Content uploaded by David M Irwin
Author content
All content in this area was uploaded by David M Irwin
Content may be subject to copyright.
A preview of the PDF is not available
Evolution of the Cytochrome-B Gene of Mammals
Abstract
With the polymerase chain reaction (PCR) and versatile primers that amplify the whole cytochrome b gene (approximately 1140 bp), we obtained 17 complete gene sequences representing three orders of hoofed mammals (ungulates) and dolphins (cetaceans). The fossil record of some ungulate lineages allowed estimation of the evolutionary rates for various components of the cytochrome b DNA and amino acid sequences. The relative rates of substitution at first, second, and third positions within codons are in the ratio 10 to 1 to at least 33. For deep divergences (greater than 5 million years) it appears that both replacements and silent transversions in this mitochondrial gene can be used for phylogenetic inference. Phylogenetic findings include the association of (1) cetaceans, artiodactyls, and perissodactyls to the exclusion of elephants and humans, (2) pronghorn and fallow deer to the exclusion of bovids (i.e., cow, sheep, and goat), (3) sheep and goat to the exclusion of other pecorans (i.e., cow, giraffe, deer, and pronghorn), and (4) advanced ruminants to the exclusion of the chevrotain and other artiodactyls. Comparisons of these cytochrome b sequences support current structure-function models for this membrane-spanning protein. That part of the outer surface which includes the Qo redox center is more constrained than the remainder of the molecule, namely, the transmembrane segments and the surface that protrudes into the mitochondrial matrix. Many of the amino acid replacements within the transmembrane segments are exchanges between hydrophobic residues (especially leucine, isoleucine, and valine). Replacement changes at first and second positions of codons approximate a negative binomial distribution, similar to other protein-coding sequences. At four-fold degenerate positions of codons, the nucleotide substitutions approximate a Poisson distribution, implying that the underlying mutational spectrum is random with respect to position.
... These tissues were stored in 2 mL cryogenic vials (CORNING, Shanghai, China) at −80 • C for subsequent analysis. Molecular biological identification involved the amplification of the mitochondrial cytochrome b (mt-Cytb) gene of liver tissue DNA using PCR as described previously [24][25][26][27]. A total of 333 small mammals, comprising thirteen species across three orders, four families, and four genera, were captured in Heqing County and Gongshan County in Yunnan Province ( Figure 1). ...
... These tissues were stored in 2 mL cryogenic vials (CORNING, Shanghai, China) at −80 °C for subsequent analysis. Molecular biological identification involved the amplification of the mitochondrial cytochrome b (mt-Cytb) gene of liver tissue DNA using PCR as described previously [24][25][26][27]. A total of 333 small mammals, comprising thirteen species across three orders, four families, and four genera, were captured in Heqing County and Gongshan County in Yunnan Province ( Figure 1). ...
Bartonella is an intracellular parasitic zoonotic pathogen that can infect animals and cause a variety of human diseases. This study investigates Bartonella infection in small mammals in Yunnan Province, China, focusing on tissue tropism. A total of 333 small mammals were sampled from thirteen species, three orders, four families, and four genera in Heqing and Gongshan Counties. Conventional PCR and real-time quantitative PCR (qPCR) were utilized for detection and quantification, followed by bioinformatic analysis of obtained DNA sequences. Results show a 31.5% detection rate, varying across species. Notably, Apodemus chevrieri, Eothenomys eleusis, Niviventer fulvescens, Rattus tanezumi, Episoriculus leucops, Anourosorex squamipes, and Ochotona Thibetana exhibited infection rates of 44.4%, 27.7%, 100.0%, 6.3%, 60.0%, 23.5%, and 22.2%, respectively. Genetic analysis identified thirty, ten, and five strains based on ssrA, rpoB, and gltA genes, with nucleotide identities ranging from 92.1% to 100.0%. Bartonella strains were assigned to B. grahamii, B. rochalimae, B. sendai, B. koshimizu, B. phoceensis, B. taylorii, and a new species identified in Episoriculus leucops (GS136). Analysis of the different tissues naturally infected by Bartonella species revealed varied copy numbers across different tissues, with the highest load in spleen tissue. These findings underscore Bartonella’s diverse species and host range in Yunnan Province, highlighting the presence of extensive tissue tropism in Bartonella species naturally infecting small mammalian tissues.
... Accurate fish species identification holds significant importance across various domains, enhancing both fish conservation efforts and ecosystem research while facilitating sustainable long-term fish management. To achieve this objective, diverse DNA and protein-based methodologies have been employed (Irwin et al. 1991;Birstein and Desalle 1998;Bataille et al. 1999). Notably, a commonly utilized approach involves the utilization of a relatively short fragment of the Co-I gene spanning 655 base pairs, a practice spanning over three decades. ...
The Himalayan region encompasses varied aquatic ecosystems, characterized by the presence of diverse ichthyofauna, particularly represented by members of the Schizothorax genus, commonly referred to as snow trout. The primary objective of this work was to examine the molecular phylogeny of Schizothoracinae, specifically focusing on the two species, Schizothorax esocinus and Schizothorax curvifrons, which are known to inhabit the northern and north-eastern regions of the Himalayas. This investigation was conducted by analyzing the entire mitochondrial Cyt-b and Co-I gene sequences. The aligned Cyt-b and Co-I sequences for S. esocinus, S. curvifrons, and related members within the subfamily Schizothoracinae, spanned 1130 to 1141 and 1536 to 1551 base pairs, respectively. Using these gene, phylogenetic trees were created to compare Schizothoracinae species to other subfamilies of the family Cyprinidae (Barbinae, Alburninae, Leuciscinae, Xenocyprinae, Cyprininae, and Cultrinae). Genetic distances for Cyt-b and Co-I sequence at three hierarchical levels shows significant disparities in their average score. For Cyt-b, average p-distances for intraspecies, intragenus, and intrafamily were 2.13%, 4.1%, and 15.23%, respectively. Similarly, for Co-I, average p-distances were 1.19%, 3.6%, and 13.8% for intraspecies, intragenus, and intrafamily, respectively. Total number of haplotypes (h) based on Cyt-b and Co-I gene were 6 and 12 within the target Schizothorax spp. In the present study, the observed range of haplotype diversity (hd) for the Cyt-b gene varied from 0.00 to 0.847, with an average haplotype diversity of 0.847 ± 0.034. Similarly, for the Co-I gene, the observed haplotype diversity ranged from 0.00 to 0.931, with an average value of haplotype diversity estimated to be 0.931 ± 0.024. The results of the present study clearly shows that the representative species exhibited close affinities with members of Barbinae and Cyprininae, while other subfamilies formed distinct groups. The findings of the study also indicated that the Cyt-b and Co-I gene exhibits polymorphism and has the potential to serve as a marker for identifying genetic differentiation among populations based on ecological habitats. Mitochondrial Cyt-b and Co-I have been established as a universally accepted and validated genetic marker within a comprehensive bio-identification system at the species level.
... The analysis was run setting: different substitution models for each mtDNA fragment, as indicated by Jmodeltest (Darriba and Posada, 2016) (the HKY model for COX2, CYTB and Dloop, and the TN93 model for COX1); the Bayesian skyline as coalescent tree prior; Cauchy as spatial diffusion model . Preliminary analyses were runs using two alternative clock rates: a strict clock with fixed rate at 1.0 E-8, commonly used for mitochondrial genes in mammal species (Irwin et al., 1991); normal distribution of clock rate with mean 9.4E-9 ± 5.0E-9 (Pesole, 1999;Madsen et al., 2015). The MCMC was run for 10 million generations, sampling every 1000th generation. ...
... LT07-218). Additionally, the identity of each cell line was verified by Sanger sequencing of mitochondrial Cytochrome b which was amplified from extracted total DNA using universal primers (FW: CGAAGCTTGATATGAAAAACCATCGTTG, RV: AAACTGCAGCCCCTCAGAATGATATTTGTCCTCA)83,84 . ...
Correlative evidence has suggested that the methyl-CpG-binding protein MeCP2 contributes to the formation of heterochromatin condensates via liquid-liquid phase separation. This interpretation has been reinforced by the observation that heterochromatin, DNA methylation and MeCP2 co-localise within prominent foci in mouse cells. The findings presented here revise this view. MeCP2 localisation is independent of heterochromatin as MeCP2 foci persist even when heterochromatin organisation is disrupted. Additionally, MeCP2 foci fail to show hallmarks of phase separation in live cells. Importantly, we find that mouse cellular models are highly atypical as MeCP2 distribution is diffuse in most mammalian species, including humans. Notably, MeCP2 foci are absent in Mus spretus which is a mouse subspecies lacking methylated satellite DNA repeats. We conclude that MeCP2 has no intrinsic tendency to form condensates and its localisation is independent of heterochromatin. Instead, the distribution of MeCP2 in the nucleus is primarily determined by global DNA methylation patterns.
... Geneious Prime v.2019.2.3 [26] was used to determine the base composition and nucleotide frequencies, with the formulas (AT skew = (A − T)/(A + T) and GC skew = (G − C)/(G + C)) used to calculate nucleotide composition and skewness, respectively [27]. Bowtie2 v2.4.5 [28] was used to align the L. c. dorsalis (NT, Australia) FASTQ reads with the L. c. dorsalis mt reference genome (GenBank accession number: MW255536; VIC, Australia). ...
The Australian sheep blowfly, Lucilia cuprina dorsalis, is a major sheep ectoparasite causing subcutaneous myiasis (flystrike), which can lead to reduced livestock productivity and, in severe instances, death of the affected animals. It is also a primary colonizer of carrion, an efficient pollinator, and used in maggot debridement therapy and forensic investigations. In this study, we report the complete mitochondrial (mt) genome of L. c. dorsalis from the Northern Territory (NT), Australia, where sheep are prohibited animals, unlike the rest of Australia. The mt genome is 15,943 bp in length, comprising 13 protein-coding genes (PCGs), two ribosomal RNAs (rRNAs), 22 transfer RNAs (tRNAs), and a non-coding control region. The gene order of the current mt genome is consistent with the previously published L. cuprina mt genomes. Nucleotide composition revealed an AT bias, accounting for 77.5% of total mt genome nucleotides. Phylogenetic analyses of 56 species/taxa of dipterans indicated that L. c. dorsalis and L. sericata are the closest among all sibling species of the genus Lucilia, which helps to explain species evolution within the family Luciliinae. This study provides the first complete mt genome sequence for L. c. dorsalis derived from the NT, Australia to facilitate species identification and the examination of the evolutionary history of these blowflies.
... Total genomic DNA was extracted from faecal samples using a QIAamp DNA stool mini kit (Qiagen, Japan) following the manufacturer's recommendations. To ensure correct host identification of samples originating from unidentified hosts in LKWS, cytochrome b (cytb) gene fragments were amplified using the primer pair L14724/H15915 (CGAAGCTTGATATGAAAAACCATCGTTG/ AACTGCAGTCATCTCCGGTTTACAAGACrespectively) (Irwin et al., 1991). Amplicons were then purified using the Agencourt AMPure system (Agencourt Bioscience Corp., USA) before sequencing in an ABI 3730xl DNA Analyzer (Applied Biosystems, USA). ...
With many non-human primates (NHPs) showing continued population decline, there is an ongoing need to better understand their ecology and conservation threats. One such threat is the risk of disease, with various bacterial, viral and parasitic infections previously reported to have damaging consequences for NHP hosts. Strongylid nematodes are one of the most commonly reported parasitic infections in NHPs. Current knowledge of NHP strongylid infections is restricted by their typical occurrence as mixed infections of multiple genera, which are indistinguishable through traditional microscopic approaches. Here, modern metagenomics approaches were applied for insight into the genetic diversity of strongylid infections in South-East and East Asian NHPs. We hypothesized that strongylid nematodes occur in mixed communities of multiple taxa, dominated by Oesophagostomum, matching previous findings using single-specimen genetics. Utilizing the Illumina MiSeq platform, ITS-2 strongylid metabarcoding was applied to 90 samples from various wild NHPs occurring in Malaysian Borneo and Japan. A clear dominance of Oesophagostomum aculeatum was found, with almost all sequences assigned to this species. This study suggests that strongylid communities of Asian NHPs may be less species-rich than those in African NHPs, where multi-genera communities are reported. Such knowledge contributes baseline data, assisting with ongoing monitoring of health threats to NHPs.
... The species affiliation of ringed seals was identified by the cytochrome-B gene of mitochondrial DNA. To amplify its 450 bps fragment, primers L14724 and H15149 were used [33]. The termination reaction was set using the BigDye Terminator v.3.1 kit with each of the indicated primers. ...
A systematic analysis of the species composition of the prey of killer whale Orcinus orca Linnaeus, 1758 was carried out. The results of observations of killer whales hunting for different types of prey and the data from an analysis of the contents of their stomachs were summarized; the species affiliation of the prey was compared with the affiliation of predators to the R- or T-type based on a genetic analysis. It has been shown that killer whales of the Far Eastern seas of Russia have a pronounced foraging specialization, which correlates with the haplotype of the mitochondrial DNA control region. Killer whales with the NT1 and GAT haplotypes previously described for mammal-eating T-type killer whales from the northeast Pacific (also called Bigg’s killer whales) have been observed preying on marine mammals but not on fish. Killer whales with the SR haplotype, previously described for fish-eating R-type killer whales from the northeastern Pacific, preyed only on fish. Two new T-type killer whale haplotypes have been discovered; animals with these haplotypes have been observed preying on large baleen whales. The importance of traditions and social learning in the differentiation of ecological niches in cetaceans has been noted. The specialization to hunt certain prey transmitted from mother to calves allows killer whales of different ecotypes to avoid food competition and acquire morphological and behavioral adaptations that facilitate hunting for a particular type of prey.
... Approximately 10 mg of liver tissue was used to attain DNA via salt extraction 41 . PCR was performed using primers L14724 and H15915 42 . Cleaned PCR products were sequenced using BigDye Terminator Cycle Sequencing Ready Reaction mix v1.1 (catalog number 4337449, Applied Biosystems, Waltham, Massachusetts, USA) and the forward primer L14724. ...
Orthohantaviruses infect distinct eulipotyphlan and rodent reservoirs throughout the world; some rodent orthohantaviruses can cause disease in humans. In the United States, a primary rodent reservoir for the human-pathogenic Sin Nombre virus (SNV) is the western deermouse (Peromyscus sonoriensis; formerly included in Peromyscus maniculatus). Deermice (rodents of genus Peromyscus) carry presumably distinct orthohantaviruses but, although deermice of ten species have been recorded in New Mexico, only SNV has been reported in rodents from that state. Using a set of pan-orthohantavirus primers, we discovered a non-SNV orthohantavirus in a brush deermouse (P. boylii), trapped in central New Mexico in 2019. Sequencing enabled the generation of a consensus codingcomplete
genome sequence, revealing similarity to the known partial sequences of the unclassified “Limestone Canyon virus
(LSCV)” in GenBank and aligning with the information in an unpublished study of wild-caught brush deermice trapped in
southwestern New Mexico in 2006. Phylogenetic analysis of these combined data revealed geospatial clades and overall identity of
“LSCV”, uncovering its association with the classified Montaño virus (MTNV), which is known to infect Aztec and Orizaba deermice in
central Mexico. Our work emphasizes the importance of determining coding-complete viral genome sequences as a framework for
rigorous virus classification as the basis for epidemiological studies.
Bartonella species, intracellular parasitic zoonotic pathogens, has drawn increasing attention for their diverse host range and associated human diseases. This study investigates Bartonella infection in small mammals in Yunnan Province, China, focusing on tissue tropism. 333 small mammals were sampled from 13 species, 3 orders, 4 families, and 4 genera in Heqing and Gongshan Counties. Conventional PCR and real-time quantitative PCR (qPCR) were utilized for detection and quantification, followed by bioinformatic analysis of obtained DNA sequences. Results show a 31.5% detection rate, varying across species. Notably, Apodemus chevrieri, Eothenomys eleusis, Niviventer fulvescens, Rattus tanezumi, Episoriculus leucops, Anourosorex squamipes, and Ochotona Thibetana exhibited infection rates of 44.4%, 27.7%, 100.0%, 6.3%, 60.0%, 23.5%, and 22.2%, respectively. Genetic analysis identified 30, 10, and 5 strains based on ssrA, rpoB, and gltA genes, with nucleotide identities ranging from 92.1% to 100.0%. Bartonella strains were assigned to B. grahamii, B. rochalimae, B. sendai, B. koshimizu, B. phoceensis, B. taylorii, and a new species identified in the Episoriculus leucops (GS136). Tissue distribution analysis revealed varied copy numbers across different tissues, with the highest load in spleen. These findings underscore Bartonella's diverse species and host range in Yunnan Province, highlighting its broad tissue tropism in small mammals.
A thermostable DNA polymerase was used in an in vitro DNA amplification procedure, the polymerase chain reaction. The enzyme, isolated from Thermus aquaticus, greatly simplifies the procedure and, by enabling the amplification reaction to be performed at higher temperatures, significantly improves the specificity, yield, sensitivity, and length of products that can be amplified. Single-copy genomic sequences were amplified by a factor of more than 10 million with very high specificity, and DNA segments up to 2000 base pairs were readily amplified. In addition, the method was used to amplify and detect a target DNA molecule present only once in a sample of 10(5) cells.
The recently-developed statistical method known as the "bootstrap" can be used to place confidence intervals on phylogenies. It involves resampling points from one's own data, with replacement, to create a series of bootstrap samples of the same size as the original data. Each of these is analyzed, and the variation among the resulting estimates taken to indicate the size of the error involved in making estimates from the original data. In the case of phylogenies, it is argued that the proper method of resampling is to keep all of the original species while sampling characters with replacement, under the assumption that the characters have been independently drawn by the systematist and have evolved independently. Majority-rule consensus trees can be used to construct a phylogeny showing all of the inferred monophyletic groups that occurred in a majority of the bootstrap samples. If a group shows up 95% of the time or more, the evidence for it is taken to be statistically significant. Existing computer programs can be used to analyze different bootstrap samples by using weights on the characters, the weight of a character being how many times it was drawn in bootstrap sampling. When all characters are perfectly compatible, as envisioned by Hennig, bootstrap sampling becomes unnecessary; the bootstrap method would show significant evidence for a group if it is defined by three or more characters.
Evolutionary genetics has two parallel thrusts: the reconstruction of phylogenies and the analysis of populations. Since 1962, when Zuckerkandl and Pauling1 proposed that comparison of the sequences of proteins and genes could be used as a molecular clock to date the divergence of extant species, a variety of biochemical methods has been used for phylogenetic studies. Electrophoretic analysis of isozymes, immunological comparisons, and protein sequencing were extensively used in the first two decades and, more recently, DNA-DNA hybridization and ribosomal RNA sequencing have made a major contribution to systematics.2 Most of these techniques are limited because they estimate sequence difference instead of measuring it directly.
A quantitative theory of directional mutation pressure proposed in 1962 explained the wide variation of DNA base composition observed among different bacteria and its small heterogeneity within individual bacterial species. The theory was based on the assumption that the effect of mutation on a genome is not random but has a directionality toward higher or lower guanine-plus-cytosine content of DNA, and this pressure generates directional changes more in neutral parts of the genome than in functionally significant parts. Now that DNA sequence data are available, the theory allows the estimation of the extent of neutrality of directional mutation pressure against selection. Newly defined parameters were used in the analysis, and two apparently universal constants were discovered. Analysis of DNA sequence has revealed that practically all organisms are subject to directional mutation pressure. The theory also offers plausible explanations for the large heterogeneity in guanine-plus-cytosine content among different parts of the vertebrate genome.
Protein and nucleic acid data have a limited though vital role in the development of an understanding of the systematics of a group. They have the potential of providing, independent of any other information, the cladistic and temporal dimensions of the phylogeny of that group. I do not think it overstates the case to argue that until we have the cladistics we, for all practical purposes, really have nothing at all. The branching pattern forms the necessary framework upon which to properly assess the meaning of the evidence gleaned from other areas of research. Once the branching order has been worked out, and if there is a significant body of fossil data to integrate into our understanding of the group, we can attempt to provide a time estimate for each node or branch point.
It is well known that all mitochondrial (mt) genomes contain the information for a number of proteins which are part of the inner mitochondrial membrane among which the three subunits of cytochromeoxidase (CoI, CoII, CoIII) and the apocytochrome b (Cyt b). In spite of the rather constant information content other features of mtDNA,such as the genome size and the gene structure and organization,appear to be very different in the various organisms. With regard to the evolutionary rate of mt genes we have only a limited number of data, particularly in some classes of organisms, which however already suggest that also this parameter is extremely variable. In this paper we report our quantitative analyses on the evolution of the mitochondrially coded cytochrome genes in animals and in a few plants applying a method recently developed in our laboratory for the measurement of the base substitution rate1.