Content uploaded by Luis Lowe
Author content
All content in this area was uploaded by Luis Lowe
Content may be subject to copyright.
Available via license: CC BY
Content may be subject to copyright.
Nipah virus (NiV) is a highly pathogenic paramyxovirus
that causes fatal encephalitis in humans. The initial outbreak
of NiV infection occurred in Malaysia and Singapore in
1998–1999; relatively small, sporadic outbreaks among
humans have occurred in Bangladesh since 2001. We
characterized the complete genomic sequences of identical
NiV isolates from 2 patients in 2008 and partial genomic
sequences of throat swab samples from 3 patients in
2010, all from Bangladesh. All sequences from patients in
Bangladesh comprised a distinct genetic group. However,
the detection of 3 genetically distinct sequences from
patients in the districts of Faridpur and Gopalganj indicated
multiple co-circulating lineages in a localized region over a
short time (January–March 2010). Sequence comparisons
between the open reading frames of all available NiV genes
led us to propose a standardized protocol for genotyping
NiV; this protcol provides a simple and accurate way to
classify current and future NiV sequences.
Nipah virus (NiV) is a deadly paramyxovirus that was
fi rst described during 1998–1999 in Malaysia and
Singapore, when a large epidemic of fatal encephalitis
occurred in humans (283 cases, 109 deaths) (1). In this
initial outbreak, most human cases were epidemiologically
linked with activities involving close contact with sick pigs;
the outbreak ended after >1 million pigs were culled and
movement of pigs was stopped (2). Although NiV infection
has not been detected in Malaysia or Singapore since 1999,
NiV has caused recurring (almost annual) outbreaks of
fatal encephalitis in Bangladesh and sporadic outbreaks
in India since 2001 (3–6). The outbreaks in Bangladesh
have demonstrated human-to-human and foodborne
transmission of NiV (7–9). Although the outbreaks in
Bangladesh have been smaller, the case-fatality rates have
been consistently higher (≈75%) than those from the initial
outbreak in Malaysia and Singapore (≈40%) (8,10). The
clinical case defi nition used in Bangladesh differs from that
used during the Malaysia outbreak and focuses on fatal or
severe neurologic signs and symptoms. Sequence analysis
of virus isolates and clinical samples obtained from persons
affected by the outbreaks in Bangladesh and India indicated
greater nucleotide heterogeneity than those from Malaysia
(3,4,11).
Within 2 weeks in Bangladesh during February 2008,
2 clusters of human NiV infection resulted in 10 cases
with 9 deaths (90% case-fatality rate). The locations of
the clusters (Rajbari and Manikgonj districts) were ≈44
km apart, separated by the intersection of the Padma and
Jamuna Rivers. The outbreak was linked to ingestion of
raw date palm sap (12). From December 2009 through
March 2010, an outbreak of NiV infection in Fardipur and
Gopalganj districts was responsible for 17 cases and 15
deaths (88% case-fatality rate) (6).
In this study, we confi rmed the suspected clinical cases
of NiV infection from both outbreaks by using IgM and IgG
ELISAs, real-time and conventional reverse transcription
PCR (RT-PCR), and virus isolation. We characterized the
complete genomic sequences of 2 identical NiV isolates
from 2008 and 3 partial genomic sequences of isolates
from 2010. Our results indicate the presence of multiple
co-circulating lineages of NiV in a localized region over a
short time in 2010. Phylogenetic and sequence analysis of
Characterization of Nipah Virus
from Outbreaks in Bangladesh,
2008–2010
Michael K. Lo, Luis Lowe, Kimberly B. Hummel, Hossain M.S. Sazzad, Emily S. Gurley,
M. Jahangir Hossain, Stephen P. Luby, David M. Miller, James A. Comer, Pierre E. Rollin,
William J. Bellini, and Paul A. Rota
RESEARCH
248 Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 18, No. 2, February 2012
Author affi liations: Centers for Disease Control and Prevention,
Atlanta, Georgia, USA (M.K. Lo, L. Lowe, K.B. Hummel, D.M. Miller,
J.A. Comer, P.E. Rollin, W.J. Bellini, P.A. Rota); and International
Centre for Diarrheal Disease Research, Bangladesh, Dhaka,
Bangladesh (H.M.S. Sazzad, E.S. Gurley, M.J. Hossain, S.P. Luby)
DOI: http://dx.doi.org/10.3201/eid1802.111492
Characterization of Nipah Virus, Bangladesh
all currently available full-length NiV gene open reading
frames (ORFs) led us to propose a standardized protocol
for genotyping NiV.
Methods
Sample Collection and Case Defi nition
We collected blood, cerebrospinal fl uid (CSF), urine,
and throat swab samples from patients with suspected
cases. The serum and CSF samples were separated into
aliquots locally, and all specimens were transported to
the International Centre for Diarrheal Disease Research,
Bangladesh (ICDDR,B) in cold packs or in liquid nitrogen
for subsequent storage at −70°C. Serum and CSF samples
were initially tested for IgM against NiV at ICDDR,B
and then sent to the Centers for Disease Control and
Prevention (CDC) (Atlanta, GA, USA) for confi rmatory
testing. Samples were confi rmed as NiV positive if IgM
against NiV was found in serum or CSF; if NiV RNA was
amplifi ed; or if NiV was isolated from CSF, urine, or throat
swab samples (6,12).
Serologic Testing
Serum samples were tested at ICDDR,B for IgM against
NiV by ELISA as described (1,3,13). At CDC, samples
were irradiated with gamma rays before confi rmatory
testing for IgM and IgG against NiV as described (3).
Detection of NiV by Real-Time, Conventional RT-PCR,
and Virus Isolation
Virus isolation was attempted on Vero E6 cells as
described (1). Human urine, CSF, and oropharyngeal
swab samples were inactivated in guanidine isothiocynate
(GITC) at a dilution of 1 part sample to 5 parts GITC.
RNA was extracted by the acid GITC–phenol–chloroform
method (14). Real-time RT-PCR (rRT-PCR) was
performed by using the following primers that amplifi ed
a 112-nt fragment spanning from positions 538 to 650 in
the NiV N gene: forward primer NVBNF2B 5′-CTGG
TCTCTGCAGTTATCACCATCGA-3′, reverse primer
NVBN593R 5′-ACGTACTTAGCCCATCTTCTAGTTT
CA-3′, and probe NVBN542P 5′-CAGCTCCCGACAC
TGCCGAGGAT-3′, with the FAM dye incorporated at
the 5′ terminus and a BHQ1 quencher molecule at the
3′ terminus. The rRT-PCR cycling conditions were as
follows: 48°C for 30 min, 95°C for 10 min, and 45 cycles
of 95°C for 15 s followed by 1 min at 60°C. Synthetic
NiV N gene RNA was produced by in vitro transcription
that used pTM1-N plasmid (15) with Megascript kit
(Ambion, Austin, TX, USA) according to manufacturer’s
instructions. An Applied Biosystems 7900HT machine
was used for rRT-PCRs, and the PCR Core Kit along with
MultiScribe Reverse Transcriptase were used for the rRT-
PCR master mix (all from Applied Biosystems, Foster
City, CA, USA). Conventional RT-PCR was performed
with the SuperScript One-Step RT-PCR kit with Platinum
Taq (Invitrogen, Carlsbad, CA, USA) as described (11).
Two-step RT-PCR was performed for selected samples
by using SuperScript III First-Strand Synthesis System
(Invitrogen) to generate cDNA and Platinum Taq DNA
Polymerase High Fidelity (Invitrogen) for the PCR. Briefl y,
8 μL of extracted RNA was used in a 20-μL RT reaction
with a primer complementary to the 3′ leader NVB3END
(5′-ACCAAACAAGGGAAAATATGGATACGTT-3′)
and the 5′ trailer NIP5END (5′-ACCGAACAAGGG
TAAAGAAGAATCG-3′) sequences of the NiV genome
from the 2004 Bangladesh outbreak (GenBank accession
no. AY988601). Subsequently, 2 μL of the cDNA reaction
was used in 50-μL PCRs to amplify the N, P, M, F, G,
and L ORFs with corresponding primer sets that anneal
to the noncoding regions for the respective genes: N ORF
NVBN5NCF1 (5′-GGTCTTGGTATTGGATCCTC-3′) and
NVBN3NCR1 (5′-GTTTAATCTAAGTTAAGATTG-3′);
P ORF NVBPPCRFW (5′-AGCAGTTATCAGCTGGG
AGTTCAACTTAC-3′) and NVBPPCRREV (5′-ATGC
GTGAATGAACTACAATACGAATCGAC-3′); M ORF
NVBMPCRFW (5′-TCCAATAACTGGTCAATTGAG
GACAGAAATCCTG-3′) and NVBMPCRREV (5′-CATA
ATAGTTGTCTAATTATTAACCGAATATTCAC-3′);
F ORF NVBPCRFFW (5′-CAAGCATTATTACTATCT
GATCAACAAAAGGATTGG-3′) and NVBPCRFREV
(5′-GAATATCAACTGTTCATTCATGGTTGAGTAC-
3′); G ORF NVBPCRGFW (5′-CAGGTCCATAACT
CATTGGATATTAAACTGTGTCC-3′) and NVBPCR
GREV (5′-CAAGATTTAGCTCTACTATATCAAATG
GAGTTTCAGTCAAG-3′); and L ORF (amplifi ed in 2
fragments) NVBPCRL1FW (5′-CAGGTCCTTGATTGTG
CTAATTTTCTTGAG-3′) and FRAG4REV (5′-GAT
CTTATCAGGCCTTTAGTTGTATCTAATAGACC-3′),
FRAG5FW (5′-TGAGGACCTTGAACTAGCTAGCTTC
CT-3′) and NVBLREV (5′-AATTGTCGGTCGGTTC
TGGACTTGGAAGATCAAATCAGATAATGGAT
ATG-3′). PCR products were analyzed by agarose gel
electrophoresis with GelRed staining (Biotium, Hayward,
CA, USA), gel purifi ed, and sequenced as described (3,11).
Rapid amplifi cation of cDNA ends was performed by
using the 5′ RACE Kit 2.0 (Invitrogen). Phylogenetic and
molecular analyses of the sequences were performed by
using MEGA5 (16).
Results
Of the 10 cases from the 2008 outbreak in Bangladesh,
5 were confi rmed positive for NiV infection by at least
1 laboratory test at CDC. Of those 5 positive cases, 4
were positive for IgM; 2 for IgG; 3 by rRT-PCR; and 2
by conventional RT-PCR; 2 throat swab samples yielded
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 18, No. 2, February 2012 249
RESEARCH
live NiV, 1 from Manikgonj (NiV/BD/HU/2008/MA
[BD, Bangladesh; HU, human]; accession no. JN808857)
and 1 from Rajbari (NiV/BD/HU/2008/RA; accession no.
JN808863) (Table 1). Despite the isolates having come from
patients from 2 districts, sequence analysis of the entire
genome of the 2 isolates indicated that they were identical.
Phylogenetic analysis of ORFs from each NiV gene
indicated that this strain was similar to, but distinct from,
the 2007 isolate from India (NiV/IN/HU/2007/FG [IN,
India]; accession no. FJ513078) (Figure 1, panel A; Figure
2, panels A–E). To rule out the possibility of laboratory
contamination, we performed 2-step conventional RT-PCR
by using RNA from duplicate samples of the original throat
swab samples from which the 2 viruses were isolated. We
amplifi ed the entire N gene ORF from each sample and
confi rmed that the sequences were identical. Although
there were 4 isolated cases of NiV infection in Bangladesh
in 2009 as confi rmed by IgM or IgG ELISA, or both, we
were not able to obtain NiV sequences from those case-
patients (Table 1).
Of the 17 cases from the 2010 outbreak in Bangladesh,
12 were confi rmed positive. All 12 were positive for IgM,
2 for IgG, 5 by rRT-PCR, and 3 by conventional 2-step
RT-PCR (Table 1). Although we detected NiV RNA by
rRT-PCR from urine, CSF, and throat swab samples, we
were unable to isolate virus from any of those sources.
Of the 3 samples from which we were able to amplify
NiV sequences, 1 was from a 10-year-old girl from the
initial cluster (NiV/BD/HU/2010/FA2; accession no.
JN808859) and the other 2 were from patients with
isolated cases. The patients with isolated cases were a
medical intern (NiV/BD/HU/2010/FA1; accession no.
JN808864) who was working in the pediatric department
at Faridpur Medical College Hospital and a 7-year-old
girl (NiV/BD/HU/2010/GO; accession no. JN808860)
who was examined by the same medical intern; both died.
The illness developed in the intern only 6 days after the
7-year-old girl died; this incubation period was atypically
short for NiV infection, indicating the possibility of
separate infections (6). Sequence analysis of the N ORFs
amplifi ed from throat swab samples confi rmed that the
intern and the girl were infected with distinct lineages
of NiV (Figure 1, panel A). Our attempts to recover NiV
sequences from prior contacts of the medical intern who
were IgM positive for NiV infection were unsuccessful.
Phylogenetic analysis indicated that the sequence from the
7-year-old girl was similar to, but distinct from, the 2007
isolate from India, whereas the sequence from the intern
was closer to that of the 2004 isolate from Bangladesh
(NiV/BD/HU/2004/RA1; accession no. AY988601). The
N sequence obtained from the 10-year-old girl from the
initial cluster was shown to be slightly more similar to
the 2007 isolate from India (Figure 1, panel A). We were
only able to amplify the complete N ORF from the throat
swab samples from the 7-year-old and 10-year-old girls
because our rRT-PCR indicated the presence of ≈103 to
104 copies of NiV N RNA (cycle threshold ≈26–30). The
rRT-PCR conducted on the throat swab sample from the
medical intern indicated the presence of ≈106 copies of
NiV N RNA (cycle threshold ≈20), which corroborated
250 Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 18, No. 2, February 2012
Table 1. Results from patients with confirmed Nipah virus infection, Bangladesh, 2008–2010*
Patient no. Year isolated Case type
Serologic result RT-PCR result
Virus isolation IgM IgG Conventional Real-time
1 2008 Cluster + + – – –
2 2008 Cluster + – – + –
3 2008 Cluster – – + + +
4 2008 Cluster + – + + +
5 2008 Cluster + + – – –
6 2009 Isolated + + NA NA NA
7 2009 Isolated + – NA NA NA
8 2009 Isolated + – NA NA NA
9 2009 Isolated + – NA NA NA
10 2010 Cluster + – NA NA NA
11 2010 Cluster + – + + –
12 2010 Cluster + – – + –
13 2010 Cluster + – NA NA NA
14 2010 Cluster + + NA NA NA
15 2010 Isolated + – – + –
16 2010 Isolated + + + + –
17 2010 Isolated + – + + –
18 2010 Isolated + – NA NA NA
19 2010 Isolated + – NA NA NA
20 2010 Isolated + – NA NA NA
21 2010 Isolated + – NA NA NA
*RT-PCR, reverse transcription PCR; +, positive; –, negative; NA, sample not available.
Characterization of Nipah Virus, Bangladesh
our ability to amplify nearly the entire genome except
for the 3′ leader and 5′ trailer (data not shown) from this
sample.
Since the initial molecular characterization of NiV
from Bangladesh in 2004 (11), there has been a shortage
of full-length NiV ORF sequences from Bangladesh.
However, the sequence data obtained from the 2008 and
2010 Bangladesh outbreaks in this study, along with the
recent characterization of the 2007 isolate from India (4),
support the previous observation of relative heterogeneity
among NiV nucleotide sequences from humans affected
by outbreaks in Bangladesh compared with sequences
from Malaysia (11). Phylogenetic analysis indicated that
these new sequences from Bangladesh and India group
substantially closer to the sequences from Bangladesh in
2004, which led us to propose a system to describe the
distinct lineages of NiV (Figure 1; Figure 2, panels A–E).
We propose to designate the current sequences obtained
from Malaysia (MY) and Cambodia (KH) as genotype M
and the sequences obtained from Bangladesh and India as
genotype B. By using a 729-nt window in the N terminal
region of the N gene ORF (N ORF nt 123–852, NiV genome
positions 236–964), we were able to determine 25 distinct
nucleotides that universally differentiated the genotypes
(Figure 1, panel B). The topology of the phylogenetic
tree and the positions of the branches generated from this
smaller nucleotide window were similar to those of the
tree generated with the full-length N ORF sequences and
have reasonably high bootstrap values at the root branch
junctions, albeit with lower bootstrap values at the distal
branch junctions (Figure 1, panels A, B). In support of this
scheme, we observed similar topologies and branching
patterns in phylogenetic trees generated for the complete
P, M, F, G, and L ORFs, all with strong bootstrap values
(Figure 2, panels A–E).
Pairwise sequence comparisons conducted across each
individual NiV gene ORF indicated a nucleotide variation
range of 6.32%–9.15% between genotype M and B viruses
and an amino acid variation range of 1.42%–9.87% (Table 2;
online Technical Appendix, wwwnc.cdc.gov/EID/pdfs/11-
1492-Techapp.pdf). The ranges of nucleotide and amino
acid variation of sequences within genotype M were 0.19%–
2.21% and 0.18–3.67%, respectively, and within genotype
B were 0.28%–1.06% and 0.28% –0.56%, respectively. The
apparently higher levels of variation found among ORFs
within genotype M is mostly caused by the comparatively
divergent sequences obtained from Pteropus vampyrus
(NiV/MY/BA/2010/MY; accession no. FN869553)
and P. lylei (NiV/KH/BA/2004/KHM; accession nos.
AY858110, AY858111) bats. Not only is the proposed
genotyping scheme supported by consistent phylogenetic
tree topologies, but pairwise nucleotide comparisons of
the 729-nt region yield similar percentages of variability
as seen in the full-length N ORF comparisons. This fi nding
indicates that this sequence window is a relatively accurate
indicator of overall nucleotide variability within and across
genotypes M and B (online Technical Appendix Figure 1,
panels A, C).
A comprehensive amino acid alignment of currently
available complete N protein ORFs indicated that the
4 residues that distinguish between genotype M and B
viruses are almost all located in the COOH-terminus
(Table 3). Of these residues, only 1 (position 387) is located
within the putative minimum contiguous sequence required
for capsid assembly (17), and none were located in the 29
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 18, No. 2, February 2012 251
Figure 1. Phylogenetic analyses of sequences from the complete
Nipah virus N ORF (A) and the 729-nt proposed N ORF genotyping
window (B). Tree created with maximum parsimony, close-
neighbor-interchange algorithm, 1,000 bootstrap replicates (16).
Branch lengths are in units of number of changes over the whole
sequence. Available GenBank accession numbers are shown
for corresponding sequences. Proposed genotype groupings
are indicated by brackets (M, B). ORF, open reading frame; MY,
Malaysia; KH, Cambodia; BD, Bangladesh; IN, India; HU, human;
PI, pig; BA, bat. Scale bars indicate number of sequence changes
corresponding to illustrated branch length.
RESEARCH
COOH-terminal and 10 NH-terminal residues required for
interaction with the P protein (18,19). Of note, there are
4 residues (V429, E432, D457, and T521) in the COOH-
terminal region common to all genotype B sequences that
are shared with 2 of the comparatively divergent genotype M
sequences. In light of the overall nucleotide and amino acid
sequence comparisons, however, the divergent genotype
M sequences from the bats still differ substantially from
genotype B sequences (Figure 1, panel A; Figure 2, panels
A–E; online Technical Appendix Figure 1, panels A, B).
Amino acid alignments of the P protein indicated
numerous differences between genotype M and B
sequences in the fi rst 400 residues, which comprise
the shared N terminal region between the P, V, and W
proteins. Of the differences in this region, there were
neither changes that would be predicted to alter the STAT-
1 binding ability of the P, V, and W proteins nor changes
that could adversely affect RNA replication (20–22). There
were only 4 changes in the COOH-terminal region of P,
which is required for direct N–P interactions, 2 of which
were nonconservative changes (N590→S, E635→G) (18).
The P sequence derived from P. vampyrus bats had an
intriguing sequence of amino acids from residues 408–440,
in which there was substantial sequence divergence from
genotypes M and B at the nucleotide and amino acid levels
(23). These particular nucleotide changes in the P sequence
also introduced several amino acid changes in the unique
COOH-terminal regions of the V (11 changes) and W (9
changes) ORFs, which distinguish them from any genotype
M and B sequences.
We observed the M protein to be highly conserved
across genotypes M and B, and we found just 2 aa residues
exclusive to genotype B that are not located in any region
of the protein with a known function, such as budding
(24,25), nuclear localization, or ubiquitination (26). In the
F protein, the predicted cleavage site, F1 amino-terminal
domain, transmembrane domain, and predicted N-linked
glycosylation sites are all conserved across both genotypes.
Although the percentage of amino acid variation in the G
protein is higher than that in all other NiV proteins (except
the P protein), it is not surprising that the residues implicated
in Ephrin B2 and B3 binding are conserved across the
genotypes (27,28). The amino acid differences between
genotypes M and B sequences are predominantly found
252 Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 18, No. 2, February 2012
Figure 2. Phylogenetic analyses of sequences from the complete Nipah virus P ORF (A), M ORF (B), F ORF (C), G ORF (D), and L ORF
(E). Tree created with maximum parsimony, close-neighbor-interchange algorithm, 1,000 bootstrap replicates (16). Branch lengths are in
units of number of changes over the whole sequence. Available GenBank accession numbers are shown for corresponding sequences.
Proposed genotype groupings are indicated by brackets (M, B). ORF, open reading frame; MY, Malaysia; KH, Cambodia; BD, Bangladesh;
IN, India; HU, human; PI, pig; BA, bat. Scale bars indicate number of sequence changes corresponding to illustrated branch length.
Table 2. Percentage nucleotide and amino acid variability among available complete Nipah virus open reading frame sequences
Gene
Open reading frame
length, nt/aa
% nt variation % aa variation
Overall Genotype M Genotype B Overall Genotype M Genotype B
N 1,599/532 0.0–6.32 0.0–2.19 0.0–1.06 0.0–2.26 0.0–1.69 0.0–0.56
P 2,130/709 0.0–9.15 0.0–2.21 0.0–0.99 0.0–9.87 0.0–3.67 0.0–0.99
M 1,059/352 0.0–6.70 0.0–0.57 0.0–0.28 0.0–1.42 0.0–0.85 0.0–0.28
F 1,641/546 0.0–6.76 0.0–0.85 0.0–0.98 0.0–1.65 0.0–0.75 0.0–0.55
G 1,809/602 0.0–7.35 0.0–1.93 0.0–0.55 0.0–4.65 0.0–1.83 0.0–0.33
L 6,735/2244 0.0–6.68 0.01–0.19 0.0–0.82 0.0–1.92 0.0–0.18 0.0–0.45
Characterization of Nipah Virus, Bangladesh
at residues that are distant from the receptor binding site.
Two differences were found in the intracellular domain,
3 differences in the stalk region (positions 72–182), 9
differences in a span of ≈100 aa (positions 236–344) along
the side of the globular head domain, 4 differences closer
to the top of the globular head domain (positions 385–424),
and only 2 differences (positions 498 and 502) that were
close to the tryptophan residue at position 504, which is part
of the receptor-binding pocket. As in other NiV proteins,
several amino acids were shared between genotype B
sequences and 2 genotype M sequences derived from the
bat isolates. The signifi cance of these changes has yet to
be explored.
The level of amino acid conservation throughout the
L proteins was high; the purported GDNE catalytic site
and the K-X21-GEGSG ATP binding site were conserved
across genotypes M and B. Most distinct differences
between genotypes M and B sequences (26 of 32) were
located outside the 6 linear domains typically found in
nonsegmented negative strand virus polymerases (29,30).
The cis-acting control sequences in NiV are usually
well conserved. The tri-nucleotide intergenic sequences
amplifi ed from the throat swab sample from the medical
intern in 2010 had GAA for all 6 intergenic regions, which
was identical to the 2007 isolate from India. For the 2008
isolates, the intergenic sequence between the N and P
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 18, No. 2, February 2012 253
Table 3. Amino acid differences among available complete Nipah virus N gene open reading frame sequences*
Sequence and
accession no.
Amino acid position
G 30 139 188 211 318 345 380 381 387 414 429 432 436 457 502 505 506 508 511 518 521
NiV/MY/HU/1999/CDC,
AF212302
M T S E Q I M N R D K I G I N I R T G E L A
NiV/MY/PI/1999/1413,
AJ564622
M . . . . . . . . . . . . . . . . . . . . .
NiV/MY/PI/1999/2794,
AJ564621
M . . . . . . . . . . . . . . . . . . . . .
NiV/MY/PI/1999/0626,
AJ627196
M . R . . . I . . . . . . . . . . . . . . .
NiV/MY/HU/1999/0128,
AJ564623
M . . . . . . . . . . . . . . . . . . . . .
NiV/MY/HU/1999/UM1,
AY029767
M . . . . . . . . . . . . . . . . . . . . .
NiV/MY/HU/1999/UM2,
AY029768
M . . . . . . . . . . . . . . . . . . . . .
NiV/MY/BA/2000/TI,
AF376747
M I . . . . . . . . . . . . . . . . . . . .
NiV/MY/BA/2010/MY,
FN869553
M . . . . . . . . . . V E . D . . . . . . .
NiV/KH/BA/2004/KHM,
AY858110
M . . . . . . . . . . V E . D T . . . G P T
NiV/BD/HU/2004/1,
AY988601
B . . D . . . . . N . V E . D . K D R . . T
NiV/BD/HU/2004/FA,
JN808858
B . . . . . . . . N N V E M D . K D R . . T
NiV/BD/HU/2004/RA2,
JN808861
B . . . . . . . . N . V E . D . K D R . . T
NiV/BD/HU/2004/RAJ,
JN808862
B . . . . . . I . N . V E M D . K D R . . T
NiV/BD/HU/2008/MA,
JN808857
B . . . . . . . . N . V E . D . K D R . . T
NiV/BD/HU/2008/RA,
JN808863
B . . . . . . . . N . V E . D . K D R . . T
NiV/BD/HU/2010/FA1,
JN808864
B . . . . . . . K N . V E . D . K D R . . T
NiV/BD/HU/2010/GO,
JN808860
B . . . . V . . . N . V E . D . K D R . . T
NiV/BD/HU/2010/FA2,
JN808859
B . . . . . . . . N . V E . D . K D R . . T
NiV/IN/HU/2007/FG,
FJ513078
B . . . R . . . . N . V E . D . K D R . . T
*Dots indicate sequence identity with AF212302. NiV, Nipah virus; MY, Malaysia; HU, human; G, genotype classification; genotype M, sequences from
Malaysia and Cambodia; genotype B, sequences from Bangladesh and India; T, threonine, S, serine; E, glutamate; Q, glutamine; I, isoleucine; M,
methionine; N, asparagine; R, arginine; D, aspartate; K, lysine; G, glycine; V; valine; P, proline; PI, pig; BA, bat; KH, Cambodia; BD, Bangladesh; IN,
India.
RESEARCH
genes was AAA, and the rest of the intergenic sequences
were GAA. The biological implications of fi nding
adenosine in the fi rst position of NiV intergenic sequences
is unknown. The 3′ leader and 5′ trailer sequences of the
2008 NiV isolates were identical to those found in the 2004
Bangladesh and 2007 India isolates.
Discussion
From the initial outbreak of NiV in Malaysia until now,
there has not been a standard method by which to classify
NiVs. With the accumulation of sequences from subsequent
human outbreaks in Bangladesh and India, along with an
increasing number of bat-derived sequences, we propose a
standardized genotyping method for NiV. The goal behind a
genotyping scheme is to classify viruses by using a smaller
sequence window that has levels of sequence variability
that correspond to variability between complete genomes
and that would give the same phylogenetic tree topology
with high bootstrap values. Genotyping schemes for other
paramyxoviruses, such as measles virus and mumps virus,
have been delineated (31,32).
Before this study, there has been a growing body of
partial-sequence data obtained from a 357-nt region coding
for the COOH-terminus of N (NiV genome positions 1197–
1553) (23,33). Although obtaining sequence information
from this window has the advantage of tracking more
variability at the nucleotide and the amino acid levels,
it could potentially overestimate the level of variability
between sequences within and across genotypes. Pairwise
nucleotide sequence comparisons performed by using the
357-nt window estimate the overall sequence variation
at ≈8%, whereas the sequence variation of the complete
N ORF is ≈6% (Table 2; online Technical Appendix
Figure 1, panels A, D). In particular, the 357-nt window
overestimates the variability within genotype M of the P.
vampyrus bat sequence at ≈2%, whereas variability of the
sequence within genotype M is <1% when the complete
N ORF is taken into account. The 729-nt window in the
N terminal region proposed in this study would serve as a
more conservative scheme for genotyping because it has
little amino acid variation but has nucleotide variability of
≈5.5% according to pairwise comparisons between the 2
proposed genotypes, which only slightly underestimates
the variability among sequences for the complete N ORF
(online Technical Appendix Figure 1, panels A, C). As with
other genotyping schemes that facilitate the classifi cation
of viruses, our proposed scheme is amenable to corrective
measures as warranted by evidence from sequences
obtained from future outbreaks and bat surveillance studies.
In summary, we conducted a comprehensive
molecular phylogenetic analysis of currently available
complete NiV gene ORFs at the nucleotide and amino
acid levels, including newly obtained sequence data from
NiV outbreaks in Bangladesh in 2008 and 2010. Analyses
of the combined sequence data obtained from Bangladesh
and India in the past decade led us to propose a genotyping
scheme based on a 729-nt window of the NiV N ORF. This
genotyping scheme provides a simple and accurate way to
classify current and future NiV sequences.
M.K.L. was supported by an American Society for
Microbiology postdoctoral fellowship. Financial support for
this research came from CDC core funding, ICDDR,B, and
US National Institutes of Health, grant no. 07-015-0712-52200
(Bangladesh-NIH/EID).
Dr Lo is a microbiologist with the Viral Special Pathogens
Branch at CDC. His research interests include the molecular
pathogenesis and epidemiology of Nipah virus.
References
1. Chua KB, Bellini WJ, Rota PA, Harcourt BH, Tamin A, Lam SK, et
al. Nipah virus: a recently emergent deadly paramyxovirus. Science.
2000;288:1432–5. http://dx.doi.org/10.1126/science.288.5470.1432
2. Chua KB. Nipah virus outbreak in Malaysia. J Clin Virol. 2003;
26:265–75. http://dx.doi.org/10.1016/S1386-6532(02)00268-8
3. Chadha MS, Comer JA, Lowe L, Rota PA, Rollin PE, Bellini WJ,
et al. Nipah virus–associated encephalitis outbreak, Siliguri, India.
Emerg Infect Dis. 2006;12:235–40.
4. Arankalle VA, Bandyopadhyay BT, Ramdasi AY, Jadi R, Patil DR,
Rahman M, et al. Genomic characterization of Nipah virus, West
Bengal, India. Emerg Infect Dis. 2011;17:907–9.
5. Luby SP, Hossain MJ, Gurley ES, Ahmed B-N, Banu S, Khan SU,
et al. Recurrent zoonotic transmission of Nipah virus into humans,
Bangladesh, 2001–2007. Emerg Infect Dis. 2009;15:1229–35.
http://dx.doi.org/10.3201/eid1508.081237
6. International Centre for Diarrheal Disease Research. Bangladesh.
Nipah outbreak in Faridpur District, Bangladesh, 2010. Health and
Science Bulletin. 2010;8:6–11.
7. Luby SP, Rahman M, Hossain MJ, Blum LS, Husain MM, Gur-
ley E, et al. Foodborne transmission of Nipah virus, Bangladesh.
Emerg Infect Dis. 2006;12:1888–94. http://dx.doi.org/10.3201/
eid1212.060732
8. Gurley ES, Montgomery JM, Hossain MJ, Bell M, Azad AK, Islam
MR, et al. Person-to-person transmission of Nipah virus in a Bangla-
deshi community. Emerg Infect Dis. 2007;13:1031–7.
9. Luby SP, Gurley ES, Hossain MJ. Transmission of human infections
with Nipah virus. Clin Infect Dis. 2009;49:1743–8. http://dx.doi.
org/10.1086/647951
10. Lo MK, Rota PA. The emergence of Nipah virus, a highly patho-
genic paramyxovirus. J Clin Virol. 2008;43:396–400. http://dx.doi.
org/10.1016/j.jcv.2008.08.007
11. Harcourt BH, Lowe L, Tamin A, Liu X, Bankamp B, Bowden N,
et al. Genetic characterization of Nipah virus, Bangladesh, 2004.
Emerg Infect Dis. 2005;11:1594–7.
12. Rahman MA, Hossain MJ, Sultana S, Homaira N, Khan SU, Rah-
man M, et al. Date palm sap linked to Nipah virus outbreak in Ban-
gladesh, 2008. Vector Borne Zoonotic Dis. 2011; [Epub ahead of
print]. http://dx.doi.org/10.1089/vbz.2011.0656
13. Daniels P, Ksiazek T, Eaton BT. Laboratory diagnosis of Nipah and
Hendra virus infections. Microbes Infect. 2001;3:289–95. http://
dx.doi.org/10.1016/S1286-4579(01)01382-X
254 Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 18, No. 2, February 2012
Characterization of Nipah Virus, Bangladesh
14. Chomczynski P, Sacchi N. Single-step method of RNA isolation
by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem. 1987;162:156–9. http://dx.doi.org/10.1016/0003-
2697(87)90021-2
15. Halpin K, Bankamp B, Harcourt BH, Bellini WJ, Rota PA. Nipah
virus conforms to the rule of six in a minigenome replication assay.
J Gen Virol. 2004;85:701–7. http://dx.doi.org/10.1099/vir.0.19685-0
16. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S.
MEGA5: Molecular Evolutionary Genetics Analysis using maxi-
mum likelihood, evolutionary distance, and maximum parsimony
methods. Mol Biol Evol. 2011;10:2731–9. http://dx.doi.org/10.1093/
molbev/msr121
17. Ong ST, Yusoff K, Kho CL, Abdullah JO, Tan WS. Mutagenesis of
the nucleocapsid protein of Nipah virus involved in capsid assembly.
J Gen Virol. 2009;90:392–7. http://dx.doi.org/10.1099/vir.0.005710-
0
18. Chan YP, Koh CL, Lam SK, Wang LF. Mapping of domains respon-
sible for nucleocapsid protein-phosphoprotein interaction of Henipa-
viruses. J Gen Virol. 2004;85:1675–84. http://dx.doi.org/10.1099/
vir.0.19752-0
19. Omi-Furutani M, Yoneda M, Fujita K, Ikeda F, Kai C. Novel phos-
phoprotein-interacting region in Nipah virus nucleocapsid protein
and its involvement in viral replication. J Virol. 2010;84:9793–9.
http://dx.doi.org/10.1128/JVI.00339-10
20. Rodriguez JJ, Cruz CD, Horvath CM. Identifi cation of the nucle-
ar export signal and STAT-binding domains of the Nipah virus V
protein reveals mechanisms underlying interferon evasion. J Vi-
rol. 2004;78:5358–67. http://dx.doi.org/10.1128/JVI.78.10.5358-
5367.2004
21. Shaw ML, Garcia-Sastre A, Palese P, Basler CF. Nipah virus V
and W proteins have a common STAT1-binding domain yet inhibit
STAT1 activation from the cytoplasmic and nuclear compartments,
respectively. J Virol. 2004;78:5633–41. http://dx.doi.org/10.1128/
JVI.78.11.5633-5641.2004
22. Ciancanelli MJ, Volchkova VA, Shaw ML, Volchkov VE, Basler
CF. Nipah virus sequesters inactive STAT1 in the nucleus via a P
gene–encoded mechanism. J Virol. 2009;83:7828–41. http://dx.doi.
org/10.1128/JVI.02610-08
23. Rahman SA, Hassan SS, Olival KJ, Mohamed M, Chang LY, Has-
san L, et al. Characterization of Nipah virus from naturally infected
Pteropus vampyrus bats, Malaysia. Emerg Infect Dis. 2010;16:1990–
3.
24. Ciancanelli MJ, Basler CF. Mutation of YMYL in the Nipah virus
matrix protein abrogates budding and alters subcellular localization.
J Virol. 2006;80:12070–8. http://dx.doi.org/10.1128/JVI.01743-06
25. Patch JR, Han Z, McCarthy SE, Yan L, Wang LF, Harty RN, et al.
The YPLGVG sequence of the Nipah virus matrix protein is required
for budding. Virol J. 2008;5:137. http://dx.doi.org/10.1186/1743-
422X-5-137
26. Wang YE, Park A, Lake M, Pentecost M, Torres B, Yun TE, et al.
Ubiquitin-regulated nuclear-cytoplasmic traffi cking of the Nipah
virus matrix protein is important for viral budding. PLoS Pathog.
2010;6:e1001186. http://dx.doi.org/10.1371/journal.ppat.1001186
27. Negrete OA, Chu D, Aguilar HC, Lee B. Single amino acid changes
in the Nipah and Hendra virus attachment glycoproteins distinguish
ephrinB2 from ephrinB3 usage. J Virol. 2007;81:10804–14. http://
dx.doi.org/10.1128/JVI.00999-07
28. Bowden TA, Aricescu AR, Gilbert RJ, Grimes JM, Jones EY, Stuart
DI. Structural basis of Nipah and Hendra virus attachment to their
cell-surface receptor ephrin-B2. Nat Struct Mol Biol. 2008;15:567–
72. http://dx.doi.org/10.1038/nsmb.1435
29. Poch O, Blumberg BM, Bougueleret L, Tordo N. Sequence compari-
son of fi ve polymerases (L proteins) of unsegmented negative-strand
RNA viruses: theoretical assignment of functional domains. J Gen
Virol. 1990;71:1153–62. http://dx.doi.org/10.1099/0022-1317-71-5-
1153
30. Harcourt BH, Tamin A, Halpin K, Ksiazek TG, Rollin PE, Bellini
WJ, et al. Molecular characterization of the polymerase gene and ge-
nomic termini of Nipah virus. Virology. 2001;287:192–201. http://
dx.doi.org/10.1006/viro.2001.1026
31. Rota PA, Featherstone DA, Bellini WJ. Molecular epidemiology
of measles virus. Curr Top Microbiol Immunol. 2009;330:129–50.
http://dx.doi.org/10.1007/978-3-540-70617-5_7
32. Jin L, Rima B, Brown D, Orvell C, Tecle T, Afzal M, et al. Proposal
for genetic characterisation of wild-type mumps strains: preliminary
standardisation of the nomenclature. Arch Virol. 2005;150:1903–9.
http://dx.doi.org/10.1007/s00705-005-0563-4
33. Wacharapluesadee S, Hemachudha T. Duplex nested RT-PCR
for detection of Nipah virus RNA from urine specimens of bats.
J Virol Methods. 2007;141:97–101. http://dx.doi.org/10.1016/j.
jviromet.2006.11.023
Address for correspondence: Michael K. Lo, Centers for Disease Control
and Prevention, 1600 Clifton Rd, Mailstop G14, Atlanta, GA 30333, USA;
email: mko2@cdc.gov
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 18, No. 2, February 2012 255
All material published in Emerging Infectious Diseases is in
the public domain and may be used and reprinted without
special permission; proper citation, however, is required.
