No full-text available
To read the full-text of this research,
you can request a copy directly from the authors.
Genetic interrelationship among species of the genus Zygosaccharomyces as revealed by small sub-unit rRNA sequences
Abstract
The phylogenetic interrelationship of species of the genus Zygosaccharomyces was examined by 18S rRNA gene sequencing. Comparative analysis of the sequence data revealed the genus to consist of a number of distinct subdivisions. The most prevalent species associated with food spoilage, Z. bailii, Z. bisporus and Z. rouxii , along with Z. mellis were found to form one subdivision. Zygosaccharomyces cidri and Z. fermentati formed a distinct species pair, as did Z. microellipsoides and Z. mrakii. Zygosaccharomyces florentinus formed a separate line displaying no specific relationship with any of the other Zygosaccharomyces species examined. Comparison with nine published ascosporogenous yeast 18S rRNA gene sequences showed that Z. microellipsoides and Z. mrakii were genealogically very close to Torulaspora delbrueckii (both displaying 99·8% 18S rRNA sequence similarity), raising the possibility that these two Zygosaccharomyces species should be moved to the genus Torulaspora .
The topologies of trees derived from complete 18S rRNA gene sequences and from individual domains within the gene were compared and the implications of using partial sequence data for inferring phylogenetic relationships discussed.
Supplementary resource (1)
... Grillitsch et al. observed clear differences in the cell membrane structure, for example, the degree of fatty acid saturation and ergosterol levels of P. pastoris compared to S. cerevisiae [28], which could be the reason why Leg1 and Leg2 had no antifungal effect against P. membranifaciens. In contrast, S. cerevisiae and Z. bailii both belong to the family Saccharomycetaceae and have high phylogenetic correlation and a high percentage of identical gene sequences [29,30]. Additionally, Nguyen et al. reported a similar general composition of the cell wall of Z. bailii and S. cerevisiae containing mannoprotein (24-35%), chitin (0.6-3%), alkali-soluble (34-37%) and alkali-insoluble glucan (20-37%) [31]. ...
... Additionally, Nguyen et al. reported a similar general composition of the cell wall of Z. bailii and S. cerevisiae containing mannoprotein (24-35%), chitin (0.6-3%), alkali-soluble (34-37%) and alkali-insoluble glucan (20-37%) [31]. correlation and a high percentage of identical gene sequences [29,30]. Additionally, Nguyen et al. reported a similar general composition of the cell wall of Z. bailii and S. cerevisiae containing mannoprotein (24-35%), chitin (0.6-3%), alkali-soluble (34-37%) and alkali-insoluble glucan (20-37%) [31]. ...
The fight against food waste benefits from novel agents inhibiting spoilage. The present study investigated the preservative potential of the antimicrobial peptides Leg1 (RIKTVTSFDLPALRFLKL) and Leg2 (RIKTVTSFDLPALRWLKL) recently identified in chickpea legumin hydrolysates. Checkerboard assays revealed strong additive antimicrobial effects of Leg1/Leg2 with sodium benzoate against Escherichia coli and Bacillus subtilis with fractional inhibitory concentrations of 0.625 and 0.75. Additionally, Leg1/Leg2 displayed antifungal activity with minimum inhibitory concentrations of 500/250 µM against Saccharomyces cerevisiae and 250/125 µM against Zygosaccharomyces bailii. In contrast, no cytotoxic effects were observed against human Caco-2 cells at concentrations below 2000 µM (Leg1) and 1000 µM (Leg2). Particularly Leg2 showed antioxidative activity by radical scavenging and reducing mechanisms (maximally 91.5/86.3% compared to 91.2/94.7% for the control ascorbic acid). The present results demonstrate that Leg1/Leg2 have the potential to be applied as preservatives protecting food and other products against bacterial, fungal and oxidative spoilage.
... Small-subunit rRNA gene sequencing also reveals these Zygosaccharomyces are very closely related. Over a 1832 nucleotide rDNA region, Z. bailii and Z. bisporus were 99.8% identical, 99.2% identical to the rDNA of Z. rouxii and 97.5% identical to the rDNA of S. cerevisiae (James et al., 1994). In this study we show that it is possible to isolate Z. bailii genes by complementation cloning in S. cerevisiae. ...
... At the start of this project to initiate Z. bailii genetics, the only Z. bailii sequence in the database was ribosomal RNA-encoding (James et al., 1994). It was therefore necessary for us to ®rst isolate a few protein-coding genes, sequences that could be used in gene deletion studies. ...
Yeasts of the genus Zygosaccharomyces are notable agents of large-scale food spoilage. Despite the economic importance of these organisms, little is known about the stress adaptations whereby they adapt to many of the more severe conditions of food preservation. In this study it was shown that genes of Z. bailii, a yeast notable for its high resistances to food preservatives and ethanol, can be isolated by complementation of the corresponding mutant strains of Saccharomyces cerevisiae. It was also discovered that the acquisition by S. cerevisiae of a single small Z. bailii gene (ZbYME2) was sufficient for the former yeast to acquire the ability to degrade two major food preservatives, benzoic acid and sorbic acid. Using DNA cassettes containing dominant selectable markers and methods originally developed for performing gene deletions in S. cerevisiae, the two copies of ZbYME2 in the Z. bailii genome were sequentially deleted. The resulting Zbyme2/Zbyme2 homozygous deletant strain had lost any ability to utilize benzoate as sole carbon source and was more sensitive to weak acid preservatives during growth on glucose. Thus, ZbYME2, probably the nuclear gene for a mitochondrial mono-oxygenase function, is essential for Z. bailii to degrade food preservatives. This ability to catabolize weak acid preservatives is a significant factor contributing to the preservative resistance of Z. bailii under aerobic conditions. This study is the first to demonstrate that it is possible to delete in Z. bailii genes that are suspected as being important for growth of this organism in preserved foods and beverages. With the construction of further mutant of Z. bailii strains, a clearer picture should emerge of how this yeast adapts to the conditions of food preservation. This information will, in turn, allow the design of new preservation strategies. GenBank Accession Nos: ZbURA3 (AF279259), ZbTIM9 (AF279260), ZbYME2 (AF279261), ZbTRP1 (AF279262), ZbHHT1(AF296170). Copyright © 2000 John Wiley & Sons, Ltd.
... Small-subunit rRNA gene sequencing also reveals these Zygosaccharomyces are very closely related. Over a 1832 nucleotide rDNA region, Z. bailii and Z. bisporus were 99.8% identical, 99.2% identical to the rDNA of Z. rouxii and 97.5% identical to the rDNA of S. cerevisiae (James et al., 1994). In this study we show that it is possible to isolate Z. bailii genes by complementation cloning in S. cerevisiae. ...
... At the start of this project to initiate Z. bailii genetics, the only Z. bailii sequence in the database was ribosomal RNA-encoding (James et al., 1994). It was therefore necessary for us to ®rst isolate a few protein-coding genes, sequences that could be used in gene deletion studies. ...
Yeasts of the genus Zygosaccharomyces are notable agents of large-scale food spoilage. Despite the economic importance of these organisms, little is known about the stress adaptations whereby they adapt to many of the more severe conditions of food preservation. In this study it was shown that genes of Z. bailii, a yeast notable for its high resistances to food preservatives and ethanol, can be isolated by complementation of the corresponding mutant strains of Saccharomyces cerevisiae. It was also discovered that the acquisition by S. cerevisiae of a single small Z. bailii gene (ZbYME2) was sufficient for the former yeast to acquire the ability to degrade two major food preservatives, benzoic acid and sorbic acid. Using DNA cassettes containing dominant selectable markers and methods originally developed for performing gene deletions in S. cerevisiae, the two copies of ZbYME2 in the Z. bailii genome were sequentially deleted. The resulting Zbyme2/Zbyme2 homozygous deletant strain had lost any ability to utilize benzoate as sole carbon source and was more sensitive to weak acid preservatives during growth on glucose. Thus, ZbYME2, probably the nuclear gene for a mitochondrial mono-oxygenase function, is essential for Z. bailii to degrade food preservatives. This ability to catabolize weak acid preservatives is a significant factor contributing to the preservative resistance of Z. bailii under aerobic conditions. This study is the first to demonstrate that it is possible to delete in Z. bailii genes that are suspected as being important for growth of this organism in preserved foods and beverages. With the construction of further mutant of Z. bailii strains, a clearer picture should emerge of how this yeast adapts to the conditions of food preservation. This information will, in turn, allow the design of new preservation strategies. GenBank Accession Nos: ZbURA3 (AF279259), ZbTIM9 (AF279260), ZbYME2 (AF279261), ZbTRP1 (AF279262), ZbHHT1(AF296170). Copyright
... Zygosaccharomyces bailii and to a lesser extent, Z. bisporus, are the principle cause for concern in preserved foods, due to their phenomenal resistance to preservatives (for reviews, see Thomas and Davenport, 1985;. Z. lentus is similarly preservative-resistant but is of greater concern in chilled foods (Steels et al., 1999a(Steels et al., , 1999b Recent taxonomic studies (James et al., 1994;1996;1997;Steels et al., 1999a) based on 18S ribosomal sequences have revealed a close relationship between many of the dominant spoilage yeasts. Z. bailii, Z. lentus and Z. bisporus are very closely related, and immediately linked to Z. rouxii and Z. mellis. ...
... Ampli®cation of the D1/D2 region of the 26S rDNA gene was performed using the method as described by James et al. (1994) and primers NL1 (5k-GCATATCAATAAGCGGAGGAAAAG) and NL4 (5k-GGTCCGTGTTTCAAGACGG) (O'Donnell, 1993). The ampli®ed products were puri®ed by using a QIAquick PCR puri®cation kit (QIAGEN), according to the manufacturers' instructions. ...
Zygosaccharomyces is a genus associated with the more extreme spoilage yeasts. Zygosaccharomyces spoilage yeasts are osmotolerant, fructophiles (preferring fructose), highly-fermentative and extremely preservative-resistant. Zygosaccharomyces bailii can grow in the presence of commonly-used food preservatives, benzoic, acetic or sorbic acids, at concentrations far higher than are legally permitted or organolepically acceptable in foods. An inoculum effect has been described for many micro-organisms and antimicrobial agents. The minimum inhibitory concentration (MIC) increases with the size of the inoculum; large inocula at high cell density therefore require considerably higher concentrations of inhibitors to prevent growth than do dilute cell suspensions. A substantial inoculum effect was found using sorbic acid against the spoilage yeast Zygosaccharomyces bailii NCYC 1766. The inoculum effect was not caused by yeasts metabolizing or adsorbing sorbic acid, thereby lowering the effective concentration; was not due to absence of cell-cell signals in dilute cell suspensions; and was not an artefact, generated by insufficient time for small inocula to grow. The inoculum effect appeared to be caused by diversity in the populations of yeast cells, with higher probability of sorbic acid-resistant cells being present in large inocula. It was found that individual cells of Zygosaccharomyces bailii populations, grown as single cells in microtitre plate wells, were very diverse, varying enormously in resistance to sorbic acid. 26S ribosomal DNA sequencing did not detect differences between the small fraction of resistant 'super cells' and the average population. Re-inoculation of the 'super cells' after overnight growth on YEPD showed a normal distribution of resistance to sorbic acid, similar to that of the original population. The resistance phenotype was therefore not heritable and not caused by a genetically distinct subpopulation. It was concluded that resistance of the spoilage yeast Zygosaccharomyces bailii to sorbic acid was due to the presence of small numbers of phenotypically resistant cells in the population.
... Grillitsch et al. observed clear differences in the cell membrane structure, for example the degree of fatty acid saturation and ergosterol levels of P. pastoris compared to S. cerevisiae[162], which could be the reason why Leg1 and Leg2 had no antifungal effect against P. membranifaciens. In contrast, S. cerevisiae and Z. bailii both belong to the family Saccharomycetaceae and have high phylogenetic correlation and a high percentage of identical gene sequences[163,164]. Additionally, Nguyen et al. reported a similar general composition of the cell wall of Z. bailii and S. cerevisiae containing mannoprotein (24-35%), chitin (0.6-3%), alkali-soluble (34-37%), and alkali-insoluble glucan (20-37%)[165]. ...
Food contamination by bacteria, viruses, fungi, or parasites have significant implications for the environment and human health. According to the World Health Organization, 350,000 deaths are related to forborne diseases, like salmonellosis, campylobacteriosis, and listeriosis. The most common symptoms of diseases caused by contaminated food are nausea, vomiting, stomach cramps, and diarrhea, which range from mild to life threatening. Although all types of food can be affected, animal products, especially meat and eggs, are the predominant sources of foodborne diseases. Foodborne illnesses can either occur through the ingestion of hazardous microorganisms or through microbial toxins. Bacterial species, such as Pseudomonas spp., and fungal strains, such as Aspergillus spp., are potent food spoilage agents, which make food unacceptable and increase food waste. Hence, physical (cooling, heating, radiation) and chemical (preservatives, essential oils, extracts) preservation techniques are used to avoid microbial contamination. However, common preservation methods have disadvantages, such as resistance mechanisms by bacterial strains or no activity against a broad spectrum of microorganism. Therefore, to enhance food safety and reduce food waste, the development of novel preservatives affecting a wide range of microorganisms is highly important. Furthermore, the increase of consumer standards requires food additives from natural sources with high safety standards for human health. Bioactive peptides are already known for their antioxidative, anticarcinogenic, antihypertensive, and antimicrobial effects. The Antimicrobial Peptide Database (APD) has included 3,257 antimicrobial peptides (AMP) from animals, plants, bacteria, fungi, protists, and archaea sources. Basically, antibacterial activity of peptides can result in two ways. The inhibition of bacterial growth is called bacteriostatic activity, while the bactericidal effect describes the complete inactivation of bacteria. AMPs, especially cationic peptides with amphipathic α-helical structures, interact with the negatively charged bacterial membrane and cause membrane destabilization, followed by membrane disruption. Therefore, virtual screening can be performed to identify potential antibacterial peptides. The first peptide preservative, which was approved for preservation in 60 countries is nisin (E 234), is formed by lactic acid bacteria (Lactococcus lactis) and mainly used for the preservation of cheese. Furthermore, nisin is particularly effective against Gram positive bacterial strains. In addition to antibacterial activity, peptides effective against yeasts, fungi, and molds have also been identified. The APD currently contains 1,204 antifungal peptides and 673 peptides active against yeast. The predominant properties of antifungal peptides and those active against yeast, for example net charge and amphipathic structure, show similarities to the AMPs. These similarities of the structure-activity relationship increase the likelihood that a peptide can be simultaneously antifungal and antibacterial. However, since the membrane composition differs greatly within yeast and fungal strains, the antimycotic action can differ within the fungal strains. Furthermore, antioxidative activity of compounds is used in the food industry to extend the shelf life and improve food quality. Peptides, particularly those containing hydrophobic amino acids such as tryptophan, phenylalanine, proline, isoleucine, and valine, are known to exhibit antioxidative activity. However, since the antioxidative mechanism of peptides has not yet been identified, the prediction of the antioxidative activity based on peptide sequence and structure alone is not possible. The food industry prefers the use of substances with multiple bioactivities to improve food quality and safety. Peptides are mainly produced with peptide synthesis and recombinant synthesis; however, they can also be extracted from natural sources. Enzymatic hydrolysis and fermentation can be used to extract peptides from the food proteins. Nevertheless, especially the purification of the food-derived peptides is labor intensive and cost-effective. In comparison, chemical synthesis, which is the gold standard for peptide production, is expensive and requires several chemicals. Therefore, a promising alternative is the biotechnological production using recombinant synthesis in host cells. The aim of this project was the identification of antimicrobial peptides from plant sources, which can be used as preservatives in food production. Since the antimicrobial peptides are derived from food sources, they are considered as non-toxic and are thus compatible with the clean label strategy. Thus, storage proteins were extracted from wheat, soybean, and chickpea and peptides were generated with enzymatic hydrolysis using the enzyme chymotrypsin. The resulting peptide profiles were comprehensively analyzed by ultra performance micro LC ESI-TripleTOF-MS/MS. The numbers of unique identified peptides were 650 for the soybean glycinin fraction (93 from glycinin), 625 for the soybean β-conglycinin fraction (49 from β conglycinin), 549 for the wheat globulin fraction (43 from globulin), 549 for the wheat gliadin fraction (192 from gliadin), and 1,279 for the chickpea globulin fraction (334 from legumin, 111 from vicilin). Subsequently, antimicrobial peptide candidates were identified by virtual screening using the APD and the structure prediction software I Tasser and Helical Wheel Projection. The main selection criteria were a positive or neutral net charge, a hydrophobic content equal or higher to 20%, the ability to form an amphipathic helical structure, and a good water solubility. Virtual screening was conducted for all storage proteins, however further experiments were limited to chickpea legumin peptides. Therefore, 21 antimicrobial peptide candidates were identified in the peptide profile of the storage protein legumin from chickpea. These peptides were purchased as synthesized peptides produced by solid phase peptide synthesis. Afterwards, the antibacterial activity of the peptides was experimentally tested against the Gram-negative strain Escherichia (E.) coli and the Gram positive strain Bacillus subtilis. Eighteen of the 21 peptides showed antimicrobial activity against E. coli and 17 against Bacillus subtilis. The peptides Leg1 (RIKTVTSFDLPALRFLKL) and Leg2 (RIKTVTSFDLPALRWLKL) had the lowest minimum inhibitory concentration (MIC) of 62.5 µM against E. coli and 15.6 µM against Bacillus subtilis. Moreover, Leg1 and Leg2 were 10 – 1,000 times more active compared to the preservatives sodium benzoate, potassium sorbate, and sodium nitrite. Further studies showed that the two peptides are additionally active against food pathogens, e.g., Clostridium perfringens, antibiotic resistant bacteria, particularly Methicillin resistant Staphylococcus aureus, and yeast strains. To test whether the peptides act bacteriostatic or bactericidal, the microdilution experiments were transferred to agar plates. While the conventional preservatives only inhibit bacterial growth (bacteriostatic activity), the incubation with peptides Leg1 and Leg2, as well as the peptide preservative nisin, showed no bacterial growth on agar and, therefore, have a bactericidal effect. Additionally, the antimicrobial activity of eight randomly selected peptides from chickpea legumin were tested to validate the virtual screening. Four of the peptides exhibited antimicrobial activity at concentrations of 500 µM and 1,000 µM. In comparison, virtual screening, which was performed to identify the peptide candidates in this study, detected AMPs with MIC values less than 100 µM and a hit rate of 76%. In addition, cell toxicity experiments were performed against human colorectal cancer cells. Leg1 and Leg2 showed no cytotoxic effect up to a concentration of 1,000 µM, which is more than 16 times higher compared to the MIC against E. coli. This finding was further confirmed with molecular dynamic simulations. Additionally, to test whether the AMPs Leg1 and Leg2 can be used in combination with commercially used preservatives, the checkerboard assay was performed. The simultaneous application of the antimicrobial peptides Leg1/Leg2 with organic acids, in the present case sodium benzoate, allows a reduced dose of chemical preservatives and may address a wider spectrum of microorganisms. Furthermore, the antioxidative activity was investigated using a radical scavenging and a reducing power assay. Both peptides act antioxidative, however, especially Leg2 showed antioxidative activity, which was comparable to the antioxidant ascorbic acid. The consistent antimicrobial activity of AMPs is important for their use as peptide preservatives. Hence, the MIC was determined with the focus on different extrinsic and intrinsic factors, including storage time, temperature, and pH value. Furthermore, the influence of the counterions trifluoroacetate, acetate, and chloride from peptide synthesis were examined. Leg1 was additionally applied on meat to test the simultaneously effects of pH, water content, salt concentration, and proteases. Leg1 and Leg2 indicated stable antimicrobial activity in solution with slight losses within four weeks and stable activity under food conditions. The antimicrobial activity was consistent within the use of different pH values and counterions. Accordingly, Leg1 and Leg2 can be used in a slightly acidic pH with the non-toxic counterions acetate or chloride. Almost all foods are stored at or below room temperature (20 to 22 °C). Incubation temperatures lower than 37 °C increased Leg1/Leg2 activity and consequently reduced the MIC value. Therefore, a lower peptide concentration is needed at room temperature to ensure microbiological safety. To increase the peptide yield from chickpea legumin, the protocol of the enzymatic hydrolysis was optimized. A shorter digestion time of 4 h and the direct protein hydrolysis without pretreatment, significantly increased the yield by 30 to 110 fold. However, for high scale production in the food industry, the recombinant synthesis may be a good alternative to lower the production costs and time. Thus, Leg1 and Leg2 are novel chickpea-derived antimicrobial peptides with antibacterial, antifungal, antioxidative, and additive antimicrobial activities. They exhibited no cytotoxicity to human cells and, therefore, may be suitable for food preservation, to maintain food safety and to reduce food waste.
... The amplified sequence of internal transcribed spacer ITS1 and ITS4 have submitted also in this study to separate the ribosomal gene, thereby achieving the intraspecies variability. Another study confirms our results in sequencing the intergenic regions to type the phylogenetic of eukaryotes in such as S. boulardii [24]. The resulted DNA band of isolated yeast approved the identification of the S. boulardii based on its capability to control the aneuploidy. ...
Isolation and identification of Saccharomyces boulardii from a product "High Active Dry Yeast" were the aim of this study. Yeast colonies were isolated and purified thrice by repetitive streaking on the YPD agar medium supplemented with 250 μg/ml of Chloramphenicol and 30 μg/ml of Ampicillin. The morphological identification was investigated regarding the shapes, color, and morphology characteristics. S. boulardii clustered in a circular shape, whitish cream color, elliptical morphology, and formed pseudohyphae. Genomic DNA (gDNA) was extracted from S. boulardii by using the TIANamp Yeast DNA Kit and the universal primers were used for species identification. Identification of yeast genetically processed by using the primer pair NL1 and NL4 to amplify and sequence the 26S rDNA gene D1/D2 domain. The internal transcribed spacer was amplified and sequenced by using ITS1 and ITS4 for fungus identification, besides using the primer pair of NS1 and NS6. Discrimination of yeast from bacteria processed by using the primer pair 7F, 1540R, and another primer pair 27F, and 1492R. PCR technique could approve that the S. boulardii was the only frequent strain in the active dry yeast. The photographed pattern by UV transilluminator types the target DNA band to S. boulardii that was achieved by amplifying and sequencing the 26S rDNA region. The amplified band (740 bp) and the resulted sequence length of 26S rDNA gene (585 bp) assigned the isolate to S. boulardii.
... The amplified sequence of internal transcribed spacer ITS1 and ITS4 were submitted also in this study to separate the ribosomal gene, thereby achieving the intraspecies variability. Other study indorses our results in sequencing the intergenic regions to type the phylogenetic of eukaryotes in such as S. cerevisiae [13]. The resulted DNA band of isolated yeast approves identification of the S. cerevisiae based on its capability to control the aneuploidy that has been stated at previous study [14]. ...
Isolation and identification of Saccharomyces cerevisiae from a Chinese product "High Active Dry Yeast" were presented in this study. The morphological identification approached the isolated yeast to S. cerevisiae that was revealed by the circular shapes, elliptical morphology, and pseudohyphae of the colonies. Identification of yeast genetically processed by using the primer pair NL1 and NL4 to amplify and sequence the 26S rDNA gene D1/D2 domain. The internal transcribed spacer was amplified and sequenced by using ITS1 and ITS4 for fungus identification, besides using the primer pair of NS1 and NS6. Discrimination of yeast from bacteria processed by using the primer pair 7F, 1540R, and another primer pair 27F, and 1492R. PCR technique could approve that the S. cerevisiae was the only frequent strain in the Chines product. The photographed pattern by UV transilluminator types the target DNA band to S. cerevisiae that was achieved by amplifying and sequencing the 26S rDNA regions.
... Yeast cultures were detected using standard light microscopy, and species identification was determined by large subunit (LSU) rRNA gene sequencing, conducted by the National Collection of Yeast Cultures (Norwich, United Kingdom). The variable D1 and D2 domains of the LSU rRNA gene were PCR-amplified directly from whole yeast cell suspensions following the procedure and PCR parameters as described previously by James et al. (1994). The yeast LSU D1/D2 domain was amplified and sequenced using the conserved fungal primers NL1 (GCATATCAATAAGCGGAGGAAAAG) and NL4 (GGTCCGTGTTTCAAGACGG) (O'Donnell 1993). ...
Yeast strains and acetic acid bacteria were isolated from spoiled soft drinks with characteristic flocs as a visual defect. Polymerase chain reaction and amplification of a partial region of the LSU rRNA gene identified the bacteria as Asaia spp. Sequence analysis of the D1/D2 region of the 26S rDNA in turn identified the yeast isolates as Wickerhamomyces anomalus, Dekkera bruxellensis and Rhodotorula mucilaginosa. The hydrophobicity and adhesion properties of the yeasts were evaluated in various culture media, taking into account the availability of nutrients and the carbon sources. The highest hydrophobicity and best adhesion properties were exhibited by the R. mucilaginosa cells. Our results suggest that Asaia spp. bacterial cells were responsible for the formation of flocs, while the presence of yeast cells may help to strengthen the structure of co-aggregates.
... The 18S ribosomal internal transcribed spacer (ITS) DNA of selected strains was amplified using the primers set of P108 (5 0 ACCTGGTTGATCCTGCCAGT3 0 ) and M3989 (5 0 CTACGGAAACCTCTACGGAAACCTTGTTACGA-CT3 0 ) as described by James et al. [26]. The reaction was performed in a volume of 25 lL containing 50 ng of DNA, 10 mM Tris-HCl, 0.2 mM each dNTPs mix, 2 mM MgCl 2 , 1 U of log chain Taq polymerase (Fermentas, USA) and 100 pg of the above mentioned primer set. ...
In the present investigation, an attempt has been made to screen and identify the isolates of yeast rich in mannan oligosaccharide (MOS) from different food sources collected from local market of Mumbai, India. Out of the forty-eight varied yeast strains obtained using selective and growth media, eighteen isolates were shortlisted on the basis of their MOS yield. The MOS yield obtained from Wickerhamomyces anomalus strain isolated from home-made dahi was even higher (33%) than that obtained from the traditionally used Saccharomyces cerevisiae strain (590.52 ± 8.25 vs 442.85 ± 4.25 mg/L). The reasonably good yield was found in Pichia casonil from grape juice (354.70 ± 1.02 mg/L) and Candida glabrata strain from carrot juice (350.8 ± 2.52 mg/L); however, the lowest yield was of Debaryomyces hansenii SZ10 (73.5 mg/L) grown on yogurt. Identification of the isolates was undertaken using Biomérieux VITEK® 2 system and molecular fingerprinting by polymerase chain reaction-random amplified polymorphism DNA (PCR-RAPD) using microsatellite M13 primer and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) of amplified 18S intergenic transcribed spacer region of ribosomal DNA (rDNA) after subjecting it to digest with three restriction endonucleases i.e. HaeIII, MspI and HinfI. Based on the better yield, it was concluded that W. anomalus can be exploited as an alternative of S. cerevisiae yeast stains for commercial mass scale MOS production for human food and animal feed industries in future.
... Between the small and the large subunits there are the two internal transcribed spacers (ITS1 and ITS2), fl anking the 5.8S rRNA gene, while the transcription units are separated by the non-transcribed intergenic spacers (IGS), also referred to as non-transcribed spacers (NTS). The nucleotide sequences of both the rRNA genes and ITS spacers have been extensively used to analyse phylogenetic relationships in eukaryotes, because they are highly conserved within a species but differ between species (White et al. 1990, James et al. 1994, Eickbush and Eickbush 2007. The D1/D2 domain of the 26S rRNA gene, in particular, is variant enough to identify and differentiate among most ascomycetous and basidiomycetous yeasts (Kurtzman and Robnett 1998, Fell et al. 2000, Scorzetti et al. 2002, Kurtzman and Robnett 2003 and practically is well-applied in all known yeast species. ...
... Comparisons of the rDNA have shown that Z. bisporus is very closely related to Z. bailii [73]. It is logical that this species shares many of the characteristics of Z. bailii, making it difficult to definitely identify it based on physiological methods [75]. ...
During the production of beverages or in terms of quality control, the question often arises as to which yeast species occur in which beverage as starter cultures or as spoilers? The species name should direct beverage microbiologists and technologists to information that is available about species' specific spoilage and fermentation characteristics. This review provides an overview regarding the yeast flora present in beverage processes in general and provides guidance on how this yeast flora can be identified at the level of genus, species or strain. Additionally, beverage-specific technological and microbiological information about specific yeast species is included. This review also provides an overview of the literature and information on the methods currently available for species identification from the point of view of beverage production, designed to aid microbiologists or technologists in coping with the challenges they face. Descriptions of the yeast flora found in beer, wine, sparkling wine and the mash used for the production of distilled beverages, as well as indigenous fermented beverages are provided below. Yeasts are grouped as either inoculated or spontaneous starter cultures and as direct or indirect spoilage organisms. Spoilage yeasts present in carbonated soft drinks are classified according to their spoilage and fermentative potential in a specific matrix. Detailed information about beverage-relevant characteristics is summarized in alphabetical order according to yeast genus and species name. Fermentation characteristics, fermentation by-products, sources of spoilage, resistance to preservatives and ethanol, osmotolerance, growth conditions and temperatures, characteristics in culture media and other beverage-specific background information are described.
... Comparison of conserved, semiconserved, and highly variable sequence parts in 18S and 28S rRNA contributed to the investi- gation of close and distant relationships of many yeast species (Kurtzman, 1994). However, James et al. (1994) pointed out that the relationships derived from partial sequences can be biased by a blend of clocks in the rRNA gene, and they used complete or near-complete 18S rRNA gene sequences for the phylogenetic analysis of the Zygosaccharomyces species. In the present experiments, divergence of ITS sequences was shown to differentiate all of the Saccharomyces species. ...
Sequences of two internally transcribed spacer regions between 18S and 28S rRNA genes were determined to assess the phylogenetic relationship in the strains belonging to the genus Saccharomyces. The sequences of S. bayanus and S. pastorianus were quite similar, but not identical. Two phylogenetic trees constructed by the neighbor-joining method showed that all the species examined were distinguished from one another. The Saccharomyces sensu stricto species: S. cerevisiae, S. bayanus, S. paradoxus and S. pastorianus, were closely related and far from the Saccharomyces sensu lato species including S. barnetti, S. castellii, S. dairensis, S. exiguus, S. servazzii, S. spencerorum and S. unisporus, and an outlying species, S. kluyveri. © 1997 John Wiley & Sons, Ltd.
... Relationships between species of Zygosaccharomyces and other yeast genera found in wines have been investigated. Research by James et al. (1994) regarding comparative analysis of 18S ribosomal RNA (rRNA) revealed that the majority of the genus was more closely related to Saccharomyces and Torulaspora delbrueckii than to other non-Saccharomyces yeasts. More recently, Novo et al. (2009) isolated a large DNA region from several strains of Saccharomyces cerevisiae used in wine production that were thought to be unique to Z. bailii, suggesting that exogenous transfer events in a yeast's genome may be more common than previously believed. ...
Understanding the characteristics of yeast spoilage, as well as the available control technologies, is vital to producing consistent, high-quality wine. Zygosaccharomyces bailii contamination may result in refermentation and CO(2) production in sweet wines or grape juice concentrate, whereas Brettanomyces bruxellensis spoilage often contributes off-odors and flavors to red wines. Early detection of these yeasts by selective/differential media or genetic methods is important to minimize potential spoilage. More established methods of microbial control include sulfur dioxide, dimethyl dicarbonate, and filtration. Current research is focused on the use of chitosan, pulsed electric fields, low electric current, and ultrasonics as means to protect wine quality. Expected final online publication date for the Annual Review of Food Science and Technology Volume 4 is February 28, 2013. Please see http://www.annualreviews.org/catalog/pubdates.aspx for revised estimates.
... Kurtzman and Robnett [6] demonstrated for ascomycetous yeasts that strains di¡ering by more than 1% substitutions in domain D1/D2 represent separate species. The genus Zygosaccharomyces has been found to be polyphyletic from phylogenetic analysis of sequences from domain D1/D2 [6], as well as from 18S rDNA [10,11]. Species that form a clade with Z. rouxii, the type species, are Z. ...
A new ascosporogenous yeast, Zygosaccharomyces kombuchaensis sp. n. (type strain NRRL YB-4811, CBS 8849), is described; it was isolated from Kombucha tea, a popular fermented tea-based beverage. The four known strains of the new species have identical nucleotide sequences in domain D1/D2 of 26S rDNA. Phylogenetic analysis of D1/D2 and 18S rDNA sequences places Z. kombuchaensis near Zygosaccharomyces lentus. The two species are indistinguishable on standard physiological tests used for yeast identification, but can be recognized from differences in restriction fragment length polymorphism patterns obtained by digestion of 18S-ITS1 amplicons with the restriction enzymes DdeI and MboI.
... Despite this, well-defined species such as D. hansenii, K. lactis and P. fermentans, which made up the majority of the isolates, were all correctly identified by phenotypic criteria. The members of more heterogeneous and complex genera, however, such as Candida (Kreger-van Rij, 1984), Pichia (Kurtzman & Fell, 1998) and Zygosaccharomyces (James, Collins, & Roberts, 1994;Kurtzman & Fell, 1998), were classified with more difficulty. This may be due to inherent phenotypic and genetic heterogeneity in their populations, or the limited ability of the tests used to distinguish them. ...
Classification of 74 yeasts isolated during manufacture and ripening of Cabrales cheese was attemped by phenotypic and molecular methods. Phenotypic classification included the use of commercial kits and classical biochemical analyses. Molecular classification was performed by restriction fragment length polymorphism (RFLP) of the ITS1-5.8S-ITS2 region, sequencing and comparison of the sequences in databases. Forty-one isolates were identified by phenotypic tests, including strains of Debaryomyces hansenii (14 isolates), Kluyveromyces lactis (11 isolates) and Pichia fermentans (9 isolates). The identification was confirmed by the HaeIII and HinfI RFLP profiles and comparison of their corresponding nucleotide sequences. The phenotypic classification failed to identify many other species; 16 isolates assigned to Zygosaccharomyces were genetically related to Pichia (13 isolates) and Saccharomyces (3 isolates). Classification of a few isolates was not possible, either because yeast species are new or a lack of sequences for this region in databases.
... Because of the high phylogenetic correlation between Z. bailii and S. cerevisiae [13] and because of the high percentage of identity among the few known Z. bailii and the corresponding S. cerevisiae gene sequences, our first attempt was to clone the gene homologous to GAS1 in Z. bailii by PCR amplification, using primers designed on the 3' and 5' ends of the ScGAS1 coding sequence, but with no success. It was therefore necessary to design internal primers choosing the most conserved regions of the gene, based on multiple sequence alignments. ...
Zygosaccharomyces bailii is a diploid budding yeast still poorly characterized, but widely recognised as tolerant to several stresses, most of which related to industrial processes of production. Because of that, it would be very interesting to develop its ability as a cell factory. Gas1p is a beta-1,3-glucanosyltransglycosylase which plays an important role in cell wall construction and in determining its permeability. Cell wall defective mutants of Saccharomyces cerevisiae and Pichia pastoris, deleted in the GAS1 gene, were reported as super-secretive. The aim of this study was the cloning and deletion of the GAS1 homologue of Z. bailii and the evaluation of its deletion on recombinant protein secretion.
The GAS1 homologue of Z. bailii was cloned by PCR, and when expressed in a S. cerevisiae GAS1 null mutant was able to restore the parental phenotype. The respective Z. bailii Deltagas1 deleted strain was obtained by targeted deletion of both alleles of the ZbGAS1 gene with deletion cassettes having flanking regions of approximately 400 bp. The morphological and physiological characterization of the Z. bailii null mutant resulted very similar to that of the corresponding S. cerevisiae mutant. As for S. cerevisiae, in the Z. bailii Deltagas1 the total amount of protein released in the medium was significantly higher. Moreover, three different heterologous proteins were expressed and secreted in said mutant. The amount of enzymatic activity found in the medium was almost doubled in the case of the Candida rugosa lipase CRL1 and of the Yarrowia lipolytica protease XPR2, while for human IL-1beta secretion disruption had no relevant effect.
The data presented confirm that the engineering of the cell wall is an effective way to improve protein secretion in yeast. They also confirmed that Z. bailii is an interesting candidate, despite the knowledge of its genome and the tools for its manipulation still need to be improved. However, as already widely reported in literature, our data confirmed that an "always working" solution to the problems related to recombinant protein production can be hardly, if never, found; instead, manipulations have to be finely tuned for each specific product and/or combination of host cell and product.
... This could be explained by the fact that both regions were conserved to a lesser degree than were the rRNA-encoding regions, since they are under fewer evolutionary constraints (14). The nucleotide sequences of rRNA genes and spacer regions have been used to analyze phylogenetic relationships among prokaryotes and eukaryotes (10,25). Since nucleotide sequencing is rather laborious and time-consuming, it is an inappropriate tool for the food industry. ...
Discrimination of strains within the species Saccharomyces cerevisiae was demonstrated by the use of four different techniques to type 15 strains isolated from spoiled wine and beer. Random amplified polymorphic DNA with specific oligonucleotides and PCR fingerprinting with the microsatellite oligonucleotide primers (GAC)5 and (GTG)5 enabled discrimination between the strains tested. Additionally, restriction enzyme analysis, with TaqI and MseI, of PCR-amplified fragments from the complete internal transcribed spacer and nontranscribed spacer, both present in the rRNA-encoding gene cluster, proved to be suitable for generating intraspecies-specific patterns. Random amplified polymorphic DNA with primers 24 and OPA-11 and PCR fingerprinting with primer (GTG)5 appeared to generate the highest degree of diversity. However, the results indicated that there was no single PCR-mediated typing technique enabling discrimination on the strain level. Discrimination of each individual strain was nevertheless possible by combining the results obtained with all typing techniques.
... A second species, K. lactis, can be found in a clade with the phytopathogenic fungus H. sinecauda. Collins and coworkers (James et al., 1994(James et al., , 1996Cai et al., 1996) sequenced the nearly complete 18S rDNA gene from several Kluyveromyces, Torulaspora and Zygosaccharomyces species. From their branching pattern it becomes clear that the traditional separation of the genera Kluyveromyces, Saccharomyces, Torulaspora and Zygosaccharomyces is no longer valid. ...
Phylogenetic relationships between species from the genera Kluyveromyces and Saccharomyces and representatives of the Metschnikowiaceae (Holleya, Metschnikowia, Nematospora) including the two filamentous phytopathogenic fungi Ashbya gossypii and Eremothecium ashbyii were studied by comparing the monosaccharide pattern of purified cell walls, the ubiquinone system, the presence of dityrosine in ascospore walls, and nucleotide sequences of ribosomal DNA (complete 18S rDNA, ITS1 and ITS2 region). Based on sequence information from both ITS regions, the genera Ashbya, Eremothecium, Holleya and Nematospora are closely related and may be placed in a single genus as suggested by Kurtzman (1995; J Industr. Microbiol. 14, 523-530). In a phylogenetic tree derived from the ITS1 and ITS2 region as well as in a tree derived from the complete 18S rDNA gene, the genus Metschnikowia remains distinct. The molecular evidence from ribosomal sequences suggests that morphology and ornamentation of ascospores as well as mycelium formation and fermentation should not be used as differentiating characters in family delimitation. Our data on cell wall sugars, ubiquinone side chains, dityrosine, and ribosomal DNA sequences support the inclusion of plant pathogenic, predominantly filamentous genera like Ashbya and Eremothecium or dimorphic genera like Holleya and Nematospora with needle-shaped ascospores within the family Saccharomycetaceae. After comparison of sequences from the complete genes of the 18S rDNA the genus Kluyveromyces appears heterogeneous. The type species of the genus, K. polysporus is congeneric with the genus Saccharomyces. The data of Cai et al. (1996; Int. J. Syst. Bacteriol. 46, 542-549) and our own data suggest to conserve the genus Kluyveromyces for a clade containing K. marxianius, K. dobzhanskii, K. wickerhamii and K. aestuarii, which again can be included in the family Saccharomycetaceae. The phylogenetic age of the Metschnikowiaceae and Saccharomycetaceae will be discussed in the light of coevolution.
Microbial communities thrive through interactions and communication, which are challenging to study as most microorganisms are not cultivable. To address this challenge, researchers focus on the extracellular space where communication events occur. Exometabolomics and interactome analysis provide insights into the molecules involved in communication and the dynamics of their interactions. Advances in sequencing technologies and computational methods enable the reconstruction of taxonomic and functional profiles of microbial communities using high-throughput multi-omics data. Network-based approaches, including community flux balance analysis, aim to model molecular interactions within and between communities. Despite these advances, challenges remain in computer-assisted biosynthetic capacities elucidation, requiring continued innovation and collaboration among diverse scientists. This review provides insights into the current state and future directions of computer-assisted biosynthetic capacities elucidation in studying microbial communities.
Yeasts are single celled fungi which reproduce vegetatively by budding, or less commonly, divide by fission. This property enables yeasts to increase rapidly in numbers in liquid environments, which favour the dispersal of unicellular microorganisms. Many yeasts grow readily under strictly anaerobic conditions, again favouring their growth in liquids. On the other hand, reproduction as single cells restricts spreading on, or penetration into, solid surfaces, where filamentous fungi have an advantage. Being eukaryotic organisms, yeasts reproduce more slowly than do most bacteria, and hence do not compete in environments which favour bacteria, i.e. at pH values near neutral or at very high temperatures. In common with filamentous fungi, many yeasts are tolerant of acid conditions. In broad terms, then, yeasts are more likely to be active in acidic, liquid environments than elsewhere. However, many yeasts also appear to be highly resistant to sunlight and desiccation and so occur widely in nature on the surfaces of leaves, fruits and vegetables.
Species of Saccharomyces, Arxiozyma, Eremothecium, Hanseniaspora (anamorph Kloeckera), Kazachstania, Kluyveromyces, Pachytichospora, Saccharomycodes, Tetrapisispora, Torulaspora, and Zygosaccharomyces, as well as three related anamorphic species assigned to Candida (C. castellii, C. glabrata, C. humilis), were phylogenetically analyzed from divergence in genes of the rDNA repeat (18S, 26S, ITS), single copy nuclear genes (translation elongation factor 1α, actin-1, RNA polymerase II) and mitochondrially encoded genes (small-subunit rDNA, cytochrome oxidase II). Single-gene phylogenies were congruent for well-supported terminal lineages but deeper branches were not well resolved. Analysis of combined gene sequences resolved the 75 species compared into 14 clades, many of which differ from currently circumscribed genera.
The soft drinks sector is one of the fastest growing, most innovative and rapidly changing areas of the food and drink industry. From high energy to no/low sugar, functional to long life, carbonated or still, soft drinks and their assosiative preservative and packaging systems have their own microbiological issues.many have adapted to growing in the unusual environment within a beverage factory and can be extremely difficult to remove once established. Many micro organisms are found in soft drinks as environmental or raw material contaminants, but relatively few can grow within the acidic or low oxygen environment. Yeasts are the most significant group of micro organisms associated wih the spoilage of soft drinks and fruit juices. Spoilage will be seen as the growth and production of metabolic by products, e.g co2, acid and tainting compounds. Most spoilage is therefore by yeasts and mold species, with yeasts most important and some spoilage is by tolerant bacteria. Bacteria that has been associated with spoilage in the soft drinks industry include Acetobacter, Alicyclobacillus, Bacillus, Clostridium, Gluconobacter, Lactobacillus, Leuconostoc, Saccharobacter, Zymobacter and Zymomonas. Gluconobacter is a common agent of fruits. It is a strict arobe requiring free oxygen. E.coli and Enterococci have been isolated from citrus juices, apple juice and have been associated with Cryptosporiadiosis. Contamination by hepatitis A and Norwalk like viruses have been reported in the fruit juices. The aim of this study is to isolate and identify the microorganism from the soft drinks.
El uso combinado del análisis de restricción del ADN mitocondrial y del RAPD-PCR permite diferenciar levaduras de jamón ibérico con alta producción de compuestos volátiles implicados en el aroma a curado. En la especie Debaryomyces hansenii se detectan los biotipos más productores, los cuales han sido seleccionados como cultivos iniciadores. Se han encontrado biotipos de levaduras exclusivos de lugar y etapa de maduración.
The first and second editions of Fungi and Food Spoilage established a reputation as the foremost book on foodborne fungi. This completely revised and updated third edition is an invaluable reference for food microbiologists investigating fungal spoilage and sources of mycotoxin contamination in foods. The introductory chapters of the book deal with the ecology of food spoilage and give an overview of how food processing, packaging and storage affect fungal growth. Subsequent chapters cover the fundamentals of classifying and naming fungi and current methods for isolation and enumeration, including general and special purpose media, incubation conditions, etc. The major part of the book provides keys, descriptions and illustrations of all yeasts and moulds commonly encountered in foods. Characteristics of the species, including their ecology and potential for mycotoxin production, are also included. The broad and practical nature of the coverage will appeal to microbiologists, mycologists and biotechnologists in the food industry, academic, research and public health institutions. Dr John Pitt and Dr Ailsa Hocking are both Honorary Research Fellows at CSIRO Food Science Australia, North Ryde, NSW, Australia. © Springer Science+Business Media, LLC 2009. All rights reserved.
A strain development program was initiated to improve the tolerance of the pentose-fermenting yeast Pachysolen tannophilus to inhibitors in lignocellulosic hydrolysates. Several rounds of UV mutagenesis followed by screening were used to select for mutants of P. tannophilus NRRL Y2460 with improved tolerance to hardwood spent sulfite liquor (HW SSL) and acetic acid in separate selection lines. The wild type (WT) strain grew in 50 % (v/v) HW SSL while third round HW SSL mutants (designated UHW301, UHW302 and UHW303) grew in 60 % (v/v) HW SSL, with two of these isolates (UHW302 and UHW303) being viable and growing, respectively, in 70 % (v/v) HW SSL. In defined liquid media containing acetic acid, the WT strain grew in 0.70 % (w/v) acetic acid, while third round acetic acid mutants (designated UAA301, UAA302 and UAA303) grew in 0.80 % (w/v) acetic acid, with one isolate (UAA302) growing in 0.90 % (w/v) acetic acid. Cross-tolerance of HW SSL-tolerant mutants to acetic acid and vice versa was observed with UHW303 able to grow in 0.90 % (w/v) acetic acid and UAA302 growing in 60 % (v/v) HW SSL. The UV-induced mutants retained the ability to ferment glucose and xylose to ethanol in defined media. These mutants of P. tannophilus are of considerable interest for bioconversion of the sugars in lignocellulosic hydrolysates to ethanol.
Foods and drinks with high solute concentration (fruit juices and concentrates, marzipan, salted and dry-cured meats, olives and cheeses), and foods containing preservatives (wine, beverages and sauces) were selected in order to characterise the contaminant yeast flora by rapid typing techniques. These included the testing of several types of molecular methods (e.g. RFLP, DNA-fingerprinting, PCR-based techniques), analysis of long-chain fatty acids and of isoenzymes. The PCR-based detection methods enabled a faster detection of emerging specific spoilers at earlier stages of processing. Fatty acid characterisation allowed the assessment of the most frequent types of contamination yeasts and supplied the information for the definition of relevant zymological indicators. A selected group of strains was used for further studies of mechanisms underlying the resistance/tolerance of yeasts towards preservatives (weak acids) and other stress factors (temperature, high sugar and salt concentrations). This study enabled the acquisition of data on the basic biology of yeasts used in the development of differential and selective media for Zygosaccharomyces bailii, Yarrowia lipolytica, Kluyveromyces marxianus and Dekkera sp.
Among oil-degrading microorganisms isolated from oil-polluted industrial areas, one yeast strain showed high degradation activity of aliphatic hydrocarbons. From the analyses of 18S rRNA sequences, fatty acid, coenzyme Q system, G+C content of DNA, and biochemical characteristics, the strain was identified as Yarrowia lipolytica 180. Y. lipolytica 180 degraded 94% of aliphatic hydrocarbons in minimal salts medium containing 0.2% (v/v) of Arabian light crude oil within 3 days at 25°C. Optimal growth conditions for temperature, pH, NaCl concentration, and crude oil concentration were 30°C, pH 5-7, 1%, and 2% (v/v), respectively. Y. lipolytica 180 reduced surface tension when cultured on hydrocarbon substrates (1%, v/v), and the measured values of the surface tension were in the range of 51 to 57 dynes/cm. Both the cell free culture broth and cell debris of Y. lipolytica 180 were capable of emulsifying 2% (v/v) crude oil by itself. They were also capable of degrading crude oil (2%). The strain showed a cell surface hydrophobicity higher than 90%, which did not require hydrocarbon substrates for its induction. These results suggest that Y. lipolytica has high oil-degrading activity through its high emulsifying activity and cell hydrophobicity, and further indicate that the cell surface is responsible for the metabolism of aliphatic hydrocarbons.
Yeasts have been associated with foods since earliest times, both as beneficial agents and as major causes of spoilage and
economic loss. Current losses to the food industry caused by yeast spoilage are estimated at several million pounds annually
in the UK alone. As new food ingredients and new food manufacturing technologies are introduced, novel food spoilage yeasts
are emerging to present additional problems. Consumer demand for milder food preservation regimes and tougher regulatory constraints
on hygiene in the production environment all serve to increase the economic severity of problems caused by yeasts.
The efficiency of mitochondrial DNA (mtDNA) restriction analysis and random amplification of polymorphic DNA (RAPD)-PCR to characterize yeasts growing on dry-cured Iberian ham was evaluated. Besides, the distribution of the main species and biotypes of yeasts in the different ripening areas of this product was investigated. MtDNA restriction analysis allowed yeast characterization at species and strain level. RAPD-PCR with the primers (GACA)(4) and (GAC)(5) was inappropriate for characterization at species level. Most of the mtDNA restriction patterns detected in dry-cured Iberian ham were consistent with Debaryomyces hansenii. Several yeasts biotypes were associated to specific geographic areas of dry-cured Iberian ham ripening.
In beverage industries yeasts are considered as spoilage yeasts on the one hand and on the other hand they are of importance as starter cultures for fermented alcoholic beverages. In this study real-time PCR assays, PCR-DHPLC methods, sequencing methods and FT-IR spectroscopy methods were being developed, optimised and transferred to the microbiological analysis of beverages with the aim to identify and differentiate beverage-relevant yeasts. A combination of sequencing methods, real-time PCR assays and FT-IR spectroscopy methods enabled the identification (on species level) of 363 isolated strains from 53 species. The isolates originated from breweries, beverage companies and starter cultures. For the first time Saccharomyces kudriavzevii was isolated and identified from a brewing environment. Specific real-time PCR assays enable the identification of Saccharomyces sensu stricto species.
The aim of the present study was to find out, whether it is possible to distinguish or identify yeast strains by using PCR-based methods. The majority of the strains to be analyzed was obtained from the Hefebank Weihenstephan. These strains are normally used in the process of beer-brewing. In addition, yeasts which do not belong to the genus Saccharomyces or the species S. cerevisiae and which are not used in beer production were also analyzed. It was found by applying SSPC technology that it is not possible to distinguish the beer yeasts with the help of the analyzed fragment of their 18S rRNA-gene. Yet, the technique allowed to differentiate yeasts on the species level. With different fingerprinting techniques such as RAPD, analysis of δ elements and AFLP, yeasts were to be differentiated on the strain level. Top-fermenting yeasts were assigned to different groups according to the results of the first two of the above-mentioned methods. In general, these groups corresponded to the industrial use of the strains, e. g. wheat beer or "Altbier" yeast. The lager strains presented as a uniform group in which no further differentiation was possible. When AFLP-technique was applied, the discrimination of different lager yeasts was possible based on a single marker. Said marker was further characterized. Consequently, it was possible to establish a specific PCR, that allowed the analysis of this marker directly from genomic DNA. When comparing the three applied techniques, AFLP showed most stability concerning reproducibility and seemed to have the highest discrimination potential. Analysis of microsatellites, obtained from Saccharomyces Genome Database (SGD), showed several differentiation levels for top-fermenting yeasts ranging from the main groups as described for the fingerprinting techniques to the identification of single strains depending on the analyzed locus. The subdivision of lager yeast strains was only possible by a systematic isolation of a variable locus and its consequent analysis. Furthermore, a method of subtractive hybridization was developed. The aim was to identify specific sequences for single yeast strains. With this method, two fragments were isolated, that showed specific sequences for lager yeasts when compared to top-fermenting yeasts. With primers based upon these sequences all lager strains but none of the top-fermenting strains were detected by PCR analysis. While screening further Saccharomyces-species with these primers, a PCR-product was amplified out of two S. pastorianus strains. This indicates a close relationship between lager yeasts and the species S. pastorianus. This conclusion is supported by further results of the present work, since these yeasts proved to be very similar especially to the former type strain of S. monacensis when analyzed by the above-mentioned techniques.
Yeasts exhibit various mechanisms for the inheritance of their mitochondrial genomes. Differences among these mechanisms are based on variations within nuclear as well as mitochondrial genetic elements. Here we report diagnostic differences in the presence of biologically active mitochondrial intergenic sequences, ori-reptra, among related yeasts in the genera Saccharomyces, Arxiozyma, Debaryomyces, Kluyveromyces, Pachytichospora, Torulaspora, and Zygosaccharomyces. A molecular probe containing ori-rep-tra can be employed specifically for the differentiation and identification of isolates belonging to the species complex Saccharomyces sensu stricto.
A novel PCR-based approach designed to detect retrotransposon long terminal repeat (LTR) elements via their association with tRNA genes was applied to Pichia membranaefaciens, an industrially important food spoilage yeast. A single primer based on tRNA gene sequences was used to amplify DNA fragments from different strains, and an observed fragment size difference among strains was found to correspond to the expected size of an integrated LTR. A 289-bp element was cloned as part of the larger fragment and shown to be present in a high copy number and variable genomic location in all strains examined. Sequence analysis revealed the element to be bounded by nucleotides TG at the 5' end and CA at the 3' end and to exhibit target site duplication and other sequence motifs diagnostic of retrotransposon LTRs. LTR sequence data enabled the development of a rapid identification method which distinguished among different strains. The novel method for LTR isolation and the strain identification system are both likely to prove generally applicable for a wide range of other organisms.
The 18S rRNA gene sequence of the ascomycete yeast Lodderomyces elongisporus was determined by PCR-direct sequencing. The phylogenetic inter-relationship of Lodderomyces elongisporus and other ascomycete yeast species was examined by comparative sequence analysis. Lodderomyces elongisporus was found to be most closely related to Candida parapsilosis, C. tropicalis and C. albicans, exhibiting sequence similarity values of greater than 97.5%. The relationship between L. elongisporus and Candida parapsilosis in particular is discussed with regard to the possibility that L. elongisporus is the teleomorph (sexual form) of C. parapsilosis.
A non-radioactive PCR coupled ligase detection reaction was developed to discriminate the food spoilage yeasts Zygosaccharomyces bailii and Z. bisporus from each other and from other members of the genus. A short region of the 18S rRNA gene was amplified from boiled cell lysates and polymerase chain reaction (PCR) products used as target in the template directed ligation of two adjacent oligonucleotides. Ligated products were captured using biotin-streptavidin chemistry and detected using digoxigenin
immuno-chemiluminescence. The ligase detection reaction was able to discriminate to the species level, targeting a single base deletion. The specificity of the reaction was assessed using seven species of the genus Zygosaccharomyces. Only strains of Z. bailii and Z. bisporus gave positive results with their respective primer sets. The lower detection limit of the strategy was 10pg (3 times 107 targets) of amplified product.
Analyses of the sequences of the small-subunit (18S) rRNA gene and two internal transcribed spacers (ITSs), ITS1 and ITS2, revealed that members of the yeast genera Torulaspora and Zygosaccharomyces are phylogenetically intermixed. Despite some minor differences in 18S rRNA-, ITS1-, and ITS2-derived trees, in general the patterns of the relationships inferred from the three chronometers were in good agreement. The ITS sequences of Torulaspora and Zygosaccharomyces species exhibited far greater interspecies differences than the 18S rRNA sequences and were better than 18S rRNA sequences for measuring close genealogical relationships. Despite the existence of interstrain ITS sequence variation in some species, it is possible to identify conserved regions in both ITSs that are useful in species differentiation.
A molecular systematic investigation of members of the ascomycetous yeast genera Brettanomyces, Debaryomyces, Dekkera, and Kluyveromyces was performed by using 18S rRNA gene sequence analysis. Our comparative sequence analysis revealed that Brettanomyces anomalus and Brettanomyces bruxellensis were closely related to one another and also to their teleomorphs, Dekkera anomala and Dekkera bruxellensis, respectively. Together with Dekkera custersiana and Dekkera naardenensis, these four species formed a stable and distinct phylogenetic group. The three representative species of the genus Debaryomyces examined (viz., Debaryomyces castellii, Debaryomyces hansenii, and Debaryomyces udenii) were found to be genealogically highly related to each other and exhibited a specific phylogenetic affinity (level of sequence similarity, approximately 99.2%) with Candida guilliermondii (teleomorph, Pichia guilliermondii). Debaryomyces species and C. guilliermondii formed a distinct phylogenetic group, which displayed a significant association with a phylogenetically coherent cluster encompassing Lodderomyces elongisporus, Candida albicans, and four other Candida species. In contrast to the situation with the genera Brettanomyces and Debaryomyces, the genus Kluyveromyces displayed very marked phylogenetic heterogeneity. Kluyveromyces polysporus, the type species of the genus Kluyveromyces, and six other Kluyveromyces species (viz., Kluyveromyces africanus, Kluyveromyces delphensis, Kluyveromyces lodderae, Kluyveromyces thermotolerans, Kluyveromyces waltii, and Kluyveromyces yarrowii) were phylogenetically intermixed with species of the genera Zygosaccharomyces, Saccharomyces, and Torulaspora. In contrast, Kluyveromyces aestuarii, Kluyveromyces dobzhanskii, Kluyveromyces lactis, Kluyveromyces wickerhamii, and three Kluyveromyces marxianus varieties, along with their anamorph, Candida kefyr, formed a highly stable monophyletic group worthy of separate generic status. Kluyveromyces blattae and Kluyveromyces phaffii formed two distinct phylogenetic lines that did not exhibit particularly close affinity with each other or other ascomycetous yeast genera. Our phylogenetic findings are discussed in the context of the results of other genotypic and phenotypic studies.
A phylogenetic investigation of the ascomycetous yeast genus Saccharomyces was performed by using 18S rRNA gene sequence analysis. Comparative sequence analysis showed that the genus is phylogenetically very heterogeneous. Saccharomyces species were found to be phylogenetically interdispersed with members of other ascomycetous genera (e.g., the genera Kluyveromyces, Torulaspora, and Zygosaccharomyces). The four species of the Saccharomyces sensu stricto complex (viz., Saccharomyces bayanus, Saccharomyces cerevisiae, Saccharomyces paradoxus, and Saccharomyces pastorianus) were found to be phylogenetically closely related to one another, displaying exceptionally high levels of sequence similarity (> or = 99.9%). These four species formed a natural group that was quite separate from the other Saccharomyces and non-Saccharomyces species examined. Saccharomyces exiguus and its anamorph, Candida holmii, were found to be genealogically almost identical and, along with Saccharomyces barnettii, formed a stable group closely related to, but nevertheless distinct from, Kluyveromyces africanus, Kluyveromyces lodderae, Saccharomyces rosinii, Saccharomyces spencerorum, and Saccharomyces sp. strain CBS 7662T (T = type strain). Saccharomyces spencerorum and Kluyveromyces lodderae displayed a particularly close genealogical affinity with each other, as did Saccharomyces castellii and Saccharomyces dairensis. Similarly, Saccharomyces servazzii, Saccharomyces unisporus, and Saccharomyces sp. strain CBS 6904 were found to be genotypically highly related and to form a phylogenetically distinct lineage. The recently reinstated species Saccharomyces transvaalensis was found to form a distinct lineage and displayed no specific association with any other Saccharomyces or non-Saccharomyces species. Saccharomyces kluyveri formed a very loose association with a group which included Kluyveromyces thermotolerans, Kluyveromyces waltii, Zygosaccharomyces cidri, and Zygosaccharomyces fermentati. Saccharomyces spp. strain CBS 6334T, on the other hand, displayed no specific association with any of the other Saccharomyces spp. studied, although a neighbor-joining analysis did reveal that this strain exhibited a loose phylogenetic affinity with Kluyveromyces polysporus and Kluyveromyces yarrowii. On the basis of the phylogenetic findings, two new Saccharomyces species, Saccharomyces kunashirensis (with type strain CBS 7662) and Saccharomyces martiniae (with type strain CBS 6334), are described.
Several wild and collection strains of the genus Zygosaccharomyces were characterized using a rapid and simple method of restriction analysis of mitochondrial DNA. Patterns obtained with three endonucleases (HaeIII, HinfI and RsaI) made it possible to differentiate each species and to identify the wild strains, isolated from the same spoiled concentrated must, as belonging to the species Z. rouxii. The HinfI restriction enzyme produced a strain-specific pattern which allowed us to recognize that the seven wild isolates belonged to only three strains.
Sequences of two internally transcribed spacer regions between 18S and 28S rRNA genes were determined to assess the phylogenetic relationship in the strains belonging to the genus Saccharomyces. The sequences of S. bayanus and S. pastorianus were quite similar, but not identical. Two phylogenetic trees constructed by the neighbor-joining method showed that all the species examined were distinguished from one another. The Saccharomyces sensu stricto species: S. cerevisiae, S. bayanus, S. paradoxus and S. pastorianus, were closely related and far from the Saccharomyces sensu lato species including S. barnetti, S. castellii, S. dairensis, S. exiguus, S. servazzii, S. spencerorum and S. unisporus, and an outlying species, S. kluyveri.
A phylogenetic investigation of the ascomycetous yeast genus Williopsis was performed by using 18S rRNA gene sequence analysis. Comparative sequence analysis revealed the genus to be phylogenetically heterogeneous. The five varieties of Williopsis saturnus [var. mrakii, var. sargentensis, var. saturnus (type), var. suaveolens and var. subsufficiens] were found to have identical 18S rRNA gene sequences and formed a distinct group, quite separate from all other Williopsis and non-Williopsis species examined. Williopsis mucosa was found to be the closet phylogenetic relative to the Williopsis saturnus group, however a sequence divergence of approximately 2.3% suggests this species may belong to a separate genus. The recently described species Williopsis salicorniae was found to exhibit a relatively close association with Ogataea minuta (identical to Pichia minuta), the type species of the genus Ogataea. The remaining two members of the genus, Williopsis californica and Williopsis pratensis, were found to form distinct lineages, displaying no specific association with any other Williopsis or non-Williopsis species. Based on comparative analysis of 18S rRNA genes it is apparent that the genus Williopsis as presently constituted is not monophyletic, and that the five currently recognized species form separate sublines each potentially worthy of separate generic status. The genus Williopsis should be restricted to the type species Williopsis saturnus and its five varieties. Despite the five varieties of Williopsis saturnus being genealogically indistinguishable at the 18S rRNA gene level, sequence analysis of the Internal transcribed spacer (ITS) region revealed that the five varieties could be differentiated on both their ITS1 and their ITS2 sequences, providing further evidence of the value of ITS sequences for discrimination of yeasts at the subspecies level.
Yeast had been known to contain only one kind of phospholipid deacylating enzyme with an optimal pH in the acidic range. However, among 8 genera and 25 strains, 7 genera and 13 strains had phospholipid deacylating activity at pH 8.0, when screening of enzyme activity was done with micellar and liposomal substrates. The enzymatic properties of phospholipid deacylating enzyme existing in yeast was not related to genetic identity based on 18S rRNA gene sequence. The results suggest that yeast contains enzymes showing a variety of properties depending on the species of yeast, and further studies on this enzyme with more varieties of yeasts are necessary for understanding the physiological roles of the enzyme in yeast.
Unusual growth characteristics of a spoilage yeast, originally isolated from spoiled whole-orange drink and previously identified as Zygosaccharomyces bailii, prompted careful re-examination of its taxonomic position. Small-subunit rRNA gene sequences were determined for this strain and for four other strains also originally described as Z. bailii but which, in contrast to other strains of this species, grew poorly or not at all under aerobic conditions with agitation, failed to grow in the presence of 1% acetic acid and failed to grow at 30 degrees C. Comparative sequence analysis revealed that these strains represented a phylogenetically distinct taxon closely related to, but distinct from, Z. bailii and Zygosaccharomyces bisporus. Furthermore, sequence analysis of the internal transcribed spacer (ITS) region showed that, while all five strains had identical ITS2 sequences, they could be subdivided into two groups based on ITS1 sequences. Despite such minor inter-strain sequence variation, these yeasts could readily be distinguished from all other currently described Zygosaccharomyces species by using ITS sequences. On the basis of the phylogenetic results presented, a new species comprising the five strains, Zygosaccharomyces lentus sp. nov., is described and supporting physiological data are discussed, including a demonstration that growth of this species is particularly sensitive to the presence of oxygen. The type strain of Z. lentus is NCYC D2627T.
Secondary structure models of 54 5S RNA species are constructed based on the comparative analyses of their primary structure. All 5S RNAs examined have essentially the same secondary structure. However, there are revealing characteristic differences between eukaryotic and prokaryotic types. The prokaryotic 5S RNAs may be further classified into two types, one having 120 nucleotides (120-N type) and another having 116 (116-N type). A possible mechanism for the conversion of the prokaryotic 116-N type to the 120-N type 5S RNAs (or vice versa) is discussed on the basis of their nucleotide alignments. Finally, by comparing the nucleotide alignments, we propose a phylogenic tree of the 54 5S RNA species.
Although the applicability of small subunit ribosomal RNA (16S rRNA) sequences for bacterial classification is now well accepted, the general use of these molecules has been hindered by the technical difficulty of obtaining their sequences. A protocol is described for rapidly generating large blocks of 16S rRNA sequence data without isolation of the 16S rRNA or cloning of its gene. The 16S rRNA in bulk cellular RNA preparations is selectively targeted for dideoxynucleotide-terminated sequencing by using reverse transcriptase and synthetic oligodeoxynucleotide primers complementary to universally conserved 16S rRNA sequences. Three particularly useful priming sites, which provide access to the three major 16S rRNA structural domains, routinely yield 800-1000 nucleotides of 16S rRNA sequence. The method is evaluated with respect to accuracy, sensitivity to modified nucleotides in the template RNA, and phylogenetic usefulness, by examination of several 16S rRNAs whose gene sequences are known. The relative simplicity of this approach should facilitate a rapid expansion of the 16S rRNA sequence collection available for phylogenetic analyses.
Abstract Ribosomal RNA sequences are an appealing target for bacterial classification as well as for development of group- or species-specific DNA probes. Using the polymerase chain reaction and synthetic primers, the feasibility of this gene amplification technique for rapid sequence determination of the major 16S ribosomal RNA domains from small amounts of input DNA is demonstrated. Information useful for phylogenetic classification as well as for construction of specific DNA probes may be obtained by comparison with known sequences.
Eleven strains of Torulaspora and Zygosaccharomyces species were examined for the partial base sequences of 18S and 26S rRNAs. In the partial base sequences in positions 493-622 (130 bases) of 26S rRNA, there were 88-91% and 70-92% maximum homologies within the genera Torulaspora and Zygosaccharomyces, respectively. The maximum homologies were 70-90% between the two genera. The species of the two genera had 73-88% maximum homologies with Saccharomyces cerevisiae. In the partial base sequences in positions 1611-1835 (225 bases) of 26S rRNA, there were 3-0 and 16-1 base differences within the two genera, respectively. The base differences were 15-0 between the two genera. The two genera had 17-8 base differences with S. cerevisiae. In the partial base sequences in positions 1451-1618 (168 bases) of 18S rRNA, there were 0 and 3-0 base differences within the two genera, respectively. The base differences were 2-0 between the two genera. The two genera had 3-1 base differences with S. cerevisiae. Zygosaccharomyces cidri and Z. fermentati occupied a unique situation (base differences, 3-2). The data obtained were discussed with regard to the phylogenetic relationships and the taxonomic positions of Torulaspora, Zygosaccharomyces, and Saccharomyces.
The potential of ribosomal (r) RNA and the encoding genes (rDNA) to elucidate natural relationships has been dramatically extended by improved sequencing approaches and the application of polymerase chain reaction. Sequence information on 16S and 23S rRNA/DNA from 69 strains of 53 Streptomyces species allows determination of regions that can be used as target sites for diagnostic probes, and for amplification and sequencing primers. To generate phylogenetic trees, sequence similarities are converted into distance values. The topologies of the trees based on different parts of the molecule are compared among each other and to the numerical phenotypic clustering of the strains.
The extent of nuclear DNA complementarity was determined for members of the genus Zygosaccharomyces. From these comparisons, nine species have been identified: Z. baillii, Z. bisporus, Z. cidri, Z. fermentati, Z. florentinus, Z. mellis, Z. microellipsoides, Z. mrakii and Z. rouxii. Candida mogii, the proposed anamorph of Z. rouxii, showed low relatedness to all nine species. The recently described Saccharomyces astigiensis and S. albasitensis were conspecific with Z. fermentati, and S. placentae showed high relatedness with Z. rouxii. Growth tests were defined that allow recognition of all Zygosaccharomyces species.
Although the applicability of small subunit ribosomal RNA (16S rRNA) sequences for bacterial classification is now well accepted, the general use of these molecules has been hindered by the technical difficulty of obtaining their sequences. A protocol is described for rapidly generating large blocks of 16S rRNA sequence data without isolation of the 16S rRNA or cloning of its gene. The 16S rRNA in bulk cellular RNA preparations is selectively targeted for dideoxynucleotide-terminated sequencing by using reverse transcriptase and synthetic oligodeoxynucleotide primers complementary to universally conserved 16S rRNA sequences. Three particularly useful priming sites, which provide access to the three major 16S rRNA structural domains, routinely yield 800-1000 nucleotides of 16S rRNA sequence. The method is evaluated with respect to accuracy, sensitivity to modified nucleotides in the template RNA, and phylogenetic usefulness, by examination of several 16S rRNAs whose gene sequences are known. The relative simplicity of this approach should facilitate a rapid expansion of the 16S rRNA sequence collection available for phylogenetic analyses.
Bacterial evolution is a topic that 10 years ago was little more than pseudoscience. Today, because of the capacity to determine and compare macromolecular sequences, the study of bacterial evolution is transforming the science of microbiology. Many hundreds of bacterial species have been characterized in terms of partial or complete ribosomal ribonucleic acid sequences, which permit the construction of a comprehensive phylogenetic tree. This phylogeny is of obvious value to the evolutionary biologist. It not only provides a framework within which to understand the evolution of bacterial phenotypes and the general nature of evolutionary process in the microbial world, but also allows one to approach the problems of cellular evolution and the relationship between physical changes in the planet and the evolutionary responses to them. The tree also has considerable predictive and organizational value for microbiology as a whole, affecting and changing the ways in which microbiologists interpret and design experiments as well as their overall perception of the field and its relationship to the other biological disciplines. The bacteria in actuality comprise two separate primary kingdoms, the eubacteria and the archaebacteria, no more related to one another than to eucaryotes. The eubacteria constitute about 10 major groups (the equivalent of eucaryotic phyla); the archaebacteria consist of at least five. The two kingdoms are very different, not only in general molecular phenotype but in the ways in which they evolve. The phylogenetic distribution of phenotypes in both kingdoms suggest that all procaryotes have ultimately arisen from thermophilic ancestry. There seems to exist a clear relationship between the rate at which bacteria evolve and the type of evolution they undergo. A rapid evolutionary course results in a highly altered phenotype, in a sense a damaged phenotype. Both this rate and the accompanying quality of evolutionary change seem to be mirrored in the changes that occur in ribosomal ribonucleic acids and presumably other molecular chronometers.
Ribosomal RNA sequences are an appealing target for bacterial classification as well as for development of group- or species-specific DNA probes. Using the polymerase chain reaction and synthetic primers, the feasibility of this gene amplification technique for rapid sequence determination of the major 16S ribosomal RNA domains from small amounts of input DNA is demonstrated. Information useful for phylogenetic classification as well as for construction of specific DNA probes may be obtained by comparison with known sequences.
The phylogenetic interrelationships of saccharolytic C. botulinum types B, E and F together with eleven other saccharolytic clostridia were examined by 16S rRNA gene sequencing. Comparative analysis of the sequence data revealed that the saccharolytic C. botulinum types B, E and F were highly related and represent a single genetic group. Strains of C. barati and C. butyricum that produce botulinal neurotoxin revealed almost 100% 16S rRNA sequence identity with their respective non-toxigenic counterparts and were phylogenetically distinct from saccharolytic C. botulinum (types B, E and F). Proteolytic C. botulinum type F was shown to be phylogenetically remote from the saccharolytic C. botulinum group. The implications of the sequence data for the taxonomy of the C. botulinum complex are discussed.
As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.
The Yeasts, A Taxonomic Study
- D. Yarrow