Content uploaded by Chuck Gomer
Author content
All content in this area was uploaded by Chuck Gomer
Content may be subject to copyright.
1996;56:2355-2360. Published online May 1, 1996.Cancer Res
Charles J. Gomer, Stefan W. Ryter, Angela Ferrario, et al.
Expression of Heat Shock Proteins
Photodynamic Therapy-mediated Oxidative Stress Can Induce
Updated Version http://cancerres.aacrjournals.org/content/56/10/2355
Access the most recent version of this article at:
Citing Articles http://cancerres.aacrjournals.org/content/56/10/2355#related-urls
This article has been cited by 14 HighWire-hosted articles. Access the articles at:
E-mail alerts related to this article or journal.Sign up to receive free email-alerts
Subscriptions
Reprints and .pubs@aacr.orgDepartment at
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Permissions .permissions@aacr.orgDepartment at
To request permission to re-use all or part of this article, contact the AACR Publications
American Association for Cancer Research Copyright © 1996 on July 14, 2011cancerres.aacrjournals.orgDownloaded from
[CANCER RESEARCH 56. 2355-2360, May 15. 1996]
Photodynamic Therapy-mediated Oxidative Stress Can Induce Expression of Heat
Shock Proteins1
Charles J. Corner,2 Stefan W. Ryter,3 Angela Ferrano, Natalie Rucker, Sam Wong, and Anita M. R. Fisher
Clayton Ocular Oncology Center, Children* Hospital Los Angeles, and Departments of Pediatrics ¡C.J. G.I. Radiation Oncology ¡C.J. G.¡,and Molecular Pharmacology and
Toxicology ¡S.R., C. J. C.], University of Southern California, Los Angeles, California 90027
ABSTRACT
Photodynamic therapy (PDT) is an experimental cancer therapy induc
ing tumor tissue damage via photosensitizer-mediated oxidative cytotox-
icity. A previous report indicates that oxidative stress induced by hydro
gen peroxide or menadione activates the heat shock transcription factor in
mouse cells but does not result in either increased transcription or trans
lation of heat shock proteins (HSPs). Our study documents that photo
sensitizer-mediated oxidative stress can activate the heat shock factor as
well as increase HSP-70 mRNA and protein levels in mouse RIF-1 cells.
The cellular heat shock response after PDT varied for the different
photosensitizers being examined. Treatments using either a chlorin
(mono-L-aspartyl chlorin-e6)- or purpurin (tin etio-purpurin)-based sen-
sitizer induced HSP-70 expression, whereas identical photosensitization
conditions with a porphyrin (Photofrin)-based sensitizer failed to induce a
cellular HSP response. These sensitizers, which generate singlet oxygen as
the primary oxidant during photosensitization, were used in experiments
under isoeffective treatment conditions. HSP-70 expression after photo
sensitization was associated with the concomitant induction of thermotol-
erance in PDT-treated cells. Interestingly, reverse transcription-PCR
demonstrated that in vivo PDT treatments of RIF-1 tumors induce ex
pression of HSP-70 for all photosensitizers including Photofrin. These
results indicate that photosensitizer-generated singlet oxygen exposure
can induce in vitro and in vivo HSP-70 expression, and that specific
subcellular targets of PDT (which can differ for various sensitizers) are
determinants for HSP-70 activation after oxidative stress.
INTRODUCTION
PDT4 is an experimental treatment for malignant and benign dis
eases (1, 2). Tumors of the bronchus, bladder, esophagus, head and
neck, brain, and skin are being treated with PDT in clinical trials (3,
4). Phase I and II studies evaluating PDT for psoriasis and age-related
macular degeneration are also under way (5). Most PDT clinical trials
use a porphyrin-based photosensitizer, PH-II (1). However, several
PDT clinical trials are now using second-generation photosensitizers
involving chlorin-, purpurin-, benzoporphyrin-, and phthalocyanine-
based derivatives (6, 7). The primary oxidant associated with these
photosensitization reactions is singlet oxygen, which is generated
during a Type II photochemical reaction (8). Photosensitization oxi
dizes cellular macromolecules including lipids, proteins, and nucleic
acids, and PDT damages a variety of subcellular structures (1, 9).
Cytotoxicity involves both programmed cell death as well as cellular
necrosis (10-12).
Received 1/12/96; accepted 3/19/96.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance with
18 U.S.C. Section 1734 solely to indicate this fact.
' This research was performed in conjunction with the Clayton Foundation for Re
search and was supported in part by USPHS Grant R37-CA-31230 from NIH and Office
of Naval Research Grant N000014-91-J-4047 from the Department of Defense.
2 To whom requests for reprints should be addressed, at Childrens Hospital Los
Angeles, Mail Stop 67, 4650 Sunset Boulevard. Los Angeles. CA 90027.
3 Present address: Swiss Institute for Experimental Cancer Research, 155 Chemin des
Boveresses, Epalinges, CH-1066, Switzerland.
4 The abbreviations used are: PDT, photodynamic therapy; GAPDH, glyceraldehyde-
3-phosphate dehydrogenase; HSE, heat shock element; HSF. heat shock factor; HSP, heat
shock protein; NPe6, mono-L-aspartyl chlorin-e6; PH-II, Photofrin porfimer sodium;
RIF-1, radiation-induced fibrosarcoma; RT-PCR, reverse transcription PCR; SnET2, tin
etio-purpurin.
Oxidative stress induced by porphyrin-mediated photosensitization
increases expression of early-response genes (c-fos, c-jun, c-myc,
egr-\) as well as the cellular stress proteins glucose-regulated protein
and heme oxygenase (13-15). Signaling pathways involved in PDT-
mediated gene activation have not been defined, but it appears that
protein phosphorylation is involved (16, 17). A recent study using
murine cells reports that oxidative stress mediated by hydrogen per
oxide or menadione activates HSF but does not result in the accumu
lation of HSP-70 mRNA or HSP (18). In the present study, we
examined whether different photosensitizers, which function via com
mon photochemical pathways to generate singlet oxygen, can induce
HSP-70 expression and concomitant cellular thermotolerance. HSPs
represent a highly conserved family of constitutively expressed and
stress-induced cellular proteins ranging in size from A/r 20,000 to
more than 110,000 (19, 20). These molecular chaperones play a
central role in the binding of denatured proteins, and in the folding
and/or cytoplasmic translocation of nascent proteins (21, 22). Induc-
ible HSPs are also associated with the development of thermotoler
ance or transient resistance to heat stress (23-25). A variety of
exogenous stress conditions, including exposure to heat, arsenite,
amino acid analogues, heavy metals, and ethanol, can induce HSPs
(19, 26). Results of our study demonstrate that cellular PDT can
induce HSP-70 expression but that photosensitizers (with similar
photochemical pathways but differing subcellular localization prop
erties) exhibit varying degrees of HSP-70 induction. Interestingly, in
vivo PDT of RIF-1 tumors using the porphyrin, chlorin, or purpurin
photosensitizers all resulted in increased expression of HSP-70
mRNA.
MATERIALS AND METHODS
Drugs. PH-II porfimer sodium was provided by Quadra Logics, Inc. (Van
couver, British Columbia, Canada); NPe6 was provided by Porphyrin Products
(Logan, UT); and SnET2 was provided by PDT Systems (Santa Barbara, CA).
Working solutions were 2.5 mg/ml for PH-II and NPe6 and 1 mg/ml for
SnET2.
Cells and Cell Culture. Murine RIF cells (RIF-1) were used in all exper
iments (27). Cells were grown in RPMI 1640 supplemented with 15% PCS and
antibiotics. The cells were plated into plastic Petri dishes before experiments
involving clonogenic survival, mRNA analysis, or thermotolerance evaluation
and into plastic T-75 flasks before mobility shift assays, protein synthesis
analysis, and Western analysis. The plating efficiency for untreated cells
ranged from 50 to 60%. Single-treatment photosensitization experiments were
performed as reported previously (28). Briefly, cells were incubated in the dark
with a photosensitizer (25 Mg/ml for PH-II and NPe6 or 0.75 /xg/ml for SnET2)
at 37°Cfor 16 h in RPMI 1640 supplemented with 5% FCS. After incubation,
the cells were incubated for 30 min in fresh RPMI 1640 supplemented with
10% PCS and then exposed to visible light. Cells incubated with PH-II were
exposed to broad-spectrum (570-650 nm) red light (0.35 mW/cm2, 315 J/m2)
generated by a parallel series of 30-W fluorescent bulbs (29). NPe6-treated
cells were exposed to 664 nm light (2 mW/cm2, 3400 J/m2) generated by an
argon ion laser-pumped dye laser, and SnET2-treated cells were exposed to
660 nm light (2 mW/cm2, 1600 J/m2) generated by the same laser. After light
treatments, cells were re-fed with complete growth media and incubated at
37°C.Cytotoxicity was determined 8 days after treatment by clonogenic assay.
Survival levels for PDT experiments involving the three photosensitizers
ranged from 25 to 39% for RNA and protein analysis and from 12 to 41% for
2355
American Association for Cancer Research Copyright © 1996 on July 14, 2011cancerres.aacrjournals.orgDownloaded from
PHOTOSENSITIZATION INDUCES HSPs
HSE binding analysis. Hyperthermia involved exposing cells to 45°Cin a
temperature-controlled water bath. Induction and measurement of PDT-medi-
ated thermotolerance included first treating cells with PDT followed at varying
time intervals (0-24 h) with heat at 45°Cfor 45 min. Heat-induced thermo
tolerance involved a priming heat dose (45°Cfor 20 min) followed at varying
time intervals (0-24 h) with heat at 45°Cfor 45 min. Cells were trypsinized
and replated for survival analysis using colony formation at the completion of
thermotolerance experiments (26).
Mobility Shift Assays. Binding of nuclear protein to the mouse HSE was
analyzed using an electrophoretic mobility shift assay as described previously
(30). Briefly, cells were harvested using solutions containing protease inhibi
tors (0.2 IHM phenylmethylsulfonyl fluoride, l /UMleupeptin, and 2 fiM pep-
statin) and phosphatase inhibitors (2 mM Na orthovanadate and 5 mM NaF).
Cells were washed in PBS, scraped from dishes, incubated in hypotonie buffer
[10 mM HEPES (pH 7.9), 1.5 mM MgCU, 10 mM KC1,0.5 mM DTT] for 30 min
and then lysed by Dounce homogenization. Nuclei were isolated and extracted
first in a low-salt buffer [20 mM HEPES (pH 7.9). 25% glycerol. 1.5 mM
MgCk 20 mM KC1, 0.2 mM EDTA] and then in high-salt buffer [20 mM
HEPES (pH 7.9), 25% glycerol, 1.5 mM MgCl2. 1.4 M KC1, 0.2 mM EDTA].
Extracts were centrifuged for 30 min at 25,000 x g and resulting supernatants
dialyzed overnight against a buffer containing 20 mM HEPES (pH 7.9), 20%
glycerol. 100 mM KG, and 0.2 mM EDTA. A double-stranded oligonucleotide
corresponding to the proximal HSE from the mouse HSP-70 promoter (-321
to -350; 5'AGACGCGAAACTGCTGGAAGATTCCTGGCC3') was used
for DNA binding. The probe was 5' end labeled with 12P using T4 polynu-
cleotide kinase. Nuclear protein (5 fig) was added to a mixture containing 2 /ng
poly(dl-dC) and 10,000 cpm of "P-labeled HSE oligonucleotide. For compet
itive analysis, 100-fold excess of cold HSE was added to a duplicate of each
reaction. Resulting mixtures were incubated at 37°Cfor 30 min. DNA-protein
complexes were resolved by electrophoresis on a 4% polyacrylamide gel (30).
mRNA Slot Blot Analysis. Total cellular RNA was collected using a
guanidinium isothiocyanate phenol chloroform extraction procedure (31).
RNA (8 fig) was blotted onto a nylon filter using positive pressure and UV
cross-linked. The filter was then incubated overnight in hybridization solution
(50% formamide, 10% dextran sulfate, l M NaCl, 1% SDS, and 2 mg salmon
sperm DNA) containing <2P-labeled DNA probes encoding for HSP-70 or
a-tubulin. Blots were then washed in a solution containing 0.IX SSC (SSC
containing 0.1% SDS) and 0.1% SDS for 30 min at 25°Cand then for an
additional 30 min at 42°Cfor a-tubulin or at 65°Cfor HSP-70. Blots were then
exposed to X-ray film, washed, and rehybridized. Relative RNA levels were
determined by densitometric scanning of the resulting autoradiograms.
Protein Synthesis and Western Immunoblot Analysis. Protein synthesis
profiles were analyzed as described previously (32). Cells were labeled for 1
h with 30 fiCi/ml rran.v-[15S)methionine (ICN Biomedicals. Inc., Irvine. CA)
in methionine-free media at selected times after the various photosensitization
treatments described above. Cells were then dissolved in a SDS loading buffer,
and lysates containing equal amounts of radioactivity were size separated using
PAGE (15). Resulting autoradiograms were then quantified by scanning den-
sitometry. Documentation of HSP-70 levels after PDT was obtained by West
ern immunoblot analysis. Treated cells were lysed in sample buffer as de
scribed previously and separated by electrophoresis on a 10% polyacrylamide
gel (28). The proteins were then transferred to nitrocellulose paper and incu
bated for 2 h at 37°Cin 10% nonfat milk. The resulting blots were then
incubated with a mouse monoclonal antibody specific for inducible HSP-70
(SPA-810: StressGen Biotechnologies Corp.. Victoria. British Columbia, Can
ada; Ref. 28). The resulting antigen-antibody complexes were visualized with
an alkaline phosphatase-linked avidin/biotin detection system (Vectastain;
Vector Laboratories. Burlingame, CA).
In Vivo Treatment and RT-PCR Analysis of RIF-1 Tumors. Female
C3H/HeJ mice (8-12 weeks old) were injected s.c. in the right flank with IO4
RIF-1 cells. PDT- and laser-induced hyperthermia treatments were started
when the largest diameter of the resulting tumors reached 6 mm. For PDT,
mice received an i.v. injection of one of the three photosensitizers at a dose of
either 5 mg/kg (PH-II and NPe6) or 1.5 mg/kg (SnET2). PDT light treatments
were then started either 6 (NPe6) or 24 h (PH-1I and SnET2) after injection. An
argon ion-pumped dye laser tuned to either 630 (PH-II), 660 (SnET2). or 664
nm (NPe6) was used for in vivo PDT treatments. Light was delivered to tumor
surfaces via a quartz fiber microlens delivery system, and power outputs were
measured with a power meter (33). Total light doses of 200 J/cirr together with
power densities of 75 mW/cnr were used for PDT treatments. Tumor hyper
thermia treatments involved a 20-min exposure to 44.5-45.0°C. which was
achieved using 810 nm diode ¡aserlight delivered at a power density of 220
mW/cnr. These treatment conditions were expected to induce comparable but
noncurative tumoricidal responses. Animals were sacrificed 6 h after the
various treatments, and tumors were collected for RT-PCR analysis. Total
RNA was isolated from control and treated tumors using a guanidinium
isothiocyanate phenol chloroform extraction (31). RT-PCR was performed
using the Gene Amp RNA PCR kit (Perkin-Elmer, Norwalk. CT). RNA (0.5
jiig) was reverse transcribed and amplified for 25 cycles (30 s denaturation at
94°C,30 s annealing at 65°C, and I min extension at 72°C).Primers to
both HSP-70 (5'CCAACGGCATCCTGAACG3f and 5TCCTTGTCGGC-
CAGCGTG3') and GAPDH (5'TGAAGGTCGGTGTGAACGGATTTGGC3'
and 5'CATGTAGGCCATGAGGTCCACCAC3') were added simultaneously
to reaction tubes for amplification. The resulting cDNA products (a 324-bp
HSP-70 fragment and a 983-bp GAPDH fragment) were size separated on a
1.5% agarose gel containing ethidium bromide and photographed under UV
illumination.
RESULTS
PDT-mediated Oxidative Stress Induces HSF Binding to HSE.
The classical heat shock response involves transcriptional induction of
heat shock genes via activation of the HSF (34). Electrophoretic
mobility shift assays demonstrated that cellular exposure to PDT-
mediated oxidative stress activated HSF binding to HSE as shown
previously after hydrogen peroxide or menadione treatments (18). Fig.
\A shows nuclear protein binding to mouse HSE for cells exposed to
NPe6-mediated PDT as well as for cells exposed to heat. The slower-
migrating, higher-molecular-weight band (Fig. \A, arrow) corre
sponds to inducible HSF binding to HSE, whereas the faster-migrat
ing, lower-molecular-weight band corresponds to the constitutive
HSE binding activity (35). Protein binding specificity to HSE was
confirmed in competition assays by including excess cold HSE in
duplicate reactions. HSF binding activity induced by NPe6-mediated
PDT was observed within 20 min of treatment and remained elevated
for 5 h (data not shown). SnET2-mediated PDT and dark incubation
of SnET2 also resulted in specific HSE binding activity, as shown in
Fig. Iß.Interestingly. PH-II-mediated PDT was associated with min
imal binding activity of HSF to HSE as shown in Fig. 1C.
PDT Can Produce a Transient Increase in HSP-70 mRNA and
Protein. mRNA levels of HSP-70 were evaluated by slot blot anal
ysis after in vitro photosensitization conditions. Fig. 2 shows relative
HSP-70 mRNA levels in RIF-1 cells (expressed as a ratio of HSP-70
versus a-tubulin) as a function of time after PDT. Increases in HSP-70
mRNA were observed after NPe6- and SnET2-mediated PDT. Max
imum mRNA levels were observed by 4 h posttreatment with a return
to background levels by 10 h. PH-II-mediated PDT did not induce an
increase in HSP-70 mRNA. Confirming results were obtained when
mRNA levels were analyzed using RT-PCR (data not shown).
Stress Proteins Are Expressed after PDT-mediated Oxidative
Stress. Synthesis of stress proteins after PDT-mediated oxidative
stress was examined using cellular incorporation of [15S]methionine
followed by SDS-PAGE and densitometric analysis. Fig. 3 shows the
kinetics of HSP-70 protein synthesis induced by isoeffective PDT
treatments for the three classes of photosensitizer. Significant HSP-70
synthesis was observed after NPe6-mediated PDT, with the maximal
level of synthesis occurring 4-8 h after treatment. Protein synthesis
levels returned to background levels within 24 h of PDT treatment.
PH-II-mediated PDT did not elicit HSP-70 synthesis after the 16-h
photosensitizer incubation protocol. An intermediate level of HSP-70
protein synthesis was also observed after SnET2-mediated PDT, and
both the induction and decay kinetics were similar to that observed for
NPe6 treatment conditions.
2356
American Association for Cancer Research Copyright © 1996 on July 14, 2011cancerres.aacrjournals.orgDownloaded from
PHOTOSENSITIZATION INDUCES HSPs
Time after POT BTime after PDT
g Time after PDT
>l1I
Fig. I. Eleclrophorelic mobility shift analysis showing specific HSE binding activity in protein extracts from RIF-1 cells. Nuclear extracts were prepared from control cells and cells
treated with either heat, photosensitizer alone, or photosensitizer after PDT. Nuclear protein was collected l h after heat treatment and at either 20 min or l h after PDT using NPeo
(A), SnET2 (ß),or PH-II (C). Lanes marked "free HSE, " reaction mixtures without proteins. Lanes marked " + ," addition of excess cold HSE oligonucleotide (12.5 ng). Arrow, HSF
specific binding activity to HSE.
24
Fig. 2. Kinetics of HSP-70 mRNA expression after PDT using PH-II. SnET2, or NPe6.
Densitometric ratios of HSP-70 veriw.v a-tubulin were obtained by scanning autoradio-
grams resulting from RNA slot blots hybridized with *2P-labeled cDNA probes first for
HSP-70 and then for a-tubulin.
Stress protein levels at various time intervals after cellular PDT
were examined by Western immunoblot analysis. Fig. 4 shows the
results of Western immunoblots using an antibody reactive against
inducible HSP-70. Cell exposure to heat served as a positive control
condition for evaluating induction of HSP-70. HSP-70 expression was
observed after NPe6- and SnET2-mediated PDT. Inducible HSP lev
els remained elevated 48 h after PDT. The increased HSP levels were
consistent with the protein synthesis data shown in Fig. 3. Specifi
cally, NPe6-mediated PDT was associated with the highest expression
of HSP-70, whereas PH-II-mediated PDT did not induce HSP-70
expression.
PDT Oxidative Stress Induces Thermotolerance. Thermotoler-
ance is a transient resistance to a subsequent heat treatment after a
priming exposure to heat (20). The thermotolerance phenotype is
correlated with HSP expression, and these proteins appear to play a
pivotal role in heat resistance (23-25). Fig. 5A shows the development
of thermotolerance when heat is used as a priming condition. A single
heat dose of 45°Cfor 45 min produces a 0.1% survival level. How
ever, when this heat dose is preceded by a priming heat treatment
(45°Cfor 20 min) that induces HSPs, the effective cytotoxicity of the
45°C45-min treatment is decreased significantly. These results are in
agreement with previous data evaluating thermotolerance (25). Fig. 5,
B and C, shows results from thermotolerance experiments when the
priming stress treatment was either NPe6- or SnET2-mediated PDT,
respectively. Thermotolerance was induced after PDT treatments,
which produced HSP expression. A priming oxidative stress treatment
using NPe6- or SnET2-mediated PDT resulted in decreased cellular
.2
«
e
(O
C
1
a.
Q.
V)
X
o
I
o
ce
2-
1.5-
1-
0.5-
SnET2
NPe6
PH-II
16 24 32 40 48
Time after PDT (h)
Fig. 3. Kinetics of HSP-70 protein synthesis following PDT using PH-II. SnET2. or
NPe6. Densitometric ratios of HSP-70 versus actin were obtained by scanning autoradio-
grams from SDS-PAGE of lysates from ira«.i-[wS|methionine-labeled RIF cells.
2357
American Association for Cancer Research Copyright © 1996 on July 14, 2011cancerres.aacrjournals.orgDownloaded from
PHOTOSENSmZATION INDUCES HSPs
hr after PDT
o,
O 0) 2
U T O 4 8 12 24 48
NPe6 P —¿ HSP-70
SnET2 _
PH-II HSP-70
A time
45°(20 min) > 45°(45 min)
100r
/20 mins
<—45°/45mins
.001
Fig. 4. Western immunoblot analysis shows HSP-70 expression after NPeó- and
SnET2-mediated PDT bul not after PH-II-mediated PDT. Treated cells were examined
from 4 to 48 h after photosensitization. Heat-treated cells (45"C for 20 min) served as a
positive control and were analyzed 6 h after treatment. Protein samples for NPe6 and
SnET2 treatment'- were run on one gel. and the upper heat treatment represents the
positive control for both groups. Drug-alone samples were collected immediately after the
16-h photosensitizer incubation, and samples labeled control were also collected at this
time.
sensitivity to a subsequent heat treatment. Kinetics of PDT-induced
thermotolerance were similar to those observed for heat. The combi
nation of PH-II-mediated PDT and heat did not result in surviving
cells, and this precluded analysis of thermotolerance under the con
ditions used in this study. Therefore, overexpression of HSPs after
PDT correlated with the induction of thermotolerance.
PDT Treatment of RIF Tumors Induces HSP-70 mRNA. Ex
pression of HSP-70 mRNA in PDT-treated tumor tissue was exam
ined using RT-PCR and results are shown in Fig. 6. Primers to
GAPDH were included to evaluate loading profiles. Control condi
tions and light-alone treatments did not induce HSP-70 mRNA. How
ever, all PDT treatments as well as heat resulted in detectable HSP-70
expression. PH-II mediated PDT was as efficient as NPe6- or SnET2-
mediated PDT at inducing in vivo expression of HSP-70 mRNA.
DISCUSSION
Our study demonstrates that PDT-mediated oxidative stress can
activate HSF binding activity as well as induce transcriptional and
translational production of HSP-70. Therefore, photosensitizer-gener-
ated reactive oxygen species such as singlet oxygen can be added to
the list of exogenous insults that activate cellular HSPs (20). Growing
evidence indicates that HSP-70 plays a major role in thermotolerance
(23), and PDT conditions that induced a cellular HSP response also
elicited thermotolerance. The question of whether heat-induced ther
motolerance confers cellular resistance to PDT has not been addressed
in the current study. Interestingly, the cellular HSP-70 response after
photosensitization varied depending on the specific sensitizer being
examined. Photosensitization involving an extended incubation with
either a chlorin (NPe6)- or purpurin (SnET2)-based sensitizer induced
HSP-70 expression, whereas isoeffective photosensitization condi
tions with a porphyrin (PH-II)-based sensitizer failed to activate HSF
binding or induce HSP expression. The fact that PH-II-mediated
photosensitization did not induce an in vitro HSP-70 response sug
gests that random singlet oxygen exposure to cells in culture is not
2358
B
O 3 6 9 121518212427
Hours Between Treatments
Atime
NPe6-PDT > 45°(45 min)
100
_ 10
re
o>
o
mean + S.E. (n=3)
.01
.001
.0001 •¿
<-NPe6 PDT
/45 min
0 3 6 9 121518212427
Hours Between Treatments
Atime
SnET2-PDT > 45°(45 min)
100
«1Ö
'E ,
9
I 1
U>
» .01
.001«
mean + SE (n=3) <—SnET2 PDT
/45 mins
12 15 18 21 24 27
Hours Between Treatments
Fig. 5. Expression of thermotolerance in RIF-1 cells treated with either hyperthermia
(A) or PDT-mediated oxidative stress (B and C). Cells were first treated with a priming
dose of either heat (A} or PDT using NPe6 (B) or SnET2 (C) and then incubated at 37°C
for the indicated time intervals before being challenged with heat. Survival levels resulting
from the individual treatments are indicated by arrows on the right ordinale. Data are
means; bars, S.E.
American Association for Cancer Research Copyright © 1996 on July 14, 2011cancerres.aacrjournals.orgDownloaded from
PHOTOSF.NSmZATION INDUCES HSPs
GAPDH
HSP-70
Fig. 6. Reverse transcriplion-PCR analysis of HSP-70 mRNA expression in RIF
tumors growing in C3H mice. Total RNA was isolated from control tumors and tumors
exposed to light alone (660 nm); photosensitizer alone: heat; or PDT using PH-II, NPe6,
or SnET2. The 983-bp fragment for GAPDH was coamplified with the 324-bp HSP-70
fragment.
sufficient by itself to activate the heat shock response. Rather, our data
suggest that specific subcellular targets of photosensitization are as
sociated with inducing HSP-70 expression. Sites of sensitizer local
ization define cellular PDT targets, whereas actual damage is medi
ated primarily by the Type II photochemical generation of singlet
oxygen (1-3). Estimates of singlet oxygen quantum yields for the
three sensitizers used in our study range from 0.4 to 0.6 (36, 37). The
minimal diffusion distance of singlet oxygen in cells (0.1-0.2 ¿im)
implies that subcellular damage will occur close to the sites of
sensitizer localization (38). Targets identified for PH-II-mediated
PDT are the plasma membrane and mitochondria, whereas targets
identified for NPe6- and SnET2-mediated PDT are the lysosomes and
plasma membrane (39-41). Differences in lysosomal versus mito
chondria! injury could therefore play a role in initiating the HSP
response after PDT. Studies using photosensitizers with selective
subcellular targets such as the mitochondria! localizing rhodamine
derivatives (42) or the lysosomal localizing Nile blue derivatives (43)
may be beneficial in identifying subcellular targets involved in the
cellular heat shock response.
In vitro patterns of HSP-70 expression after PH-II photosensitiza
tion were not predictive of the in vivo stress responses induced by
PH-II-mediated PDT. Interestingly, RT-PCR demonstrated that in
vivo PDT treatments of RIF-1 tumors were associated with expression
of HSP-70 mRNA for all photosensitizers tested, including PH-II.
Therefore, secondary effects of photosensitization in addition to direct
subcellular oxidation may play a role in the heat shock response
observed after in vivo PDT. For example, cellular photosensitization
activates phospholipase A2, which in turn hydrolyzes fatty acids from
membrane phospholipids and generates arachidonic acid (2, 11).
Thromboxane, a product of arachidonic acid metabolism, is released
in rats immediately after PH-II-mediated PDT (2, 44). Interestingly, it
has been reported recently that cellular exposure to arachidonic acid
induces a full heat shock response in mammalian cells (45). HSP-70
transcription occurs in an arachidonic acid dose-dependent manner
and involves DNA binding activity of HSF. Therefore, in vivo PDT
treatments that produce arachidonic acid via a cascade involving
phospholipase A2 activation may elicit a stress response.
Finally, little is known about the actual in vivo targets of PDT and
this is especially true for the growing number of second-generation
compounds. Our study confirms that inducible stress protein expres
sion occurs after PDT, and this observation may be useful in the
development of in vivo molecular markers of PDT targets. Conven
tional histological studies provide information regarding generalized
areas of PDT damage arising hours or days after treatment (2).
However, questions still remain regarding which specific targets
within the treated tumor volume are initially damaged by PDT.
Likewise, little is known about the uniformity of the initial PDT
response or how actual sensitizer localization profiles correspond to
tissue damage profiles. Our data suggest that HSP-70 expression can
be used as a biomarker for sites of in vivo PDT-mediated oxidative
damage using porphyrin-, chlorin-, or purpurin-based photosensitiz
ers. In situ hybridization and immunohistochemical analysis using
stress protein probes and antibodies may provide selective and sensi
tive methods for documenting in vivo profiles of initial in vivo targets
of PDT or sites of indirect arachidonic acid-mediated responses.
Combining profiles of photosensitizer localization using fluorescence
analysis with PDT-mediated HSP-70 expression profiles may there
fore produce a unique opportunity to correlate localization sites with
PDT targets.
REFERENCES
10.
12.
13
14.
15,
16.
17
19.
20.
22.
23.
24.
Gonier, C. J.. Rucker, N., Ferrano, A., and Wong. S. Principals and applications of
photodynamic therapy. Radiât.Res.. 120: 1-18. 1989.
Henderson. B. W. Photodynamic therapy: coming of age. Pholodermatology. 6:
200-211, 1989.
Fisher, A. M. R., Murphree, A. L.. and Gomer. C. J. Clinical and preclinical
photodynamic therapy. Lasers Surg. Med.. 17: 2-31. 1995.
Pass, H. I. Photodynamic therapy in oncology: mechanisms and clinical use. J. Nati.
Cancer Inst., 85: 145-157, 1993.
Levy, J. C. Photodynamic therapy. Trends Biotechnol., 13: 14-17, 1995.
Gomer. C. J. Preclinical examination of first and second generation photosensitizers
used in photodynamic therapy. Photochem. Photobiol.. 54: 1093-1107. 1991.
Marcus. S. L.. and Dugan. M. H. Global status of clinical photodynamic therapy: the
registration process for a new therapy. Lasers Surg. Med., 12: 318-324. 1992.
Weishaupt. K. R.. Gomer. C. J.. and Dougherty. T. J. Identification of singlet oxygen
as the cytotoxic agent and photoinactivation of a murine tumor. Cancer Res., 36:
2326-2329. 1976.
Moan, J.. and Berg. K. Photochemotherapy of cancer: experimental research. Photo
chem. Photobiol., 55: 931-948, 1992.
Agarwal. M. L.. Clay. M. E.. Harvey, EJ., Evans. H. H., Antunez. A. R.. and Oleinick,
N. L. Photodynamic therapy induces rapid cell death by apoptosis in L5178Y mouse
lymphoma cells. Cancer Res.. 51: 5993-5996. 1991.
Agarwal, M. L., Larkin, H.. Zaidi, S. I. A., Mukhtar, H.. and Oleinick. N. L.
Phospholipase activation triggers apoptosis in photosensitized mouse lymphoma
cells. Cancer Res., 53: 5897-5902. 1993.
Zaidi. S. I. A.. Oleinick. N. L.. Zaim, M. T.. and Mukhtar. H. Apoptosis during
photodynamic therapy induced ablation of RIF-1 tumors in C3H mice: electron
microscopy, histopathologic and biochemical evidence. Photochem. Photobiol.. 58:
771-776. 1993.
Luna. M. C.. Wong. S., and Gomer, C. J. Photodynamic therapy mediated induction
of early response genes. Cancer Res., 54: 1374-1380, 1994.
Gomer, C. J., Luna, M., Ferrano, A., and Rucker, N. Increased transcription and
translation of heme oxygenase in Chinese hamster fibroblasts following photody
namic stress or Photofrin II incubation. Photochem. Photobiol.. 53: 275-279. 1991.
Gomer. C. J.. Ferrarlo. A.. Rucker. N.. Wong. S.. and Lee. A. Glucose regulated
protein (GRP-78) induction and cellular resistance to oxidative stress mediated by
porphyrin photosensitization. Cancer Res.. 51: 6574-6579, 1991.
Oleinick. N. L.. He. J.. Xue. L-Y.. and Balasubramaniam. U. Photodynamic therapy
and apoptosis. Photochem. Photobiol., 61: 39S, 1995.
Dubbelman. T. M. A. R. Signalling induced by photodynamic therapy. Photochem.
Photobiol., 61: 31S, 1995.
Bruce, J. L., Price. B. D., Coleman. C. N.. and Calderwood. S. K. Oxidative injury
rapidly activates the heal shock transcription factor but fails to increase levels of heat
shock proteins. Cancer Res.. 53: 12-15. 1993.
Subjeck, J. R.. and Shyy. T-T. Stress protein systems of mammalian cells. Am J.
Physiol.. 250: 1-17. 1986.
Lindquist. S.. and Craig. E. A. The heat shock proteins. Ann Rev. Genet.. 22:
631-677. 1988.
Beckmann. R. P., Mizzen. L. A., and Welch. W. J. Interaction of Hsp 70 with newly
synthesized proteins: implications for protein folding and assembly. Science (Wash
ington DC). 248: 850-854. 1990.
Frydman. J.. Nimmesgern. E.. Ohtsuka, K., and Hartl, F. U. Folding of nascent
polypeplide chains in a high molecular weight mass assembly with molecular chap-
erones. Nature (Lond.), 370: 111-117, 1994.
Li, G. C., Li, L., Liu, R. Y., Rehman, M., and Lee, W. M. F. Heat shock protein hsp70
protects cells from thermal stress even after deletion of its ATP-binding domain. Proc.
Nail. Acad. Sci. USA, 89: 2036-2040, 1992.
Landry. J.. Chretien, P.. Lambert. H.. Hickey, E.. and Weber. L. A. Heat shock
resistance conferred by expression of the human HSP-27 gene in rodent cells. J. Cell
Biol., 109: 7-15, 1989.
2359
American Association for Cancer Research Copyright © 1996 on July 14, 2011cancerres.aacrjournals.orgDownloaded from
PHOTOSENSITIZATION INDUCES HSPs
25. Riabowol, K. T., Mizzen. L. A., and Welch, W. J. Heat shock is lethal to fibroblasts
microinjecled with antibody against hsp-70. Science (Washington DC), 242: 433-
436. 1988.
26. Laszlo. A., and Li, G. C. Effect of amino acid analogs on the development of
thermotolerance and on thermotolerant cells. J. Cell. Physiol.. 154: 419-432. 1993.
27. Luna, M. C.. and Gomer. C. J. Isolation and initial characterization of mouse tumor
cells resistant to porphyrin-mediated photodynamic therapy. Cancer Res.. 51: 4243-
4249. 1991.
28. Fisher. A. M. R., Ferrano. A., and Gomer, C. J. Adriamycin resistance in Chinese
hamster fibroblasts following oxidative stress induced by photodynamic therapy.
Photochem. Photobiol.. 58: 581-588. 1993.
29. Gomer. C. J.. Rucker, N., Ferrano. A., and Murphree. A. L. Expression of potentially
lethal damage in Chinese hamster cells exposed to hematoporphyrin derivative
photodynamic therapy. Cancer Res.. 46: 3348-3352. 1986.
30. Ryter. S. W.. and Gomer. C. J. NFkB binding activity in mouse L12IO cells
following Photofrin II mediated photosensitization. Photochem. Photobiol., 58:
753-756. 1993.
31. Luna, M. C.. Ferrano, A.. Rucker. N., and Gomer. C. J. Decreased expression and
function of or-2 macroglobulin receptor/low density lipoprotein receptor-related pro
tein in photodynamic therapy-resistant mouse tumor cells. Cancer Res.. 55: 1820-
1823, 1995.
32. Li, L-J., Li, X., Ferrano, A.. Rucker, N.. Liu, E. S., Wong, S., Gomer, C. J.. and Lee,
A. S. Establishment of a Chinese hamster ovary cell line which expresses grp78
antisense transcripts and suppresses A23187 induction of both GRP78 and GRP94. J.
Cell Physiol., 153: 575-582, 1992.
33. Ferrano. A.. Kessel. D., and Gomer, C. J. Metabolic properties and photosensitizing
responsiveness of mono-L-aspartyl chlorin e6 in a mouse tumor model. Cancer Res..
52: 2890-2893. 1992.
34. Sistonen, L.. Sarge. K. D., and Morimoto. R. I. Human heat shock factors 1 and 2 are
differentially activated and can synergistically induce hsp-70 gene transcription. Mol.
Cell Biol.. 14: 2087-2099. 1994.
35. Liu. R. Y.. Kim, D.. Yang. S-H.. and Li. G. C. Dual control of heat shock response:
involvement of a constitutive heat shock element-binding factor. Proc. Nati. Acad.
Sci. USA, 90: 3078-3082, 1993.
36. Grossweiner, L. I. The Science of Photobiology, p. 43. Boca Raton. FL: CRC Press,
1994.
37. Spikes. J. Chlorins as photosensitizers in biology and medicine. J. Photochem.
Photobiol. B Biol.. 6: 259-274. 1990.
38. Moan. J. On the diffusion length of singlet oxygen in cells and tissue. J. Photochem.
Photobiol. B Biol.. 6: 343-344, 1990.
39. Kessel. D. Use of fluorescent probes for characterizing sites of photodamage. The
Spectrum (Bowling Green State University), 6: 3-5, 1993.
40. Roberts, W, G., Liaw, L-H.. and Berns. M. W. In vitro Photosensitization. An electron
microscopy study of cellular destruction with mono-L-aspartyl chlorin e6 and Pho-
tofnn. Laser Surg. Med.. 9: 102-108. 1989.
41. Kessel. D. Sites of photosensitization by derivatives of hematoporphyrin. Photochem.
Photobiol.. 44: 489-494, 1986.
42. Johnson. L. V.. Walsh. M. L.. and Chen. L. B. Localization of mitochondria in living
cells with rhodamine 123. Proc. Nati. Acad. Sci. USA. 77: 990-994, 1980.
43. Lin, C-W.. Shulok, J. R.. Kirley, S. D.. Cincona, L.. and Foley. J. W. Lysosomal
localization and mechanism of uptake of Nile blue photosensitizers in tumor cells.
Cancer Res., 51: 2710-2719. 1991.
44. Pingar, V. H., Wieman, J.. and Doak, K. W. Role of thromboxane and prostacyclin
release on photodynamic therapy induced tumor destruction. Cancer Res., 50: 2599-
2603. 1990.
45. Jurivivh, D. A.. Sistonen, L.. Sarge. K. D.. and Morimoto, R. I. Arachidonate is a
potent modulator of human heat shock gene transcription. Proc. Nati. Acad. Sci. USA,
91: 2280-2284. 1994.
2360
American Association for Cancer Research Copyright © 1996 on July 14, 2011cancerres.aacrjournals.orgDownloaded from
