
(LSAB-HRP), according to the best protocol for each
antibody tested in our laboratory.
PCR analysis
HPV-DNA was detected using nested PCR (MY/GP pri-
mers), and HPV genotype was determined by direct
sequencing of PCR fragments. Three types of control
were included in each reaction series: blank control, HPV
negative Wi cells as negative control and HPV-18 DNA-
positive HeLa cells, in dilutions from 20,000-50,000
down to 2-5 HPV-DNA copies, as positive control. HPV-
DNA was amplified by PCR assay using primers useful
for samples with a low copy number of HPV (MY09-
MY11 primer pair in combination with GP5-GP6 primer
pair) as previously demonstrated [42] and amplifications
were performed in a Mastercycler gradient thermal cycler
(Eppendorf, Hamburg, Germany); amplification products
were analyzed in 8% polyacrylamide gel.
Sequencing analysis
HPV genotyping was based on direct sequencing of MY
or MY/GP PCR fragments. Amplification products were
purified by Microcon YM-100 (Amicon-Millipore,
Pannone et al.Infectious Agents and Cancer 2012, 7:4
http://www.infectagentscancer.com/content/7/1/4
Page 11 of 14
Billerica, MA); the sequence of both DNA strands was
determined by the BigDye Ready Reaction Kit in the
automatic sequencer ABI Prism 310 Analyzer (both
from Perkin-Elmer Applied Biosystems, Foster City,
CA). Alignments were obtained from the GenBank on-
line BLAST server and HPV sequences downloaded
from the HPV database http://hpv-web.lanl.gov.
In situ hybridization (ISH) for HPV-DNA detection in
morphological context
ISH signal patterns has been reported to be associated to
the status of HPV showing the test the power to detect
episomal, integrated, or mixed forms [43,44]. Recently, a
commercially available probe set for HR-HPV has
showed an agreement with Consensus PCR of 85% in
FFPE tissue specimens from patients with cervical intrae-
pithelial neoplasia and cervical carcinoma [45]. This A
commercially available HPV ISH system has been used
(Ventana Inform HPV, Tucson, AZ, USA) to detect inte-
gration or episomic status in our study. Briefly, in situ
hybridization was performed using the Benchmark
®
plate
and an alkaline-phosphatase coupled antibody detection
method. The hybridization signals were shown with Tet-
razole Blu and Fast Red nuclear counterstaining. The
commercially available Ventana kit includes the following
probes for HR-HPVs 16, 18, 31, 33, 35, 39, 45, 51, 52, 56,
58, e 66 (Iiform HPV family-III 16 Probe; Ventana -
Roche); and the following probes for LR-HPVs, 6, 11
(Inform HPV famly- II 6 Probe; Ventana - Roche).
ISH evaluation
ISH signals were determined for at least 10 high pow-
ered fields as described above. OSCC/OPSCC cases
showing prominent nuclear punctuated (discreet dot-
like) signals have been considered as integrative (I).
Cases with exclusive nuclear cluster signals as been eval-
uated as episomal (E). The episomal pattern appeared as
large, homogeneous, globular navy-blue precipitate
within the cell nucleus. Recently it has been suggested
that the signals originating from integrated virus can be
hidden in a background of episomal HPV [46]; therefore
cases showing a prevalent nuclear cluster signals along
with also focal punctuated signals of integration have
been evaluated as mixed episomic-integrative (E-I).
According to the manufacturer, artifacts or non-specific
staining is regarded as: non-cellular stromal precipitates;
cytoplasms of PMNs (polymorphonucleated cells), eosi-
nophils, lymphocytes and endothelial cells; and staining
of nucleoli
Methylation-specific PCR (MSP) to analyze promoter
methylation of CDKN2a/INK4a locus
Following careful examination of Haematoxylin-eosin
stained slides, we selected tissue sections with the
greatest proportion of malignant tissue. Paraffin blocks
with corresponding normal epithelium distant from
tumor were as selected. Five 10 μM sections were cut
from each formalin-fixed, paraffin-embedded tumor sam-
ple and transferred into micro centrifuge tubes. The par-
affin was dissolved using xylene followed by two washes
with 100% ethanol and one wash with phosphate-buf-
fered saline. The samples were then incubated in lysis
solution (proteinase K - Qiagen, 20 mg/ml, 50 micro-L; 1
M Tris HCl solution, 10 micro-L; 0,5 M EDTA, 2 micro-
L; 10% SDS 100 micro-L; distilled water 838 ml) over-
night at 55°C. Reversal of cross-linking was performed by
adding NaCl (final concentration 0.7 M) and incubating
at 65°C for 4 h. DNA was recovered using the Wizard
DNA clean-up kit (Promega, Madison, WI) according to
the manufacturer’s protocols. To test the integrity of iso-
lated DNA the housekeeping haemoglobin gene was
amplified by PCR and visualized by gel electrophoresis
for both control and pathological samples. The haemo-
globin gene primers used were: forward,5’-GAA GAG
CCAAGGACAGGTA-3’,andreverse,5’-GGA AAA
TAG ACC AAT AGG CAG 3’.TheDNAquantitywas
evaluated by a NanoDrop Spectrophotometer (CELBIO).
Sodium bisulfate modification of 100 μg DNA for each
sample was performed using the EZ DNA Methylation
Kit (Zymo Research, Orange, CA) following the manufac-
turer’s protocol, with the addition of a 5 min initial incu-
bation at 95°C prior to addition of the denaturation
reagent. The steps to reverse cross-linking in the extrac-
tion procedure as well as the 95°C incubation ensure
more complete melting of the DNA and thus more com-
plete sodium bisulfite conversion of these formalin-fixed
specimens. All Methylation-Specific PCRs were opti-
mized to detect > 5% methylated substrate in each sam-
ple. Each experiment was performed in triplicate.
Methylated and unmethylated DNA were equally recov-
ered from fixed material and only non-degraded DNA
samples were selected. The primers used for Nested-PCR
to flank methylated/unmethylated (M/U) CDKN2a/
INK4a locus have been reported in Table 3.
Statistical analysis
The data were analyzed by the Stanton Glantz statistical
software 3 (MS-DOS) and GraphPad Prism software
Table 3 Primers used to detect methylated and
unmethylated p16-CDKN2a locus by Nested PCR (MSP)
P16 EF AGAAAGAGGAGGGGTTGGTTGG
P16 ER ACRCCCRCACCTCCTCTACC
P16 IMR GACCCCGAACCGCGACCGTAA
P16 IMF TTATTAGAGGGTGGGGCGGATCGC
P16 IUR CAACCCCAAACCACAACCATAA
P16 IUF TTATTAGAGGGTGGGGTGGATTGT
Pannone et al.Infectious Agents and Cancer 2012, 7:4
http://www.infectagentscancer.com/content/7/1/4
Page 12 of 14
version 4.00 for Windows (Graph Pad software San
Diego, CA, http://www.graphpad.com).
Reliability
The HPV ‘positivity’as evaluated by different methods
was assessed using Kappa statistics. The reliability of
ISH and Consensus PCR was determined using Fleiss’
intra-class correlation coefficient (ICCC) [47,48]. The
Kappa coefficients were divided into categories as
described by Landis and Kock [49].
Abbreviations
HPV: Human papilloma virus; HN-SCC: Head and neck squamous cell
carcinoma; IHC: Immunohistochemistry; DNA: Desoxyribonucleic acid; PCR:
Polymerase chain reaction; ISH: In situ hybridization; OSCC: Oral squamous
cell carcinoma; OPSCC: Oro-pharyngeal squamous cell carcinoma; MSP:
Methylation-specific PCR; FFPE: Formalin fixed paraffin embedded; RNA:
Ribonucleic acid; USA: United States of America; Rb: Retinoblastoma protein;
LOH: Loss of heterozygosity; WHO: World Health Organization; EBV: Epstein
barr virus; TMA: Tissue micro-array; LR-HPV: Low risk human papilloma virus;
HR-HPV: High risk human papilloma virus; I: Integrative pattern; E-I: Episomal-
integrative pattern; E: Episomal pattern; ORF: open reading frame; TCs:
tonsillar cancers; QPCR: Quantitative polymerase chain reaction; JO-RRP:
Juvenile onset recurrent respiratory papillomatosis; LSAB-HRP: Linked
streptavidin-biotin horseradish peroxidase technique; DAB: 3,3’-
diaminobenzidine tetrahydrochloride chromogen solution; HPF: High power
field analyzed; ICCC: Intra-class correlation coefficient.
Acknowledgements
This study has been partially supported by Greiner Bio-One (Greiner Bio-One,
Kremsmunster, Österreich). In particular we thank Mag. Michaela Neuhofer
for her particular involvement in the research field on the HPV topic
(Product Manager Saliva Systems-Clinical Research Laboratory/Greiner Bio-
One GmbH - Blumauerstraße 3 - 5 / A-4020 Linz - Austria). Furthermore, we
thank Dr. Michael Schleichert and Dr. Martha Formanek for their precious
contribution to HPV-DNA isolation and genotyping (HPV Diagnostic Lambda
GmbH Gewerbepark 2 A-4261 Rainbach - Austria).
Author details
1
Department of Surgical Sciences - Section of Anatomic Pathology and
Cytopathology, University of Foggia, Viale Luigi Pinto 1, 71122 Foggia, Italy.
2
Dipartimento di Scienze per la promozione della Salute - Sez. Anatomia
Patologica, Università degli Studi di Palermo, A.O.U. Policlinico “P. Giaccone”
- Via del Vespro 129, 90127 Palermo, Italy.
3
Department of Surgical Sciences -
Section of Oral Pathology, University of Foggia, Foggia, Italy.
4
Istituto
Nazionale per lo Studio e la Cura dei Tumori - Fondazione ‘G. Pascale’,
Naples, Italy.
5
Dipartimento di Scienze Stomatologiche, Università di Palermo,
Via del Vespro 129, 90127 Palermo, Italy.
6
Sezione di Anatomia Patologica,
Università Politecnica delle Marche, Ancona, Italy.
7
Department of
Otolaryngology - Head and Neck Surgery - Laboratory of Oral, Head and
Neck Cancer Invasion and Metastasis, Medical School, University of Michigan
Ann Arbor, Ann Arbor, MI, USA.
8
Dipartimento di Scienze Biomorfologiche e
Funzionali, Università degli Studi di Napoli ‘Federico II’, Via Sergio Pansini 5,
80131 Naples, Italy.
9
Laboratory of Molecular Biology and Viral Oncogenesis
& AIDS Reference Center, Istituto Nazionale Tumori Fondazione G. Pascale,
Via Mariano Semmola 1, 80131 Naples, Italy.
Authors’contributions
PG, SA, CG, RC, PS carried out the molecular studies, participated in the
sequence alignment and drafted the manuscript. PMC, CS carried out the
immunoassays. FR, BG, AG participated in the sequence alignment. RV, LLM
participated in the design of the study and SA performed the statistical
analysis. PG; SA PB, SS conceived of the study, and participated in its design
and coordination and DRG, TML, BFM have made contributions to
acquisition, analysis and interpretation of data and helped to draft the
manuscript. All Authors read and approved the final manuscript.
Competing interests
The authors declare that they have no competing interests.
Received: 15 December 2011 Accepted: 29 February 2012
Published: 29 February 2012
References
1. Gillison ML, Koch WM, Capone RB: Evidence for a causal association
between human papillomavirus and a subset of Head and Neck
Cancers. J Natl Cancer Inst 2000, 92:709-720.
2. Lo Muzio L, Campisi G, Giovannelli L, Ammatuna P, Greco I, Staibano S,
Pannone G, De Rosa G, Di Liberto C, D’Angelo M: HPV-DNA and survivin
expression in epithelial oral carcinogenesis: a relationship? Oral Oncol
2004, 40(7):736-741.
3. Paz IB, Cook N, Odom-Maryon T, et al:Human papillomavirus (HPV) in
Head and Neck Cancer: an association of HPV 16 with squamous cell
carcinoma of Waldeyer’s tonsillar ring. Cancer 1997, 79:595-604.
4. Ryerson AB, Peters ES, Coughlin SS, et al:Burden of potentially human
papillomavirus-associated cancers of the oropharynx and oral cavity in
the US, 1998-2003. Cancer 2008, 113:2901-2909.
5. Charfi L, Jouffroy T, de Cremoux P, et al:Two types of squamous cell
carcinoma of the palatine tonsil characterized by distinct etiology,
molecular features and outcome. Cancer Lett 2008, 260:72-78.
6. Pannone G, Santoro A, Papagerakis S, Lo Muzio L, De Rosa G, Bufo P: The
role of human papillomavirus in the pathogenesis of head & neck
squamous cell carcinoma: an overview. Infectious Agents and Cancer 2011,
6:4.
7. Syrjänen K, Syrjänen S, Lamberg M, Pyrhönen S, Nuutinen J: Morphological
and immunohistochemical evidence suggesting human papillomavirus
(HPV) involvement in oral squamous cell carcinogenesis. Int J Oral Surg
1983, 12:418-424.
8. Clifford GM, Smith JS, Plummer M, Munoz N, Franceschi S: Human
papillomavirus types in invasive cervical cancer worldwide: a meta-
analysis. Br J Cancer 2003, 88:63-73.
9. Campisi G, Panzarella V, Giuliani M, Lajolo C, Di Fede O, Falaschini S, Di
Liberto C, Scully C, Lo Muzio L: Human papillomavirus: its identity and
controversial role in oral oncogenesis, premalignant and malignant
lesions (review). Int J Oncol 2007, 30(4):813-823.
10. Syrjänen S, Lodi G, von Bültzingslöwen I, Aliko A, Arduino P, Campisi G,
Challacombe S, Ficarra G, Flaitz C, Zhou HM, Maeda H, Miller C, Jontell M:
Human papillomaviruses in oral carcinoma and oral potentially
malignant disorders: a systematic review. Oral Dis 2011, 17(S1):58-72.
11. Termine N, Panzarella V, Falaschini S, Russo A, Matranga D, Lo Muzio L,
Campisi G: HPV in oral squamous cell carcinoma vs Head and Neck
squamous cell carcinoma biopsies: a meta-analysis (1988-2007). Ann
Oncol 2008, 19(10):1681-1690.
12. Cairns P, Polascik TJ, Eby Y, Tokino K, Califano J, Merlo A, Mao L, Herath J,
Jenkins R, Westra W, et al:Frequency of homozygous deletion at p16/
CDKN2 in primary human tumours. Nat Genet 1995, 11(2):210-212.
13. Merlo A, Herman JG, Mao L, Lee DJ, Gabrielson E, Burger PC, Baylin SB,
Sidransky D: 5’CpG island methylation is associated with transcriptional
silencing of the tumour suppressor p16/CDKN2/MTS1 in human cancers.
Nat Med 1995, 1(7):686-692.
14. Herman JG, Merlo A, Mao L, Lapidus RG, Issa JP, Davidson NE, Sidransky D,
Baylin SB: Inactivation of the CDKN2/p16/MTS1 gene is frequently
associated with aberrant DNA methylation in all common human
cancers. Cancer Res 1995, 55(20):4525-4530.
15. Gonzalez-Zulueta M, Bender CM, Yang AS, Nguyen T, Beart RW, Van
Tornout JM, Jones PA: Methylation of the 5’CpG island of the p16/
CDKN2 tumor suppressor gene in normal and transformed human
tissues correlates with gene silencing. Cancer Res 1995, 55(20):4531-4535.
16. Reed AL, Califano J, Cairns P, Westra WH, Jones RM, Koch W, Ahrendt S,
Eby Y, Sewell D, Nawroz H, Bartek J, Sidransky D: High frequency of p16
(CDKN2/MTS-1/INK4A) inactivation in Head and Neck squamous cell
carcinoma. Cancer Res 1996, 56(16):3630-3633.
17. Rischin D, Young R, Fisher R, Le Q, Peters L, Choi J, O’Sullivan B, Giralt J,
McArthur G: Prognostic significance of HPV and p16 status in patients
with oropharyngeal cancer treated on a large international phase III trial
[abstract]. J Clin Oncol 2009, 27(15s):Ab 6004.
Pannone et al.Infectious Agents and Cancer 2012, 7:4
http://www.infectagentscancer.com/content/7/1/4
Page 13 of 14
18. Reimers N, Kasper HU, Weissenborn SJ, et al:Combined analysis of HPV-
DNA, p16 and EGFR expression to predict prognosis in oropharyngeal
cancer. Int J Cancer 2007, 120:1731-1738.
19. National Comprehensive Cancer Network (NCCCN) Guidelines™Version
1.2011-Head and Neck Cancers. [http://www.nccn.org/professionals/
physician_gls/f_guidelines.asp].
20. Umudum H, Rezanko T, Dag F, Dogruluk T: Human papillomavirus
genome detection by in situ hybridization in fine-needle aspirates of
metastatic lesions from head and neck squamous cell carcinomas.
Cancer Cytopathol 2005, 105(3):171-177.
21. El-Mofty SK, Zhang MQ, Davila RM: Histologic identification of human
papillomavirus (HPV)-related squamous cell carcinoma in cervical lymph
nodes: a reliable predictor of the site of an occult Head and Neck
primary carcinoma. Head Neck Pathol 2008, 2(3):163-168.
22. Pannone G, Santoro A, Carinci F, Bufo P, Papagerakis SM, Rubini C,
Campisi G, Giovannelli L, Contaldo M, Serpico R, Mazzotta M, Lo Muzio L:
Double demonstration of oncogenic high risk human papilloma virus
DNA and HPV-E7 protein in oral cancers. Int J Immunopathol Pharmacol
2011, 24(S2):95-101.
23. Scapoli L, Palmieri A, Rubini C, Martinelli M, Spinelli G, Ionna F, Carinci F:
Low prevalence of human papillomavirus in squamous-cell carcinoma
limited to oral cavity proper. Mod Pathol 2009, 22(3):366-372.
24. Hines LE, Ceron-Cabrera D, Romero K, Anthony M, Woosley RL,
Armstrong EP, Malone DC: Evaluation of warfarin drug interaction listings
in US product information for warfarin and interacting drugs. Clin Ther
2011, 33(1):36-45.
25. Amortegui AJ, Meyer MP, Elborne VL, Amin RM: p53, retinoblastoma gene
product, and cyclin protein expression in human papillomavirus virus
DNA-positive cervical intraepithelial neoplasia and invasive cancer. Mod
Pathol 1995, 8(9):907-912.
26. Keating JT, Cviko A, Riethdorf S, Riethdorf L, Quade BJ, Sun D, Duensing S,
Sheets EE, Munger K, Crum CP: Ki-67, cyclin E, and p16INK4 are
complimentary surrogate biomarkers for human papilloma virus-related
cervical neoplasia. Am J Surg Pathol 2001, 25(7):884-891.
27. O’Neill CJ, McCluggage WG: p16 expression in the female genital tract
and its value in diagnosis. Adv Anat Pathol 2006, 13(1):8-15.
28. Marur S, D’Souza G, Westra WH, Forastiere AA: HPV-associated Head and
Neck Cancer: a virus-related cancer epidemic. Lancet Oncol 2010,
11(8):781-789.
29. Fischer CA, Kampmann M, Zlobec I, Green E, Tornillo L, Lugli A,
Wolfensberger M, Terracciano LM: p16 expression in oropharyngeal
cancer: its impact on staging and prognosis compared with the
conventional clinical staging parameters. Ann Oncol 2010,
21(10):1961-1966.
30. Doxtader EE, Katzenstein AL: The relationship between p16 expression
and high-risk human papillomavirus infection in squamous cell
carcinomas from sites other than - uterine cervix: a study of 137 cases.
Hum Pathol 2011, 43(3):327-332.
31. El-Mofty SK, Lu DW: Prevalence of human papillomavirus type 16 DNA in
squamous cell carcinoma of the palatine tonsil, and not the oral cavity,
in young patients: a distinct clinicopathologic and molecular disease
entity. Am J Surg Pathol 2003, 27:1463-1470.
32. Cullen AP, Reid R, Campion M, Lörincz AT: Analysis of the physical state of
different human papillomavirus DNAs in intraepithelial and invasive
cervical neoplasm. J Virol 1991, 65:606-612.
33. Dǚrst St M, Kleinheinz A, Hotz M, Gissmann L: The physical state of human
papillomavirus type 16 DNA in benign and malignant genital tumours. J
Gen Virol 1985, 66:1515-1522.
34. Snijders PJ, Cromme FV, van den Brule AJ, Schrijnemakers HF, Snow GB,
Meijer CJ, Walboomers JM: Prevalence and expression of human
papillomavirus in tonsillar carcinomas, indicating a possible viral
etiology. Int J Cancer 1992, 51(6):845-850.
35. Mellin H, Dahlgren L, Munck-Wikland E, Lindholm J, Rabbani H, Kalantari M,
et al:Human papillomavirus type 16 is episomal and a high viral load
may be correlated to better prognosis in tonsillar cancer. Int J Cancer
2002, 102:152-158.
36. Prado JC, Calleja-Macias IE, Bernard HU, Kalantari M, Macay SA, Allan B,
Williamson AL, Chung LP, Collins RJ, Zuna RE, Dunn ST, Ortiz-Lopez R,
Barrera-Saldaña HA, Cubie HA, Cuschieri K, von Knebel-Doeberitz M,
Sanchez GI, Bosch FX, Villa LL: Worldwide genomic diversity of the human
papillomaviruses-53, 56, and 66, a group of high-risk HPVs unrelated to
HPV16 and HPV-18. Virology 2005, 340(1):95-104.
37. Kim SH, Koo BS, Kang S, Park K, Kim H, Lee KR, Lee MJ, Kim JM, Choi EC,
Cho NH: HPV integration begins in the tonsillar crypt and leads to the
alteration of p16, EGFR and c-myc during tumor formation. Int J Cancer
2007, 120(7):1418-1425.
38. van Houten VM, Snijders PJ, van den Brekel MW: Biological evidence that
human papillomaviruses are etiologically involved in a subgroup of
Head and Neck squamous cell carcinomas. Int J Cancer 2001, 93:232-235.
39. Klussmann JP, Weissenborn SJ, Wieland U, Dries V, Kolligs J,
Jungehuelsing M, et al:Prevalence, distribution, and viral load of human
papillomavirus 16 DNA in tonsillar carcinomas. Cancer 2001,
92(11):2875-2884.
40. Schache AG, Triantafilos Liloglou, Risk Janet M, Anastasia Filia, Jones
Terence M, Jon Sheard, Woolgar Julia A, Helliwell Timothy R, Asterios
Triantafyllou, Max Robinson, Philip Sloan, Colin Harvey-Woodworth,
Daniel Sisson, Shaw Richard J: Evaluation of Human Papilloma Virus
Diagnostic Testing in Oropharyngeal Squamous Cell Carcinoma:
Sensitivity, Specificity, and Prognostic Discrimination. Clin Cancer Res
2011, 17:6262-6271.
41. Greene FL, Page DL, Fleming ID, Fritz AG, Balch CM, Haller DG, et al:
American Joint Committee on Cancer New York: Cancer Staging Manual.
Springer; 2002.
42. Husnjak K, Grce M, MagdićL, PavelićK: Comparison of five different
polymerase chain reaction methods for detection of human
papillomavirus in cervical cell specimens. J Virol Methods 2000,
88(2):125-134.
43. Cooper K, Herrington CS, Stickland JE, Evans MF, McGee JO: Episomal and
integrated human papillomavirus in cervical neoplasia shown by non-
isotopic in situ hybridization. J Clin Pathol 1991, 44:990-996.
44. Evans MF, Mount SL, Beatty BG, Cooper K: Biotinyltyramide-based in situ
hybridization signal patterns distinguish human papillomavirus type and
grade of cervical intraepithelial neoplasia. Mod Pathol 2002, 15:1339-1347.
45. Guo M, Gong Y, Deavers M, Silva EG, Jan YJ, Cogdell DE, Luthra R, Lin E,
Lai HC, Zhang W, Sneige N: Evaluation of a commercialized in situ
hybridization assay for detecting human papillomavirus DNA in tissue
specimens from patients with cervical intraepithelial neoplasia and
cervical carcinoma. J Clin Microbiol 2008, 46(1):274-280.
46. Hopman AH, Kamps MA, Smedts F, Speel EJ, Herrington CS, Ramaekers FC:
HPV in situ hybridization: impact of different protocols on the detection
of integrated HPV. Int J Cancer 2005, 115(3):419-428.
47. Hale CA, Fleiss JL: Interval estimation under two study designs for kappa
with binary classifications. Biometrics 1993, 49(2):523-534.
48. Nam JM: Interval estimation of the kappa coefficient with binary
classification and an equal marginal probability model. Biometrics 2000,
56(2):583-585.
49. Landis JR, Koch GG: The measurement of observer agreement for
categorical data. Biometrics 1977, 33(1):159-174.
doi:10.1186/1750-9378-7-4
Cite this article as: Pannone et al.: Evaluation of a combined triple
method to detect causative HPV in oral and oropharyngeal squamous
cell carcinomas: p16 Immunohistochemistry, Consensus PCR HPV-DNA,
and In Situ Hybridization. Infectious Agents and Cancer 2012 7:4.
Submit your next manuscript to BioMed Central
and take full advantage of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution
Submit your manuscript at
www.biomedcentral.com/submit
Pannone et al.Infectious Agents and Cancer 2012, 7:4
http://www.infectagentscancer.com/content/7/1/4
Page 14 of 14
