Content uploaded by Elisabeth Margaretha Bik
Author content
All content in this area was uploaded by Elisabeth Margaretha Bik
Content may be subject to copyright.
JOURNAL OF CLINICAL MICROBIOLOGY, June 1996, p. 1453–1461 Vol. 34, No. 6
0095-1137/96/$04.0010
Copyright q 1996, American Society for Microbiology
DNA Fingerprinting of Vibrio cholerae Strains with a Novel
Insertion Sequence Element: a Tool To Identify
Epidemic Strains
ELISABETH M. BIK, RICHARD D. GOUW, AND FRITS R. MOOI*
Molecular Microbiology Unit, National Institute of Public Health and the Environment,
3720 BA Bilthoven, The Netherlands
Received 8 December 1995/Returned for modification 22 February 1996/Accepted 14 March 1996
A novel Vibrio cholerae insertion sequence element, designated IS1004, was characterized and used for DNA
fingerprinting of Vibrio spp. IS1004 comprises 628 bp and contains an open reading frame whose product
shows a large degree of sequence identity with the IS200-encoded transposase. IS1004 was present in one to
eight copies in most of the V. cholerae strains analyzed. The IS1004-generated fingerprints of epidemic V.
cholerae strains with serotype O1 were closely related, although it was possible to distinguish between the two
biotypes, classical and El Tor. Non-O1 serotype strains generally showed heterogeneous patterns unrelated to
those of the epidemic O1 strains. Several strains were observed with identical or related fingerprint patterns
but expressed different serotypes. Conversely, strains with different fingerprint patterns but identical serotypes
were also found. These observations indicate that the gene clusters coding for distinct O antigens may be
transferred horizontally between V. cholerae strains. Two examples of non-O1 strains with a fingerprint
resembling that of epidemic O1 strains were found; they were the O139 Bengal strain and an O37 strain. The
O139 Bengal strain is closely related to the El Tor biotype. The O37 strain was responsible for a large cholera
outbreak in Sudan in 1968 and was classified as a noncholera vibrio. Our study, however, shows that the O37
Sudan strain is genetically closely related to classical O1 strains. Similar to O139 Bengal, O37 Sudan lacked
most of the O1 antigen cluster but did contain flanking genes. Thus, O37 Sudan represents a second example
of an epidemic V. cholerae strain carrying non-O1 antigens. This study underlines the importance of genotypic
methods for the differentiation of V. cholerae strains and for the recognition of strains with epidemic potential.
To date, more than 140 Vibrio cholerae serotypes have been
identified, but the three cholera pandemics recorded since
1881 were exclusively caused by strains of serotype O1 (4, 34).
The O1 serotype can be further subdivided into the classical
and El Tor biotypes on the basis of phenotypic differences. The
ongoing pandemic, which started in 1961, is caused by the El
Tor biotype, while strains isolated from the two previous pan-
demics (1881 to 1896 and 1899 to 1923) were of the classical
biotype (4). V. cholerae serotypes other than O1 (usually called
non-O1) are only sporadically pathogenic for humans (25, 33).
Some non-O1 strains, however, produce cholera toxin, and
these strains can cause severe, cholera-like symptoms (20, 25,
26, 31). Until recently, though, non-O1 strains have been as-
sociated only with small outbreaks or isolated cases of intesti-
nal or extraintestinal infections and were regarded to lack
epidemic potential (19, 25, 33). Therefore, it was totally unex-
pected that a large cholera outbreak which started in 1992 in
India and Bangladesh was caused by a non-O1 V. cholerae
strain with serotype O139, with the synonym Bengal (reviewed
in reference 1). The disease had all the characteristics of chol-
era caused by the O1 serotype, and there is now ample evi-
dence that the O139 Bengal strain has evolved from a V.
cholerae O1 El Tor strain by an exchange of genes coding for
synthesis of cell surface polysaccharides (6, 12).
The emergence of the O139 strain illustrates that serotyping
is of limited value for predicting the epidemiological potential
of a strain and underlines the importance of genotypic meth-
ods. Several genotypic approaches to differentiate between V.
cholerae strains, such as multilocus enzyme electrophoresis,
ribotyping, and pulsed-field gel electrophoresis (9, 13, 21, 42),
have been used. Of these techniques, pulsed-field gel electro-
phoresis appears to have the best discriminatory potential.
However, this method is quite laborious and the large number
of bands makes the interpretation of results and comparison
between different laboratories or even different gels difficult.
Another genotypic method which has been applied successfully
for strain differentiation is DNA fingerprinting using insertion
sequence (IS) elements. The restriction fragment length poly-
morphism associated with the presence of multiple IS elements
has been applied successfully for the differentiation of strains
of a variety of bacterial species, but not for V. cholerae. In this
report, we describe a novel V. cholerae IS element and its use
to differentiate between V. cholerae strains by DNA finger-
printing. Using this approach, we identified a second example
of a non-O1 serotype strain with the genetic background of an
epidemic strain.
MATERIALS AND METHODS
Bacterial strains and plasmids. The V. cholerae strains and other Vibrio iso-
lates used in this study are described in Table 1. Escherichia coli DH5a (Gibco
BRL, Gaithersburg, Md.) was used for the cloning of DNA fragments. All
plasmids used in this study are listed in Table 2. The sequences of primers used
in this study are listed in Table 3.
DNA techniques. Chromosomal DNA extraction, digestion, and cloning were
performed as described by Ausubel et al. (3). Restriction endonucleases were
from Boehringer Mannheim. PCR was performed as described by Bik et al. (6).
Southern blotting was done as described by van Soolingen et al. (41). Probes for
Southern blot hybridization were isolated by using Qiaex or Qiaquick DNA
purification kits (Qiagen Inc., Chatsworth, Calif.) and labeled by using the en-
hanced chemiluminescence gene detection system (Amersham International
PLC, Amersham, United Kingdom).
Cloning and sequencing of IS1004. We fortuitously identified a repeated DNA
* Corresponding author. Mailing address: Molecular Microbiology
Unit, National Institute of Public Health and the Environment, P.O.
Box 1, 3720 BA Bilthoven, The Netherlands. Phone: (31)-30-2743091.
Fax: (31)-30-2744414. Electronic mail address: fr.mooi@rivm.nl.
1453
TABLE 1. Vibrio strains used in this study
Strain Biotype Serotype Relevant characteristic(s)
Cholera toxin
production
a
Source and/or
reference
b
Fingerprint
type
V. cholerae
CVD101 Classical O1 Ogawa ctxA mutant of 395, vaccine strain 2 18 C1
395 Classical O1 Ogawa Patient isolate, India 1 10 C1
569B Classical O1 Inaba Patient isolate, 1948, India 1 10 C2
NCTC 8039 Classical O1 Inaba Patient isolate, 1955 1 RIVM C1
C21 Classical O1 Ogawa Patient isolate, 1963, Pakistan 1 17 C1
Cairo 48 Classical O1 Inaba Patient isolate, 1949, Egypt 1 RIVM C1
C5 El Tor O1 Ogawa Patient isolate, 1957, Indonesia 1 17 E1
C30 El Tor O1 Ogawa Patient isolate, 1981, Tunesia 1 RIVM E1
N16961 El Tor O1 Inaba Patient isolate, ,1982, Bangladesh 1 10 E2
35473 El Tor O1 Inaba Patient isolate, 1992, Venezuela 1 INHRR E3
35481 El Tor O1 Inaba Patient isolate, 1992, Venezuela 1 INHRR E3
35518 El Tor O1 Inaba Patient isolate, 1992, Venezuela 1 INHRR E3
35656 El Tor O1 Inaba Patient isolate, 1992, Venezuela 1 INHRR E3
35730 El Tor O1 Inaba Sewage isolate, 1992, Venezuela 1 INHRR E3
35757 El Tor O1 Inaba Sewage isolate, 1992, Venezuela 1 INHRR E3
35759 El Tor O1 Inaba Sewage isolate, 1992, Venezuela 1 INHRR E3
37188 El Tor O1 Inaba Patient isolate, 1992, Venezuela 1 INHRR E3
38068 El Tor O1 Ogawa Patient isolate, 1992, Venezuela 1 INHRR E3
38358 El Tor O1 Ogawa Patient isolate, 1992, Venezuela 1 INHRR E3
38359 El Tor O1 Ogawa Patient isolate, 1992, Venezuela 1 INHRR E3
38578 El Tor O1 Ogawa Patient isolate, 1992, Venezuela 1 INHRR E3
9400377 El Tor O1 Ogawa Patient isolate, 1994, Rwanda 1 RIVM E1
9400378 El Tor O1 Ogawa Patient isolate, 1994, Rwanda 1 RIVM E1
V83 El Tor O1 Patient isolate, 1994, Indonesia 1 AMC E1
CO440 El Tor O1 Patient isolate, 1994, India 1 IMCJ E1
CO443 El Tor O1 Patient isolate, 1994, India 1 IMCJ E1
CO447 El Tor O1 Patient isolate, 1994, India 1 IMCJ E4
CO457 El Tor O1 Patient isolate, 1994, India 1 IMCJ E1
CO458 El Tor O1 Patient isolate, 1994, India 1 IMCJ E4
CO460 El Tor O1 Patient isolate, 1994, India 1 IMCJ E1
CO462 El Tor O1 Patient isolate, 1994, India 1 IMCJ E1
CO471 El Tor O1 Patient isolate, 1994, India 1 IMCJ E1
5188 El Tor O1 Ogawa Patient isolate, 1995, Zaire 1 AMC E1
5189 El Tor O1 Ogawa Patient isolate, 1995, Zaire 1 AMC E1
5190 El Tor O1 Ogawa Patient isolate, 1995, Zaire 1 AMC E1
MO45/ATCC 51394 O139 Patient isolate, 1993, India 1 KU (27) E5
NT552 O139 Patient isolate, 1993, India 1 NICED E5
NT554 O139 Patient isolate, 1993, India 1 NICED E5
NCTC 4711 O2 O reference strain 2 NIHT (34) N1
NCTC 4715 O3 O reference strain 2 NIHT (34) N2
NCTC 4716 O4 O reference strain 2 NIHT (34) N3
B4202-64 O5 O reference strain 2 NIHT (34) N4
7007-62 O6 O reference strain 2 NIHT (34) N5
8394-62 O7 O reference strain 2 NIHT (34) N6
10317-62 O8 O reference strain 2 NIHT (34) N7
112-68 O9 O reference strain 2 NIHT (34) N8
218-68 O10 O reference strain 2 NIHT (34) N9
10843-62 O11 O reference strain 2 NIHT (34) N10
SG2 O60 Patient isolate, 1992–1993, India 2 NICED N11
SG3 O32 Patient isolate, 1992–1993, India 2 NICED N12
SG4 O2 Patient isolate, 1992–1993, India 2 NICED N13
SG6 O45 Patient isolate, 1992–1993, India 2 NICED N14
SG7 O56 Patient isolate, 1992–1993, India 2 NICED —
c
SG8 O37 Patient isolate, 1992–1993, India 2 NICED —
SG10 O69 Patient isolate, 1992–1993, India 2 NICED N15
SG13 O24 Patient isolate, 1992–1993, India 2 NICED N16
SG14 O54 Patient isolate, 1992–1993, India 2 NICED N17
2107-78 Rough Patient isolate, 1978, Bangladesh 1 CDC C1
3176-78 O141 Water isolate, 1978, Georgia 1 CDC N18
609-84 O141 Patient isolate, 1984, New York 1 CDC N19
2454-85 O141 Patient isolate, 1985, Tennessee 1 CDC N19
2466-85 O141 Patient isolate, 1985, North Carolina 1 CDC N19
2533-86 O141 Patient isolate, 1986, California 1 CDC N19
2527-87 O141 Patient isolate, 1987, Maryland 1 CDC N19
E8498 O141 Environmental isolate, 1978, Louisiana 1 CDC N18
S7 O37 Patient isolate, 1968, Sudan 1 CDC (28, 43) C3
Continued on following page
1454 BIK ET AL. J. C
LIN.MICROBIOL.
element when characterizing a TnphoA mutant of V. cholerae CVD101 which was
auxotrophic for d-aminolevulinic acid (32). The region harboring the transposon
in this mutant was cloned from CVD101 and used for Southern blotting. Unex-
pectedly, this region, contained as a 2.0-kb ClaI fragment in pEB1056, hybridized
to multiple chromosomal bands, indicating that it harbored a repetitive DNA
element. The repeat could be mapped to a 300-bp AvaII-ClaI fragment derived
from the insert of pEB1056. This 300-bp fragment was subcloned, and the
resulting plasmid was designated pEB1062. To clone different copies of the
repetitive element, CVD101 chromosomal DNA was digested with HpaII. Frag-
ments of sizes corresponding to fragments hybridizing to pEB1056 were isolated
from an agarose gel by using a Qiaex purification kit (Qiagen), blunted with
Klenow polymerase, and ligated into the SmaI site of pEMBL18. Ligation mix-
tures were transformed into E. coli DH5a and plated onto NZ agar plates with
ampicillin, 5-bromo-4-chloro-3-indolyl-b-
D-galactopyranoside (X-Gal), and iso-
propyl-b-
D-thiogalactopyranoside (IPTG) (3). White colonies were screened on
Hybond-N filters with the enhanced chemiluminescence-labeled insert of
pEB1056 (Amersham International PLC). Twenty hybridizing colonies were
selected, and plasmid DNA of these colonies was isolated. After digestion and
electrophoresis of plasmid DNA, fragments were transferred to Hybond-N
1
membranes (Amersham International PLC) and probed with the insert of
pEB1062. Five plasmids were selected for further analysis. Plasmids pEB1107,
-1109, -1110, -1111, and -1113 contained HpaII inserts of 1,900, 1,500, 2,500,
1,500, and 2,200 bp, respectively. Plasmid pEB1109 and pEB1111 contained
inserts of the same length but comprised different HpaII fragments, as was
concluded by restriction analysis (data not shown). Therefore, the 1,500-bp
HpaII fragment hybridizing to the insert of pEB1062 (see Fig. 1) is a double
band. The insert of pEB1110 overlapped with that of pEB1056. Two internal
ClaI sites in the pEB1110 insert were used to make subclones for sequencing.
TABLE 2. Plasmids used in this study
Plasmid Relevant characteristic(s) Reference
pEMBL18 Cloning vehicle; ampicillin resistance 14
pEB1056 pEMBL18 with 2,040-bp ClaI chromosomal fragment from CVD101 This study
pEB1062 pEMBL18 with 300-bp AvaII-ClaI fragment of pEB1056 insert This study
pEB1107 pEMBL18 with 1,900-bp HpaII chromosomal fragment from CVD101 containing IS1004 copy C This study
pEB1109 pEMBL18 with 1,500-bp HpaII chromosomal fragment from CVD101 containing IS1004 copy B This study
pEB1110 pEMBL18 with 2,500-bp HpaII chromosomal fragment from CVD101 containing IS1004 copy E This study
pEB1111 pEMBL18 with 1,500-bp HpaII chromosomal fragment from CVD101 containing IS1004 copy A This study
pEB1113 pEMBL18 with 2,200-bp HpaII chromosomal fragment from CVD101 containing IS1004 copy D This study
TABLE 1—Continued
Strain Biotype Serotype Relevant characteristic(s)
Cholera toxin
production
a
Source and/or
reference
b
Fingerprint
type
G12R O37 Patient isolate, 1968, Sudan 1 CDC (43, 44) C3
FY2G O8 Patient isolate, Thailand? 1 CDC N20
9300028 Non-O1 Patient isolate, 1993, The
Netherlands
2 RIVM N21
9300031 Non-O1 Patient isolate, 1993, The
Netherlands
2 RIVM N22
9300169 Non-O1 Patient isolate, 1993, The
Netherlands
2 RIVM N23
9300268 Non-O1 Patient isolate, 1993, The
Netherlands
2 RIVM —
9300575 Non-O1 Shrimp isolate, 1993, The
Netherlands
2 RIVM N24
9300576 Non-O1 Shrimp isolate, 1993, The
Netherlands
2 RIVM N24
36328 Non-O1 Sewage isolate, 1992, Venezuela ND
d
INHRR N25
36309 Non-O1 Sewage isolate, 1992, Venezuela ND INHRR N26
40106 Non-O1 Patient isolate, 1993, Venezuela ND INHRR N27
S165 Non-O1/non-O139 Patient isolate, 1995, The
Netherlands
2 RIVM —
Other Vibrio species
ATCC 33653 ND V. mimicus reference strain ND NIHT N28
ATCC 33809 ND V. fluvialis reference strain ND NIHT —
ATCC 33564 ND V. hollisae reference strain ND NIHT —
4750 O2K3 V. parahaemolyticus reference
strain
ND NIHT —
VM-1 UT
e
V. mimicus 2 NICED N29
VM-2 O41 V. mimicus 2 NICED N21
VM-4053 O126 V. mimicus 1 NICED N30
VM-4208 O32 V. mimicus 2 NICED N31
VM-4197 O34 V. mimicus 2 NICED —
a
1, production; 2, lack of production.
b
RIVM, National Institute of Public Health and the Environment, Bilthoven, The Netherlands; INHRR, M. C. de Chaco´n and S. de Waard, Instituto Nacional de
Higiene ‘‘Rafael Rangel,’’ Caracas, Venezuela; AMC, AMC Hospital, Amsterdam, The Netherlands; IMCJ, Y. Takeda and G. B. Nair, International Medical Center
of Japan, Tokyo, Japan; KU, Y. Takeda, Department of Microbiology, Faculty of Microbiology, Kyoto University, Kyoto, Japan; NICED, G. B. Nair and M. K.
Bhattacharya, National Institute of Cholera and Enteric Disease, Calcutta, India; NIHT, T. Shimada and Y. Takeda, National Institute of Health, Tokyo, Japan; CDC,
J. C. Feeley, Centers for Disease Control and Prevention, Atlanta, Ga.
c
—, no hybridization with IS1004 probe.
d
ND, not determined.
e
UT, untypeable.
VOL. 34, 1996 IS1004 FINGERPRINTING OF V. CHOLERAE 1455
Plasmids were purified with Qiagen columns and sequenced with M13 forward
and reversed primers or by dye terminator sequencing (Applied Biosystems) with
primers 9, 10, 72, and 73 (Table 3), which correspond to sequences on the
repetitive element. All sequence reactions were run and analyzed on an auto-
mated DNA sequencer (Applied Biosystems).
Heteroduplex formation. Repetitive sequences in V. cholerae were enriched by
heteroduplex formation (29, 39). Chromosomal DNA (100 mg) of V. cholerae
CVD101 was sheared by 20 passages through a 26-gauge needle and precipitated
with ethanol. The DNA was resuspended in 50 ml of 50% formamide, denatur-
ated by boiling for 10 min, and allowed to renaturate for4hatroom tempera-
ture. Subsequently, S1 nuclease treatment was performed to remove single-
stranded DNA. After ethanol precipitation, the heteroduplex DNA was
dissolved in 50 ml of water. Ten microliters was electrophoresed on an agarose
gel, Southern blotted, and probed with the insert of pEB1062.
Alignment programs. Sequences were compared by using Multalin or FASTA
(30). Alignments of sequences in the EMBL and GenBank databases were
performed by using the BLAST program (2).
Standard procedure for V. cholerae DNA fingerprinting with IS1004. The
DNA fingerprinting procedure was performed essentially as described previously
(40, 41). Chromosomal DNAs of V. cholerae strains were digested with HpaII.
After the inactivation of HpaII by placing the digestion mixtures for 20 min at
658C in DNA sample buffer, a small aliquot was run on an agarose gel to estimate
the concentration. Two milligrams of digested DNA of each strain was mixed
with 2.5 ml of internal marker. This internal marker contained 1 ng of PvuII-
digested supercoiled ladder DNA (BRL) and 0.5 ng of HaeIII-digested fX174
DNA (Boehringer Mannheim) per ml. DNA fragments were separated by over-
night electrophoresis on 0.8% agarose gels. DNA was transferred to Hybond-N
1
membranes (Amersham International PLC) by vacuum blotting, and 2-ml ali-
quots containing both IS1004 DNA and internal marker in 0.4 M NaOH were
spotted on three corners of the filter. Membranes were hybridized with an
enhanced chemiluminescence-labeled 624-bp internal fragment of IS1004, ob-
tained by PCR of pEB1110 DNA with primers 9 and 10 (Table 3). A second
hybridization was performed with labeled internal marker. Because of the pres-
ence of spots on the membrane hybridizing to both probes, films could be
superimposed very precisely.
Computer analysis of DNA fingerprints. DNA banding patterns on films were
imaged by using a Bio-Image Analyzer (Millipore Corporation, Ann Arbor,
Mich.). Fingerprints were analyzed with Gelcompar software (Applied Maths,
Kortrijk, Belgium). By superimposing the autoradiograms obtained after hybrid-
ization with IS1004 and with internal markers of known molecular sizes, the
positions of hybridizing fragments were normalized. Comparison of fingerprints
was performed by the unweighted pair group method using arithmetic averages
(UPGMA) clustering method by using the Dice coefficient according to the
instructions by the manufacturer of Gelcompar.
Nucleotide sequence accession number. The nucleotide sequence of the
IS1004 copy on pEB1003 appears in the EMBL and GenBank databases under
accession number Z67733.
RESULTS
Identification of a repetitive sequence in an O1 classical V.
cholerae strain, CVD101. While characterizing V. cholerae
transposon mutants affected in the synthesis of d-aminolevu-
linic acid (32), we noticed that a V. cholerae DNA fragment
contained in pEB1062 hybridized to multiple (six to seven)
bands on Southern blots, indicating the presence of a repetitive
DNA element (Fig. 1). To determine the size of this element,
we conducted a heteroduplex experiment (29, 39). Chromo-
somal DNA of V. cholerae was denaturated, renaturated, and
treated with S1 nuclease to remove single-stranded DNA.
When a Southern blot of the obtained heteroduplex DNA was
probed with the insert of pEB1062, a 600-bp band hybridized,
defining the approximate size of the repetitive element (Fig. 1).
The DNA sequences of five different copies of the repetitive
element were determined, and comparison of these sequences
allowed us to delineate the element. The element appeared to
comprise 628 bp (Fig. 2A), which corresponded well with the
length estimated from the heteroduplex experiment (see
above). No terminal inverted repeats nor evidence for target
sequence duplication was observed (Fig. 2A). The G1C con-
tent of the element was 41%, which is 6 to 8% lower than that
of the V. cholerae genome (19).
The largest open reading frame contained in the repetitive
element, designated tnpA, encodes a protein of 145 amino
acids, with a predicted pI of 9.99. Database searches revealed
that the tnpA product showed sequence identities with trans-
posases encoded by the IS element IS200, which is found in
several bacterial species (7, 22). The highest degree of identity
(41%) was found with the transposase encoded by IS200 from
Salmonella enterica (Fig. 2B). In addition, we found sequence
similarity between the IS1004-encoded tnpA and an open read-
ing frame located at the end of the hyaluronidase gene of
Streptococcus pneumoniae, suggesting that this sequence is
probably also an IS200-like element (5). IS200 comprises 708
bp and is the smallest IS element known until now (16). Unlike
most IS elements but like the V. cholerae repeat, IS200 does
not contain terminal inverted repeats or give rise to target
DNA duplication (16, 23). On the basis of its similarity to
IS200, we conclude that the V. cholerae repetitive element
described here is an IS element, which we have designated
IS1004.
An incomplete copy of IS1004 is located in the rfb locus of V.
cholerae serotype O1. A nucleotide sequence comparison of
FIG. 1. Southern blot analysis of heteroduplex DNA and restricted chromo-
somal DNA of V. cholerae CVD101. The 300-bp insert of pEB1062 was used as
a probe. The positions and sizes (in kilobases) of marker DNA are indicated on
the left. Lane 1, heteroduplex DNA; lane 2, ClaI digest; lane 3, HindIII digest;
lane 4, HpaII digest; lane 5, PvuI digest.
TABLE 3. Primers used in this study
a
Primer Sequence (59 to 39) Positions of primer
9 ATAAAAATCCGCCTTCTTAG 1–20 of IS1004
10 ATTGTCATCCCTAAACCACC 625–605 of IS1004
72 ATCAACGTCGAAATCGATAC 300–320 of IS1004
73 CATGTCCACTTAGTTGCGAT 340–320 of IS1004
31 GGATAGGGCCATCAAAATAT 55–74 of X59554
78 GAACTTCAAACGTGATTTCG 552–533 of X59554
27 TTTGAAGGATGGCGTTTTA 4273–4291 of X59554
28 TTATTGCTTGAGAATCGCC 7072–7054 of X59554
18 CCAGTATTATTGGCGACTTTT 14031–14033 of X59554
15 TTGGAACATCGACTTATTGAA 14915–14895 of X59554
16 AGATGTAAAAGGCTGCTTGAT 16373–16393 of X59554
17 ACGTTTGAGCTTCCAATTCTT 16767–16747 of X59554
74 ATAGCGATGTGCTGTGAATT 18136–18155 of X59554
75 CACGGAACTTGATGTATGCT 19298–19279 of X59554
76 TCGACGATTTTTACTGGTTC 19515–19534 of X59554
77 CAGGAATTACAAGCGATCAA 20101–20082 of X59554
a
The sequences of primers are based on the IS1004 sequence on pEB1111 or
on the sequence of the V. cholerae O1 rfb cluster (GenBank accession number
X59554) (38).
1456 BIK ET AL. J. CLIN.MICROBIOL.
IS1004 with known V. cholerae sequences in the EMBL and
GenBank databases revealed the presence of an incomplete
IS1004 copy (comprising bases 1 to 190) in the rfb locus of V.
cholerae O1 (24, 38). This region is responsible for the synthe-
sis of the O1 antigen. The IS1004 sequence is located just
upstream of rfbQRS, which is also a putative IS element (24).
Originally, this region was designated rfbP and no homology
between the rfbP product and any known amino acid sequence
was observed (24, 38). However, tnpA is located in another
reading frame than is rfbP, and only the first 22 codons of tnpA
are present in the incomplete IS1004 copy. The incomplete
IS1004 copy is visible as a faint band of 3.5 kb in Southern blots
of HpaII-digested chromosomal DNAs of most V. cholerae O1
strains probed with IS1004. This band is not visible in Fig. 1
because the insert of pEB1062, which was used as a probe,
does not contain the part of IS1004 located in the rfb region.
IS1004-generated fingerprints of epidemic V. cholerae sero-
type O1 and O139 strains. To determine whether IS1004 could
be used to differentiate between epidemic V. cholerae O1
strains, we used it as a probe of HpaII-digested chromosomal
DNAs of V. cholerae O1 strains of classical and El Tor biotypes
isolated in different parts of the world (Table 1). We used the
restriction enzyme HpaII because this yielded the most even
distribution of IS1004-hybridizing fragments of the 14 restric-
tion enzymes tested (results not shown). HpaII does not cleave
within IS1004. V. cholerae O1 strains showed very similar
IS1004 patterns (Fig. 3). All O1 strains tested had IS1004-
containing HpaII fragments of 1,500, 2,200 and 2,500 bp. A
faint band, which in most strains had a size of 3,500 bp, rep-
resented the incomplete copy of IS1004 in the rfb locus (see
above). The fingerprint patterns of classical biotypes differed
from those of El Tor strains in the presence of extra IS1004
copies and in the decreased mobility of the largest HpaII band.
Within the classical and El Tor biotypes, two (C1 and C2) and
four (E1 through E4) fingerprint types, respectively, were
found. Most (5 of 6) of the classical strains revealed IS1004
fingerprint type C1, while E1 was the dominant fingerprint type
found in the El Tor strains (14 of 29 strains) (Fig. 3; Table 1).
All El Tor strains from the Latin American epidemic revealed
the same fingerprint, E3. V. cholerae O139 strains from the
recent epidemic in Asia had pattern E5, which is almost iden-
tical to E1, the pattern observed for most El Tor strains, as
shown before (6). Only the faint band at 3.5 kb, which repre-
sents the incomplete IS1004 copy in the O1 rfb locus, was
lacking (Fig. 3, lane 13). This is in agreement with the obser-
FIG. 2. (A) Alignment of sequences of five cloned copies of IS1004 (copies A through E) and their flanking regions. Sequence identity with IS1004 copy A is
indicated by a dot. IS1004 sequences are separated from flanking regions by spaces. Arrows indicate the positions of the primers, 9 and 10, used for generating a probe
for DNA fingerprinting. (B) Homology between the putative products encoded by IS1004 and IS200 of S. enterica (EMBL and GenBank accession number L25848).
Asterisks and dots represent identical and similar amino acids, respectively. The percent identity between the two sequences is 40.6%.
FIG. 3. IS1004 fingerprints of HpaII-digested chromosomal DNAs of epi-
demic serotype O1 and O139 V. cholerae strains. Lanes 1 to 5, V. cholerae O1
classical biotype strains; lanes 6 to 12, V. cholerae O1 El Tor biotype strains; lane
13, V. cholerae O139 Bengal. The fingerprint type of each strain is indicated
below the lane number. Lane 1, 395; lane 2, 569B; lane 3, NCTC 8039; lane 4,
C21; lane 5, Cairo 48; lane 6, C5; lane 7, C30; lane 8, N16961; lane 9, 35481; lane
10, 9400378; lane 11, V83; lane 12, CO447; lane 13, MO45. The positions and
sizes (in kilobases) of DNA markers are indicated on the left.
VOL. 34, 1996 IS1004 FINGERPRINTING OF V. CHOLERAE 1457
vation that O139 strains contain a large deletion in the O1 rfb
region (6, 24).
IS1004 fingerprint analysis of O1 and non-O1 V. cholerae
and V. mimicus strains. We extended our fingerprint analyses
to include non-O1 and non-O139 V. cholerae strains. These
strains were environmental and patient isolates, some of which
produced cholera toxin (Table 1). Some V. mimicus strains
were also included, as this species is very closely related to V.
cholerae and indistinguishable from V. cholerae by serology. To
be able to compare the banding patterns of different gels,
fingerprints were imaged, normalized, and stored in a data-
base. Computer analysis allowed us to cluster related finger-
prints. All V. cholerae O1 classical and O1 El Tor strains
exhibited very similar IS1004 banding patterns, indicating that
they represent a genetically distinct, closely related group (Fig.
4; Table 1). In contrast, the fingerprints of non-O1 and non-
O139 strains were very polymorphic and, with one notable
exception (see below), unrelated to the banding patterns of
classical and El Tor strains (Fig. 4; Table 1). The number of
IS1004-hybridizing bands ranged from zero to nine. Among 43
non-O1 and non-O139 V. cholerae and V. mimicus strains, 31
fingerprint patterns (types N1 through N31) were distinguished
(Table 1).
Cluster analysis revealed groups of strains with identical or
very similar fingerprints that express different O antigens (Fig.
5A). One such group consisted of V. mimicus O41 VM-2, V.
cholerae O2 NCTC 4711, and strain 9300028, a V. cholerae
non-O1 strain of undefined serotype. O41 and non-O1 strains
revealed identical fingerprint patterns (N21), while the pattern
of the O2 strain (N1) differed by only one band from this
pattern. Another group comprised O139 and O1 El Tor
strains, as described above. The most remarkable observation
was that the fingerprints of two O37 strains, S7 and G12R,
from Sudan were very similar to C1, the predominant pattern
in O1 classical strains, differing by only two bands. Therefore,
the pattern of these O37 strains was named C3. These results
indicate that the O37 and O1 classical strains have a very
similar genetic background but harbor distinct cell wall poly-
saccharide genes. It should be noted that the O37 strains from
Sudan produced cholera toxin and were isolated from an out-
break of diarrheal disease in Sudan (43, 44).
In addition to strains which were genetically closely related
but expressed different serotypes, we also observed the reverse,
i.e., strains from different genetic backgrounds but of identical
serotype (Fig. 5B). For instance, the O37 serotype was ex-
pressed by strains with (S7 and G12R [see above]) and without
(SG8) IS1004. Strain SG8 does not contain the cholera toxin
genes, in contrast to S7 and G12R (Table 1). Other examples
of genetically distinct strains expressing the same serotype in-
clude serotype O2 strains NCTC 4711 and SG4, which dis-
played fingerprint patterns N1 and N13, respectively. Further,
seven O141 strains isolated from different regions in the
United States showed two different fingerprint patterns. Re-
markably, the five O141 patient isolates had the same finger-
print pattern (N19), while the two environmental isolates dis-
played another pattern (N18). The observation that genetically
FIG. 4. Clustering of IS1004 fingerprints of V. cholerae strains obtained in this study. Only one strain of each fingerprint type is shown. Strains which did not show
hybridization with the IS1004 probe were not included in this analysis. The codes on the right give the serotype, strain designation, and fingerprint type of each strain.
The scale measures similarity values.
1458 BIK ET AL. J. CLIN.MICROBIOL.
related strains may express different serotypes is consistent
with the transfer of cell wall polysaccharide genes in V. chol-
erae.
Characterization of serotype O37 strains S7 and G12R from
Sudan. As described above, O37 strains S7 and G12R ap-
peared to be closely related to O1 classical strains. To charac-
terize these strains further, we used fragments obtained by
PCR amplification of the rfb locus of V. cholerae O1 as a probe
on Southern blots with O37 chromosomal DNA (Fig. 6). Three
fragments containing the central parts of the rfb locus, frag-
ments B, C, and D, did not hybridize to chromosomal DNAs of
these O37 strains. Probes A and F, however, comprising rfaD
and orf2-orf3, respectively, showed hybridization to these O37
strains, while probe E showed weak hybridization. These re-
sults indicate that the two O37 strains from Sudan lack the
central part of the O1 rfb region, while the flanking regions are
present.
Occurrence of IS1004 among Vibrio species other than V.
cholerae. When the presence of IS1004 in the genomes of
Vibrio species other than V. cholerae was investigated by South-
ern blot hybridization, only V. mimicus strains hybridized (Ta-
ble 1). V. mimicus is closely related to V. cholerae. The number
of IS1004 copies in the six V. mimicus strains tested varied
from zero to five, and the patterns were as polymorphic as
those found in the V. cholerae non-O1 strains. V. fluvialis, V.
hollisae, and V. parahaemolyticus failed to hybridize (data not
shown).
DISCUSSION
In this study, we characterized a new IS element of V. chol-
erae, designated IS1004, and we investigated its potential to
differentiate V. cholerae strains. IS1004 is 628 bp in size, which
makes it the smallest IS element known, and is closely related
to IS200.IS200 was first discovered in S. enterica (22), but
homologous elements have been identified in E. coli, Shigella
spp., Clostridium perfringens, and Yersinia pestis (7, 8, 15). Like
IS1004,IS200 has no terminal inverted repeats and it does not
give rise to target sequence duplication (16, 23), two properties
frequently associated with other IS elements. IS200 has proved
to be a useful tool for DNA fingerprinting of Salmonella sero-
vars (35–37). This study shows that IS1004 can be applied for
studying the genetic relationships of V. cholerae isolates.
The number of IS1004 copies in the V. cholerae strains stud-
ied varied from zero to eight (Fig. 4; Table 1). In contrast to O1
strains, non-O1 strains displayed very polymorphic patterns,
indicating that the latter form a more heterogeneous group.
This has also been observed by other genotyping methods (13,
20, 25). Further, the fingerprint patterns of the O1 and non-O1
strains were unrelated, with a few notable exceptions (see
below). Our studies revealed that strains displaying the same
serotype are not necessarily genetically related. Among the
relatively small number (49) of non-O1 V. cholerae and other
Vibrio strains investigated, we found three groups of strains of
the same serotype that showed different fingerprint patterns
(Fig. 5B). Conversely, we also encountered identical or closely
related fingerprint patterns for strains expressing different se-
rotypes (Fig. 5A). Although the first observation could be
explained by IS1004 transposition or sequence divergence re-
sulting in the shift of DNA fragments harboring IS1004 copies,
it is less likely an explanation for different serotype isolates
displaying identical or closely related IS1004 patterns. Rather,
our findings indicate that closely related strains may contain
gene clusters coding for different serotypes and that horizontal
FIG. 5. IS1004 fingerprints of strains expressing different O antigens but
displaying identical or related fingerprints (A) and strains of the same serotype
with different fingerprints (B). The positions of molecular weight (in kilobases)
markers are indicated in the middle. The codes above each lane are explained in
the legend to Fig. 4.
FIG. 6. Presence of serotype O1 rfb sequences in serotype O37 strains from Sudan. The O1 rfb sequence was derived from those of Stroeher et al. (38) and Manning
et al. (24) (GenBank accession number X59554). Open arrows indicate genes; small black arrows indicate primers. Fragments were amplified by PCR on chromosomal
DNA of strain C5 with the indicated primer pairs and used as probes on Southern blots of chromosomal DNAs of O37 strains S7 and G12R. 1, 6, and 2, strong, weak,
and no hybridization, respectively.
VOL. 34, 1996 IS1004 FINGERPRINTING OF V. CHOLERAE 1459
transfer of O-antigen-determining genes occurs among V. chol-
erae strains.
The high level of polymorphism in V. cholerae O antigens
suggests diversifying selection. It is not clear what the adaptive
value of this diversity is to V. cholerae in its natural environ-
ment, estuarine systems (11). However, when V. cholerae
strains interact with the immune system, polymorphism in sur-
face antigens is clearly adaptive. This is dramatically illustrated
by the emergence of the O139 Bengal strain. This strain is not
affected by immunity to O1 strains, and it is probably not a
coincidence that it emerged in a region where naturally ac-
quired immunity to O1 strains is high (1).
In contrast to the non-O1 fingerprint patterns, the O1 pat-
terns were closely related. To facilitate further discussion, fin-
gerprint patterns identical or closely related to those of the O1
classical and El Tor strains are hereafter referred to as classical
and El Tor patterns, respectively. Together, the classical and
El Tor patterns are designated epidemic patterns. The simi-
larity of classical and El Tor fingerprint patterns indicates that
the two biotypes are closely related. Not withstanding this
similarity, both biotypes could clearly be distinguished by fin-
gerprinting (Fig. 3). Within the classical and El Tor biotypes,
we observed two (C1 and C2) and four (E1 through E4) fin-
gerprint patterns, respectively. El Tor isolates from the Latin
American epidemic of 1991 and 1992 could be recognized by
their distinct fingerprint pattern (E3). This is in agreement
with other reports which showed that strains from the Latin
American epidemic are different from the current pandemic
strains (i.e., isolates from Asia and Africa) when analyzed by
multilocus enzyme electrophoresis or pulsed-field gel electro-
phoresis (9, 42). Another distinct fingerprint type (E4) was
displayed by two El Tor strains isolated in Calcutta in 1994.
Two non-O1 V. cholerae strains with an epidemic fingerprint
pattern, the O139 Bengal strain (isolates MO45, NT552, and
NT554) and the O37 Sudan strain (isolates S7 and G12R),
were observed. The close genetic relationship between the
Bengal strain and the O1 El Tor strain has been described
previously (6, 12, 24). Serotype O37 isolates S7 and G12R were
isolated from a large outbreak of diarrheal disease in 1968 in
Sudan (43), one of the largest outbreaks caused by a non-O1
strain other than O139 Bengal. Further, it was shown that
strain G12R produced cholera toxin (44) and that pili of O37
strain S7 were immunologically indistinguishable from the 16-
kDa pili of O1 strains (28). Viewed in retrospect, these obser-
vations can be explained by our finding that the O37 strains
from Sudan are genetically closely related to epidemic O1
strains. In 1968, the Sudan strain was classified as a noncholera
vibrio because it did not agglutinate with the O1 serum. This
exemplifies the pitfalls of using phenotypic methods to differ-
entiate V. cholerae strains. IS1004 DNA fingerprinting revealed
that the Sudan strains are actually closely related to the O1
classical lineage. Thus, both El Tor and classical fingerprint
type strains may carry non-O1 antigens. We propose to change
the designations of the G12R and S7 strains to V. cholerae O37
Sudan.
Like the O139 Bengal strain, the O37 Sudan strains lack
most of the O1 rfb cluster (Fig. 6), but they do contain genes
flanking this region. It is conceivable that after horizontal
transfer of cell wall polysaccharide genes between V. cholerae
strains, such conserved flanking regions are used for recombi-
national exchange. Such a mechanism would target the genes
to a particular position in the chromosome and avoid the
presence in a strain of two gene clusters encoding distinct cell
wall polysaccharides. Interestingly, the O37 serotype is also
expressed by a strain unrelated to the epidemic lineages, i.e.,
SG8. The relationship between the O37 Sudan strain and O1
classical strains is unclear. The two lineages may have evolved
from each other directly by exchange of cell wall polysaccha-
ride genes, in which case either one could be the progenitor. It
is also possible that the two lineages have diverged from a
common ancestor with a distinct (non-O1 and non-O37) sero-
type. Seven cholera pandemics have been distinguished; only
strains from the last three have been isolated, and they were
identified as O1 strains. Possibly, older epidemics were caused
by strains with an epidemic genotype expressing non-O1 sero-
types.
The identification of a second non-O1 strain with an epi-
demic genotype clearly demonstrates the usefulness of DNA
fingerprinting in studying the epidemiology of cholera. It is
conceivable that widespread use of this method and other
genotypic methods will identify more such strains and increase
our knowledge of the evolution of epidemic V. cholerae strains.
ACKNOWLEDGMENTS
We thank A. E. Bunschoten for technical assistance. M. K. Bhatta-
charya, M. C. de Chaco´n, J. C. Feeley, G. B. Nair, T. Shimada, Y.
Takeda, and S. de Waard are gratefully acknowledged for providing us
with V. cholerae and other Vibrio strains.
This study received financial support from Dutch Organization for
Scientific Research (NWO) grant 901-15-022.
REFERENCES
1. Albert, M. J. 1994. Vibrio cholerae O139 Bengal. J. Clin. Microbiol. 32:2345–
2349.
2. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990.
Basic local alignment search tool. J. Mol. Biol. 215:403–410.
3. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A.
Smith, and K. Struhl. 1987. Current protocols in molecular biology. John
Wiley and Sons, New York.
4. Barua, D. 1992. History of cholera, p. 1–36. In D. Barua and W. B.
Greenough III (ed.), Cholera. Plenum Publishing Corp., New York.
5. Berry, A. M., R. A. Lock, S. M. Thomas, D. P. Rajan, D. Hansman, and J. C.
Paton. 1994. Cloning and nucleotide sequence of the Streptococcus pneu-
moniae hyaluronidase gene and purification of the enzyme from recombi-
nant Escherichia coli. Infect. Immun. 62:1101–1108.
6. Bik, E. M., A. E. Bunschoten, R. D. Gouw, and F. R. Mooi. 1995. Genesis
of the novel epidemic Vibrio cholerae O139 strain: evidence for horizontal
transfer of genes involved in polysaccharide synthesis. EMBO J. 14:209–
216.
7. Bisercˇic´, M., and H. Ochman. 1993. The ancestry of insertion sequences
common to Escherichia coli and Salmonella typhimurium. J. Bacteriol. 175:
7863–7868.
8. Brynestad, S., L. A. Iwanejko, G. S. A. B. Stewart, and P. E. Granum. 1994.
A complex array of Hpr consensus DNA recognition sequences proximal to
the enterotoxin gene in Clostridium perfringens type A. Microbiology (Read-
ing) 140:97–104.
9. Cameron, D. N., F. M. Khambaty, I. K. Wachsmuth, R. V. Tauxe, and T. J.
Barrett. 1994. Molecular characterization of Vibrio cholerae O1 strains by
pulsed-field gel electrophoresis. J. Clin. Microbiol. 32:1685–1690.
10. Clements, M. L., M. M. Levine, C. R. Young, R. E. Black, Y. L. Lim, R. M.
Robins-Browne, and J. P. Craig. 1982. Magnitude, kinetics, and duration of
vibriocidal antibody responses in North Americans after ingestion of Vibrio
cholerae. J. Infect. Dis. 145:465–473.
11. Colwell, R. R., and A. Huq. 1994. Vibrios in the environment: viable but
nonculturable Vibrio cholerae, p. 117–134. In I. K. Wachsmuth, P. A. Blake,
and Ø. Olsvik (ed.), Vibrio cholerae and cholera: molecular to global per-
spectives. ASM Press, Washington, D.C.
12. Comstock, L. E., D. Maneval, Jr., P. Panigrahi, A. Joseph, M. M. Levine,
J. B. Kaper, J. G. Morris, Jr., and J. A. Johnson. 1995. The capsule and O
antigen in Vibrio cholerae O139 Bengal are associated with a genetic region
not present in Vibrio cholerae O1. Infect. Immun. 63:317–323.
13. Dalsgaard, A., O. Serichantalergs, C. Pitarangsi, and P. Echeverria. 1995.
Molecular characterization and antibiotic susceptibility of Vibrio cholerae
non-O1. Epidemiol. Infect. 114:51–63.
14. Dente, L., M. Sollazo, C. Baldari, G. Cesareni, and R. Cortese. 1985. The
pEMBL family of single-stranded vectors, p. 101–107. In D. M. Glover (ed.),
DNA cloning: a practical approach, vol. I. IRL Press, Oxford.
15. Gibert, I., J. Barbe´, and J. Casadesu´s. 1990. Distribution of insertion se-
quence IS200 in Salmonella and Shigella. J. Gen. Microbiol. 136:2555–2560.
16. Gibert, I., K. Carroll, D. R. Hillyard, J. Barbe´, and J. Casadesu´s. 1991. IS200
is not a member of the IS600 family of insertion sequences. Nucleic Acids
Res. 19:1343.
1460 BIK ET AL. J. CLIN.MICROBIOL.
17. Guine´e, P. A. M., W. J. Jansen, and P. W. J. Peters. 1985. Vibrio cholerae
infection and acquired immunity in an adult rabbit model. Zentralbl. Bak-
teriol. Mikrobiol. Hyg. Ser. A 259:118–131.
18. Kaper, J. B., H. Lockman, M. M. Baldini, and M. M. Levine. 1984. A
recombinant live oral cholera vaccine. Bio/Technology 2:345–349.
19. Kaper, J. B., J. G. Morris, Jr., and M. M. Levine. 1995. Cholera. Clin.
Microbiol. Rev. 8:48–86.
20. Kaper, J. B., J. P. Nataro, N. C. Roberts, R. J. Siebeling, and H. B. Bradford.
1986. Molecular epidemiology of non-O1 Vibrio cholerae and Vibrio mimicus
in the U.S. Gulf Coast region. J. Clin. Microbiol. 23:652–654.
21. Karaolis, D. K. R., R. Lan, and P. R. Reeves. 1994. Molecular evolution of
the seventh-pandemic clone of Vibrio cholerae and its relationship to other
pandemic and epidemic V. cholerae isolates. J. Bacteriol. 176:6199–6206.
22. Lam, S., and J. R. Roth. 1983. IS200: a Salmonella-specific insertion se-
quence. Cell 34:951–960.
23. Lam, S., and J. R. Roth. 1986. Structural and functional studies of insertion
element IS200. J. Mol. Biol. 187:157–167.
24. Manning, P. A., U. H. Stroeher, and R. Morona. 1994. Molecular basis for
O-antigen biosynthesis in Vibrio cholerae O1: Ogawa-Inaba switching, p.
77–94. In I. K. Wachsmuth, P. A. Blake, and Ø. Olsvik (ed.), Vibrio cholerae
and cholera: molecular to global perspectives. ASM Press, Washington, D.C.
25. Morris, J. G., Jr. 1990. Non-O group 1 Vibrio cholerae: a look at the epide-
miology of an occasional pathogen. Epidemiol. Rev. 12:179–191.
26. Mukhopadhyay, A. K., P. K. Saha, S. Garg, S. K. Bhattacharya, T. Shimada,
T. Takeda, Y. Takeda, and G. B. Nair. 1995. Distribution and virulence of
Vibrio cholerae belonging to serogroups other than O1 and O139: a nation-
wide survey. Epidemiol. Infect. 114:65–70.
27. Nair, G. B., T. Shimada, H. Kurazono, J. Okuda, A. Pal, T. Karasawa, T.
Mihara, Y. Uesaka, H. Shirai, S. Garg, P. K. Saha, A. K. Mukhopadhyay, T.
Ohashi, J. Tada, T. Nakayama, S. Fukushima, T. Takeda, and Y. Takeda.
1994. Characterization of phenotypic, serological, and toxigenic traits of
Vibrio cholerae O139 Bengal. J. Clin. Microbiol. 32:2775–2779.
28. Nakasone, N., and M. Iwanaga. 1990. Pili of Vibrio cholerae non-O1. Infect.
Immun. 58:1640–1646.
29. Ohtsubo, H., and E. Ohtsubo. 1977. Repeated DNA sequences in plasmids,
phages, and bacterial chromosomes, p. 49–63. In A. I. Bukhari, J. A. Shapiro,
and S. Adhya (ed.), DNA insertion elements, plasmids and episomes. Cold
Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
30. Pearson, W. R., and D. J. Lipman. 1988. Improved tools for biological
sequence comparison. Proc. Natl. Acad. Sci. USA 85:2444–2448.
31. Ramamurthy, T., P. K. Bag, A. Pal, S. K. Bhattacharya, M. K. Bhattacharya,
T. Shimada, T. Takeda, T. Karasawa, H. Kurazono, Y. Takeda, and G. B.
Nair. 1993. Virulence patterns of Vibrio cholerae non-O1 strains isolated
from hospitalised patients with acute diarrhoea in Calcutta, India. J. Med.
Microbiol. 39:310–317.
32. Rijpkema, S. G. T., E. M. Bik, W. H. Jansen, H. Gielen, L. F. Versluis, A. H.
Stouthamer, P. A. M. Guine´e, and F. R. Mooi. 1992. Construction and
analysis of a Vibrio cholerae d-aminolevulinic acid auxotroph which confers
protective immunity in a rabbit model. Infect. Immun. 60:2188–2193.
33. Sanyal, S. C. 1992. Epidemiology and pathogenicity of non-O1 Vibrio spe-
cies and related organisms, p. 57–67. In D. Barua and W. B. Greenough III
(ed.), Cholera. Plenum Publishing Corp., New York.
34. Shimada, T., E. Arakawa, K. Itoh, T. Okitsu, A. Matsushima, Y. Asai, S.
Yamai, T. Nakazato, G. B. Nair, M. J. Albert, and Y. Takeda. 1994. Extended
serotyping scheme for Vibrio cholerae. Curr. Microbiol. 28:175–178.
35. Soria, G., J. Barbe, and I. Gibert. 1994. Molecular fingerprinting of Salmo-
nella typhimurium by IS200-typing as a tool for epidemiological and evolu-
tionary studies. Microbiologia (Madrid) 10:57–68.
36. Stanley, J., N. Baquar, and E. J. Threlfall. 1993. Genotypes and phylogenetic
relationships of Salmonella typhimurium are defined by molecular finger-
printing of IS200 and 16S rrn loci. J. Gen. Microbiol. 139:1133–1140.
37. Stanley, J., N. Powell, C. Jones, and A. P. Burnens. 1994. A framework for
IS200, 16S rRNA gene and plasmid-profile analysis in Salmonella serogroup
D1. J. Med. Microbiol. 41:112–119.
38. Stroeher, U. H., L. E. Karageorgos, R. Morona, and P. A. Manning. 1992.
Serotype conversion in Vibrio cholerae O1. Proc. Natl. Acad. Sci. USA
89:2566–2570.
39. van der Zee, A., C. Agterberg, M. van Agterveld, M. Peeters, and F. R. Mooi.
1993. Characterization of IS1001, an insertion sequence element of Borde-
tella parapertussis. J. Bacteriol. 75:141–147.
40. van Embden, J. D. A., M. D. Cave, J. T. Crawford, J. W. Dale, K. D.
Eisenach, B. Gicquel, P. Hermans, C. Martin, R. A. McAdam, T. M. Shin-
nick, and P. M. Small. 1993. Strain identification of Mycobacterium tubercu-
losis by DNA fingerprinting: recommendations for a standardized method-
ology. J. Clin. Microbiol. 31:406–409.
41. van Soolingen, D., P. E. W. de Haas, P. W. M. Hermans, and J. D. A. van
Embden. 1994. DNA fingerprinting of Mycobacterium tuberculosis. Methods
Enzymol. 235:196–205.
42. Wachsmuth, I. K., Ø. Olsvik, G. M. Evins, and T. Popovic. 1994. Molecular
epidemiology of cholera, p. 357–370. In I. K. Wachsmuth, P. A. Blake, and
Ø. Olsvik (ed.), Vibrio cholerae and cholera: molecular to global perspectives.
ASM Press, Washington, D.C.
43. World Health Organization. 1969. Outbreak of gastro-enteritis by nonagglu-
tinable (NAG) vibrios. Weekly Epidem. Rec. 44:1–28.
44. Zinnaka, Y., and C. C. J. Carpenter, Jr. 1972. An enterotoxin produced by
noncholera vibrios. Johns Hopkins Med. J. 131:403–411.
VOL. 34, 1996 IS1004 FINGERPRINTING OF V. CHOLERAE 1461
