Available via license: CC BY 4.0
Content may be subject to copyright.
Ligand-dependent Interaction of the Aryl Hydrocarbon Receptor
with a Novel Immunophilin Homolog in Vivo*
(Received for publication, February 19, 1997)
Lucy A. Carver and Christopher A. Bradfield‡
From the McArdle Laboratory for Cancer Research, University of Wisconsin Medical School,
Madison, Wisconsin 53706-1599
In an effort to identify regulators of aryl hydrocarbon
receptor (AHR) signaling, we have employed the yeast
two-hybrid system to screen for human proteins that
interact in a ligand-dependent manner with the AHR.
After screening 1.4 3 10
6
clones from a human B cell
library, two distinct clones were identified that associ-
ated specifically with the liganded receptor. No clones
were identified that interacted preferentially with the
unliganded AHR. One of the ligand-dependent clones,
ARA9, encodes a novel 330-amino acid protein with re-
gions of amino acid sequence similarity to the 52-kDa
FK506-binding protein known to be associated with the
glucocorticoid receptor. Yeast two-hybrid experiments
with ARA9 demonstrated a strong interaction with the
AHR that is enhanced 11-fold in the presence of the
ligand
b
-naphthoflavone. In vitro experiments using
proteins generated in reticulocyte lysates confirmed
this interaction and indicated that ARA9 can be co-im-
munoprecipitated with the AHR using antisera raised
specifically for either the AHR or the 90-kDa heat shock
protein. The observation that ARA9 has a high affinity
for both the 90-kDa heat shock protein-associated and
ligand-activated forms of the AHR suggests that ARA9 is
a component of the AHR-signaling pathway in vivo.
The AHR
1
is a ligand-activated transcription factor that
regulates the expression of xenobiotic metabolizing enzymes in
response to binding environmental pollutants such as 2,3,7,8-
tetrachlorodibenzo-p-dioxin (1). The AHR is a member of the
Per-ARNT-Sim homology domain superfamily of regulatory
proteins that also includes the AHR’s dimer partner, ARNT,
and such proteins as HIF1
a
and Sim (reviewed in Ref. 2).
Members of this family are distinguished by a region of simi-
larity of approximately 200 amino acids termed PAS (3). In the
AHR this domain is involved in dimerization with other PAS-
containing proteins, ligand binding, and association with hsp90
(4–6). Most members of this superfamily also contain a basic
helix-loop-helix domain immediately N-terminal to the PAS
region (2). The basic domain mediates the recognition and
binding of these factors to specific DNA sequences in enhancer
elements that regulate transcription of target genes (6, 7). The
helix-loop-helix domain functions as a primary dimerization
surface that directs interactions with appropriate dimeric
partners (8, 9).
Although no obvious structural relationship is apparent, the
AHR and certain members of the steroid receptor superfamily
exhibit similarities in their signaling mechanism (10, 11). Bio-
chemical studies have indicated that the unliganded AHR and
the GR are located in the cytosol in a complex with a dimer of
the molecular chaperone hsp90 and other cellular proteins
(12–14). hsp90 has been shown to be an important regulator of
receptor activity. Genetic studies in yeast systems deficient in
hsp90 have demonstrated an absolute requirement for hsp90 in
both glucocorticoid and AHR signaling (10, 11, 15). Biochemical
studies have correlated the association of hsp90 with an in-
crease in ligand binding capacity, and dissociation of hsp90 has
been correlated with an increase in DNA binding capacity
(16–19). Finally, current models of signaling for the GR and
AHR are quite similar. In response to ligand binding in the
cytosol, receptor-hsp90 complexes translocate to the nucleus
where hsp90 dissociates and the activated GR homodimerizes
or the AHR heterodimerizes with ARNT. The resulting com-
plexes attain binding specificity for their cognate enhancer
elements to regulate transcription of specific batteries of genes.
In addition to hsp90, a number of other intracellular proteins
appear to play a role in GR signaling. The GR has been shown
to exist in a complex with two other heat-inducible proteins,
hsp70 and FKBP52 (20). hsp70 binds to the hormone binding
domain of the GR and may be required for hsp90 to bind to the
receptor (21). FKBP52 is an immunophilin of the FK506 bind-
ing class that binds directly to hsp90 in the non-liganded re-
ceptor heat shock protein complex and may play a role in
targeted protein movement (20–24). Other proteins that have
been recovered in native steroid receptor complexes bound to
hsp90 include a highly acidic 23-kDa protein and an immu-
nophilin of the cyclosporin A binding class known as Cyp-40 of
unknown function (20).
In contrast to GR, less is known about the composition of the
cytosolic and ligand-activated forms of the AHR. Chemical
cross-linking experiments have revealed the presence of a 46-
kDa protein of unknown function in the AHR cytosolic complex
(25–27). Purification of ligand-activated AHR complexes using
DNA affinity chromatography has indicated that the DNA-
bound form of the AHR is found associated with ARNT and a
number of unknown proteins including those with apparent
molecular masses of 110, 57, and 54 kDa (28, 29). In an effort
to identify additional proteins that are part of the AHR complex
or that may regulate its activity, we used the yeast two-hybrid
* This work was supported by National Institutes of Health Grants
P30-CA07175 and ES05703 and The Burroughs Wellcome Foundation.
The costs of publication of this article were defrayed in part by the
payment of page charges. This article must therefore be hereby marked
“advertisement” in accordance with 18 U.S.C. Section 1734 solely to
indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted
to the GenBank
TM
/EBI Data Bank with accession number(s) U78521.
‡ To whom correspondence should be addressed: McArdle Laboratory
for Cancer Research, 1400 University Ave., Madison, WI 53706-1599.
Tel.: 608-262-2024; Fax: 608-262-2824; E-mail: bradfield@oncology.
wisc.edu.
1
The abbreviations used are: AHR, aryl hydrocarbon receptor; PAS,
Per-ARNT-Sim homology domain; ARNT, AHR nuclear translocator;
GR, glucocorticoid receptor; hsp90, 90-kDa heat shock protein; hsp70,
70-kDa heat shock protein; FKBP52, 52-kDa FK506-binding protein;
FKBP12, 12-kDa FK506-binding protein;
b
NF,
b
-naphthoflavone; TAD,
transcriptional activation domain; TPR, tetratricopeptide repeat;
hsp56, 56-kDa heat shock protein.
THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 272, No. 17, Issue of April 25, pp. 11452–11456, 1997
© 1997 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A.
This paper is available on line at http://www-jbc.stanford.edu/jbc/11452
by guest on December 25, 2015http://www.jbc.org/Downloaded from
system to screen for proteins that associate with the AHR in a
ligand-dependent manner in vivo and then confirmed these
interactions by co-immunoprecipitation assays in vitro.Were-
port here the isolation of a cDNA clone encoding a protein
whose interaction with the AHR in vivo is detected only in the
presence of ligand and with sequence similarity to the FKBP52
protein found associated with the GR.
MATERIALS AND METHODS
The oligonucleotide sequences are: OL176, CGGGATCCTTACACA-
TTGGTGTTGGTACAGATGATGTAGTC; and OL226, CGGGATC-
CTCATGGCGGCGACTACTGCCAACC.
Strains and Plasmids—Saccharomyces cerevisiae strain L40 (MAT a,
his3D200, trp1–901, leu2–3, 112, ade2, LYS2::(lexAop)
4
-HIS3,
URA3::(lexAop)
8
-lacZ, gal80) was used for two-hybrid screens and inter-
action assays (30). Plasmid pBTM116 is a 2-
m
m TRP-marked plasmid
containing the full-length Escherichia coli LexA protein under the control
of the ADH1 promoter for expressing LexA fusion proteins (31). pGAD424
isa2-
m
mLEU-marked plasmid for making fusions with the GAL4 tran-
scriptional activation domain (32). Plasmid pBTMAHRDTAD contains the
murine AHR lacking amino acids 494–640 fused in frame to the full-
length E. coli LexA protein (33). pBTMARNTCD325 was constructed by
amplifying amino acids 1–464 from pSPORTARNT (4) with the primers
OL176 and OL226 using standard polymerase chain reaction protocols as
described (10). The amplified fragment was ligated into the vector
pGEM-T (Promega, Madison, WI). The resulting plasmid pGE-
MARNTCD325 was digested with BamHI, and the insert was subcloned
into the BamHI site of pBTM116.
Transformations and Library Screening—Transformation of plas-
mids into the strain L40 was performed by a modified lithium acetate
protocol as described (10, 34). For library screening, the transformants
were replica-plated after 4 days to fresh plates of the same media and
incubated for 2 days. The colonies were again replica-plated to fresh
plates that contained either no agonist or 1
m
M
b
NF, then incubated at
30 °C for 2 days, and assayed for lacZ expression as described (35).
Northern Blot Analysis—Fifty nanograms of ARA9 and 25 ng of actin
cDNA were random-primed and used as a probe to hybridize human
multiple tissue and human immune system Northern blots (CLON-
TECH, Palo Alto, CA) as described (33).
Quantitative
b
-Galactosidase Assays—S. cerevisiae strain L40 was
transformed with the appropriate plasmids and plated on selective
media either treated by spreading 100
m
lof1mM
b
NF over the surface
(78.5 cm
2
) of the medium or left untreated. The plates were incubated
for 4 days at 30 °C. For each assay, three colonies were suspended in
100
m
l of buffer Z (60 mM Na
2
HPO
4
,40mMNaH
2
PO
4
,10mMKCl, 1 mM
MgSO
4
,35mM2-mercaptoethanol). Five microliters of the cell suspen-
sion were diluted in 170
m
l of buffer Z, and the A
600
was measured to
estimate cell density. The remaining cell suspension was pelleted by
centrifugation, and
b
-galactosidase activity was determined by a chemi-
luminescent reporter assay protocol (Galacto-light, Tropix, Bedford,
MA). Light units were divided by the A
600
to normalize values to cell
density.
Co-immunoprecipitation Assay—AHR, ARNT, and ARA9 were ex-
pressed in vitro using the TNT-coupled rabbit reticulocyte lysate (Pro-
mega) using the plasmids pSportAHR, pSportARNT, and PL580 as
templates, respectively (4). In our hands, this expression system typi-
cally produces about 10 fmol of
35
S-labeled translated protein per 50
m
l
of reaction mixture (4). Associations were formed by mixing 5
m
lofthe
appropriate in vitro translated proteins in a 1.5-ml microcentrifuge
tube, and co-immunoprecipitations were performed as described previ-
ously (33). For co-immunoprecipitations using the AHR, 0.1
m
lof1mM
b
NF or Me
2
SO was first added to the reaction and incubated for2hat
30 °C.
RESULTS AND DISCUSSION
Two-hybrid Assay Screening Strategy—To identify novel fac-
tors involved in AHR signaling, we designed a two-hybrid assay
that would detect proteins that interact with the AHR in a
ligand-dependent manner. A plasmid containing a LexA-AHR
fusion that had a deletion in the transcriptional activation
domain (LexA-AHRDTAD (36)) was used to screen a human B
lymphocyte cDNA library that was fused to the GAL4 tran-
scriptional activation domain (6, 37). The transformants were
plated on selective media containing 1
m
M AHR agonist
b
NF or
onto untreated plates. The surviving colonies from each group
were twice replica-plated onto agonist and nonagonist plates
and assayed for both histidine prototrophy and lacZ expression
exclusively under either agonist or nonagonist conditions.
700,000 clones were screened under each condition. No clones
were identified that interacted preferentially with the unligan-
ded AHR. However, we isolated 13 positive colonies that inter-
acted with AHR in a ligand-dependent manner. Ten of these
clones retained ligand-dependent interactions with the LexA-
AHRDTAD construct upon secondary screening against the
unrelated protein, lamin (38). Sequence analysis revealed that
five clones represented a distinct cDNA of 2.2 kilobase pairs,
designated ARA3 (for Ah receptor-activated), and the remain-
ing five clones represented a second cDNA of 1.03 kilobase
pairs that was designated ARA9. In this paper, we describe the
characterization of the ARA9 cDNA.
Analysis of the ARA9 cDNA—The original ARA9 clone,
pbARA9, contained an open reading frame of 325 amino acids
and lacked a Kozak consensus methionine (39). To obtain ad-
ditional upstream sequence information, expressed sequence
tags were identified by a BLAST search of the GenBanky data
base (33). Three of the corresponding cDNAs were obtained
from the IMAGE consortium at Washington University and
subjected to sequence analysis. One of the expressed sequence
tag clones, PL580 (GenBank accession number R50134), con-
tained the entire ARA9 sequence as well as additional 39-
untranslated sequences, a poly(A) tail, and an additional 131
nucleotides at the 59 end for a total of 1244 nucleotides (Fig.
1A). This clone also contained a Kozak methionine with an
upstream in-frame stop codon at position 299 (39). The ARA9
mRNA is approximately 1.35 kilobases in length and is ex-
pressed in all tissues examined with higher levels of expression
in heart, placenta, and skeletal muscle (Fig. 2).
The DNA and deduced amino acid sequence of ARA9 is
shown in Fig. 1A. It contains an open reading frame encoding a
novel protein of 330 amino acids followed by a short 39-untrans-
lated region ending in a polyadenylation sequence. The de-
duced amino acid sequence has a predicted molecular weight of
38, which is consistent with the estimated molecular mass of 37
kDa as determined from the electrophoretic mobility of in vitro
translated ARA9 on SDS-polyacrylamide gel electrophoresis
(Fig. 4). The N-terminal portion of ARA9 contains a region of 79
amino acids, which is 30% identical to a region in FKBP52 and
28% identical to FKBP12. A second region of 11 amino acids is
63% identical to a region in FKBP12 (Fig. 1B). The C terminus
harbors three regions among residues 182–215, 234–267, and
268–301 that conform to the consensus TPR domain and are
21, 24, and 47%, respectively, identical to TPR domains found
within FKBP52. TPR domains are highly degenerate 34-amino
acid sequences containing two regions able to form short am-
phipathic
a
-helices that are thought to mediate protein-protein
interactions in a number of proteins (40, 41). These domains
have been identified in many proteins involved in such diverse
functions as cell division in yeast, protein import, and Drosoph-
ila development (42).
Interaction of the AHR and ARNT with ARA9—To obtain
quantitative data describing the ligand-dependent interaction
of the AHR with ARA9 and to determine whether ARA9 inter-
acts with the structurally related AHR dimeric partner, ARNT,
LexA fusions of AHRDTAD or ARNTCD325 were co-trans-
formed with pbARA9 into the strain L40, plated on selective
media, and
b
-galactosidase activity measured as an indication
of the relative strength of the interactions in the presence or
absence of
b
NF (for AHRDTAD). In the presence of ARA9,
induction of
b
-galactosidase expression was increased 25-fold
over control in the absence of agonist, and this interaction is
enhanced approximately 11-fold in the presence of
b
NF. These
AHR-associated Protein 11453
by guest on December 25, 2015http://www.jbc.org/Downloaded from
experiments demonstrate that ARA9 interacts with the AHR in
a conditional manner (Fig. 3). Co-transformation of Lex-
AARNTCD325 with ARA9 only weakly induced
b
-galactosidase
activity (2.7-fold over control) suggesting that ARNT may not
associate with ARA9 in vivo or that this interaction is much
weaker than that with AHR (Fig. 3).
To further characterize the interactions of ARA9 with the
AHR and ARNT, co-immunoprecipitation assays were per-
formed using full-length in vitro translated AHR, ARNT, and
35
S-labeled full-length ARA9. Using AHR antisera,
35
S-labeled
ARA9 could be co-precipitated with the AHR both in the pres-
ence and absence of ligand (Fig. 4, lanes 2–5). We also asked
whether ARA9 was a component of the AHRzhsp90 complex.
The AHRzARA9 complex was detected using anti-hsp90 anti-
sera, indicating that ARA9 is present in AHRzhsp90 complexes
(Fig. 4, lanes 6–9). However, ARA9 could not be co-precipitated
with hsp90 in the absence of AHR (Fig. 4, lanes 10 and 11).
These results suggest that either ARA9 binds to the AHR
FIG.1.ARA9 sequence and compar-
ison to FKBP52 and FKBP12. A, nucle-
otide sequence and deduced amino acid
sequence of human ARA9 cDNA is shown.
Numbers to the left indicate nucleotide
numbering with the initiation ATG as 11.
Numbers to the right indicate amino acid
numbering. The asterisk designates posi-
tion of the stop codon. The underlined
sequence indicates the regions similar to
FKBP12. Double-underlined sequences
indicate the TPR domains. B, comparison
of ARA9, FKBP52, and FKBP12 is shown.
The amino acid sequences are aligned by
the first position of the FKBP12 homology
domain I in FKBP52. The shaded regions
indicate regions of homology to FKBP12.
The hatched regions denote the positions
of the TPR domains. The numerals I and
II indicate the FKBP12-like domains of
FKBP52. Percent identity to ARA9 is
shown below each protein.
AHR-associated Protein11454
by guest on December 25, 2015http://www.jbc.org/Downloaded from
directly or that stable or high affinity association with hsp90 is
AHR-dependent.
The observation that ARA9-AHR interactions are ligand-de-
pendent in vivo and ligand-independent in vitro suggests that
ARA9 constitutively associates with the AHR regardless of the
ligand binding status of the receptor, and that the apparent
ligand dependence of the complex in vivo reflects the change in
subcellular localization from the cytosol to the nucleus where it
is able to activate transcription. This observation also suggests
that the ARA9-AHR interaction occurs at multiple stages of the
signaling pathway and that the ligand dependence of the two-
hybrid assay is a reflection of the fact that the interaction can
be maintained during nuclear translocation, hsp90 association/
dissociation, dimerization, and DNA binding of the LexA-
AHRDTAD chimera. The negative co-immunoprecipitation
data with ARA9 and ARNT (Fig. 4, lanes 12 and 13) supports
the in vivo experiments which demonstrated a weak interac-
tion between ARA9 and ARNT and indicate that ARA9 may
have marked restrictions in the number of proteins with which
it can interact. With this in mind, it is interesting to point out
that our preliminary two-hybrid data suggest that ARA9 does
not interact with GR (data not shown).
ARA9 is a candidate for the previously described 43-kDa
subunit of the AHR-cytosolic complex (26). Chemical cross-
linking experiments using murine Hepa1c1c7 cytosol have
shown that the AHR-cytosolic complex exists as a heterotet-
ramer (25, 26). One of these subunits is the AHR, two others
have been identified as a hsp90 dimer, and the fourth is an
unidentified 43-kDa subunit (26). In a previously reported
study, a heteromeric intermediate of 146 kDa was isolated
using immunoabsorbed anti-AHR antibody and was postulated
to contain the 97-kDa AHR plus the 43-kDa-associated protein
suggesting that this factor may be directly associated with the
AHR (25, 26). Additionally, the 43-kDa subunit was shown not
to be stably associated with cytosolic-hsp90 complexes in
Hepa1c1c7 extracts (43). These findings are in agreement with
the data presented here in which ARA9, a human protein of
similar size to p43, appears to directly interact with the AHR,
but not with cytosolic hsp90 in the absence of receptor.
In overall structure, ARA9 is related to FKBP52, also known
in the literature as p59 and hsp56 (reviewed in Ref. 20) (Fig.
1B). FKBP52 is one of several chaperone proteins found in the
untransformed GR heterocomplex and has an overall length of
459 amino acids (20). It binds directly to hsp90 in the heat
shock complex through three TPR units located within the
C-terminal half of the protein (44, 45). FKBP52 also contains
two FKBP12-like domains termed I and II. Although the func-
tion of domain II is unknown, domain I has high identity (49%)
with FKBP12 and has been shown to exhibit peptidylprolyl
isomerase activity and bind to the immunosuppressants FK506
and rapamycin (44, 46). The biological significance of this ac-
tivity is unclear since blocking the peptidylprolyl isomerase
activity with FK506 does not affect the cytosolic heterocomplex
assembly or proper folding of the GR into a high affinity ligand
binding conformation (47). Furthermore, FKBP52 does not ap-
pear to be necessary for GRzhsp90 heterocomplex assembly
(48). Recent experiments, however, have indicated that it may
play a role in receptor translocation to the nucleus upon acti-
vation by ligand (23, 24).
In contrast to FKBP52, ARA9 is a smaller protein (330 amino
acids) and has only one FKBP12-like domain with weaker
identity to FKBP12 (28%) and three TPR domains in the C
terminus. It has yet to be established if ARA9 exhibits FK506
FIG.2.Northern blot analysis of ARA9. Each lane contains 2
m
gof
poly(A)
1
mRNA from the indicated human tissue. The blot was probed
with a random-primed probe to ARA9. The ARA9-hybridized blots were
exposed to film at 280 °C with intensifier screens for either 2 days (left
panel) or 5 days (right panel, immune system tissues). The blots were
reprobed with actin to control for loading (data not shown).
FIG.3. In vivo interaction of ARA9 with AHR and ARNT.
pbARA9 was co-transformed into S. cerevisiae with a LexA fusion of
either AHRDTAD or ARNTCD325 and assayed for interaction with
ARA9 in the presence or absence of ligand. As a control, the AHRDTAD
and ARNTCD325 LexA fusions were transformed into the strain L40
with an empty GAL4 activation domain vector to measure base-line
b
-galactosidase activity in the absence of ARA9 expression. Each bar
represents the average of three independent experiments.
b
-Galacto-
sidase expression was measured and normalized to the number of cells
assayed.
FIG.4.In vitro interaction of ARA9 with AHR and ARNT. Five
microliters of in vitro translated [
35
S]methionine-labeled ARA9 was
incubated with either AHR (lanes 2–9), reticulocyte lysate (lanes 10 and
11), or ARNT (lanes 12 and 13) in the presence (lanes 2, 3, 6, and 7)or
absence (lanes 4, 5, and 8–13)of10
m
M
b
NF and precipitated with
Bear1 (anti-AHR antibody) (lanes 2 and 4), anti-hsp90 antibody (lanes
6, 8, and 10), R3611-1b (anti-ARNT antibody) (lane 12), or preimmune
antisera (lanes 3, 5, 7, 9, 11, and 13).Lane 1 contains 5
m
lofin vitro
translated
35
S-labeled ARA9. Proteins bound to the washed protein
A-Sepharose beads were fractionated by SDS-polyacrylamide gel elec-
trophoresis and visualized by autoradiography. The arrow indicates the
position of the labeled ARA9 protein.
AHR-associated Protein 11455
by guest on December 25, 2015http://www.jbc.org/Downloaded from
binding and peptidylprolyl isomerase activity and how this
may affect receptor function. One important difference between
ARA9 and FKBP52 is that while FKBP52 has been found to be
associated with hsp90 through chemical cross-linking and co-
immunoprecipitation experiments, ARA9 does not appear to
stably interact with hsp90 in the absence of AHR. Possible
explanations for this difference in hsp90 binding affinity in the
absence of AHR may be that 1) all TPR domains do not form
equally tight interactions with hsp90, 2) the affinity of the
ARA9-hsp90 association may be below the limit of detection in
our assay, and 3) the hsp90 antibodies used in our experiments
may recognize hsp90 complexes different from those used to
co-precipitate hsp90-FKBP52 complexes (i.e. our hsp90 anti-
bodies may not be able to recognize hsp90zARA9 complexes). In
any case, while ARA9 appears to be in the same class structur-
ally as FKBP52 and although both proteins associate with
nuclear receptors, their roles in receptor signaling may be
distinct.
Because of its stable, ligand-dependent interaction with
AHR, ARA9 is likely to have an important role in receptor
function. If ARA9 and p43 are the same protein and ARA9 does
indeed form part of the AHR cytosolic complex it may associate
with the AHR complex and function along with hsp90 in the
folding and stabilization of the receptor in an inactive form.
Alternatively, since ARA9 also appears to interact with the
AHR as part of a DNA-binding complex, it is possible that
ARA9 functions as a co-activator forming a bridge between the
receptor and basal transcription factors similar to the way that
steroid receptor co-activators such as SRC-1 and Trip1 are
thought to function (49, 50). Given its structural similarity
with FKBP52, it is possible that ARA9 may have a similar role
in AHR signaling possibly acting as a targeting molecule to
direct receptor trafficking to the nucleus. Finally, we cannot
rule out the possibility that ARA9 has a function unrelated to
AHR signaling and that this function is dependent upon asso-
ciation with AHR.
Acknowledgments—We thank Stanley Hollenberg for the S. cerevi-
siae strain L40 and the plasmid pBTM116, Stephen Elledge for the B
cell library, and Alan Poland for the Bear1 AHR antibody and the hsp90
antibody.
REFERENCES
1. Poland, A., and Knutson, J. C. (1982) Annu. Rev. Pharmacol. Toxicol. 22,
517–554
2. Schmidt, J. V., and Bradfield, C. A. (1996) Annu. Rev. Cell Dev. Biol. 12, 55–89
3. Nambu, J. R., Lewis, J. O., Wharton, K. A., Jr., and Crews, S. T. (1991) Cell 67,
1157–1167
4. Dolwick, K. M., Swanson, H. I., and Bradfield, C. A. (1993) Proc. Natl. Acad.
Sci. U. S. A. 90, 8566–8570
5. Whitelaw, M. L., Gottlicher, M., Gustafsson, J. A., and Poellinger, L. (1993)
EMBO J. 12, 4169–4179
6. Fukunaga, B. N., Probst, M. R., Reisz-Porszasz, S., and Hankinson, O. (1995)
J. Biol. Chem. 270, 29270–29278
7. Durrin, L. K., and Whitlock, J. P., Jr. (1987) Mol. Cell. Biol. 7, 3008 –3011
8. Murre, C., McCaw, P. S., and Baltimore, D. (1989) Cell 56, 777–783
9. Huang, Z. J., Edery, I., and Rosbash, M. (1993) Nature 364, 259–262
10. Carver, L. A., Jackiw, V., and Bradfield, C. A. (1994) J. Biol. Chem. 269,
30109–30112
11. Whitelaw, M. L., McGuire, J., Picard, D., Gustafsson, J. A., and Poellinger, L.
(1995) Proc. Natl. Acad. Sci. U. S. A. 92, 4437–4441
12. Perdew, G. H. (1988) J. Biol. Chem. 263, 13802–13805
13. Denis, M., Cuthill, S., Wikstrom, A. C., Poellinger, L., and Gustafsson, J. A.
(1988) Biochem. Biophys. Res. Commun. 155, 801–807
14. Sanchez, E. R., Toft, D. O., Schlesinger, M. J., and Pratt, W. B. (1985) J. Biol.
Chem. 260, 12398–12401
15. Picard, D., Khursheed, B., Garabedian, M. J., Fortin, M. G., Lindquist, S., and
Yamamoto, K. R. (1990) Nature 348, 166–168
16. Pongratz, I., Mason, G. G. F., and Poellinger, L. (1992) J. Biol. Chem. 267,
13728–13734
17. Wilhelmsson, A., Cuthill, S., Denis, M., Wikstrom, A. C., Gustafsson, J. A., and
Poellinger, L. (1990) EMBO J. 9, 69–76
18. Hutchison, K. A., Czar, M. J., and Pratt, W. B. (1992) J. Biol. Chem. 267,
3190–3195
19. Sanchez, E. R., Meshinchi, S., Tienrungroj, W., Schlesinger, M. J., Toft, D. O.,
and Pratt, W. B. (1987) J. Biol. Chem. 262, 6986–6991
20. Pratt, W. B. (1993) J. Biol. Chem. 268, 21455–21458
21. Hutchison, K. A., Dittmar, K. D., Czar, M. J., and Pratt, W. B. (1994) J. Biol.
Chem. 269, 5043–5049
22. Renoir, J. M., Radanyi, C., Faber, L. E., and Baulieu, E. E. (1990) J. Biol.
Chem. 265, 10740–10745
23. Czar, M. J., Owens-Grillo, J. K., Yem, A. W., Leach, K. L., Deibel, M. R., Welsh,
M. J., and Pratt, W. B. (1994) Mol. Endocrinol. 8, 1731–1741
24. Czar, M. J., Lyons, R. H., Welsh, M. J., Renoir, J. M., and Pratt, W. B. (1995)
Mol. Endocrinol. 9, 1549–1560
25. Perdew, G. H. (1992) Biochem. Biophys. Res. Commun. 182, 55–62
26. Chen, H. S., and Perdew, G. H. (1994) J. Biol. Chem. 269, 27554–27558
27. Hossain, A., Kikuchi, H., Ikawa, S., Sagami, I., and Watanabe, M. (1995)
Biochem. Biophys. Res. Commun. 215, 405–411
28. Elferink, C. J., and Whitlock, J. P., Jr. (1994) Receptor 4, 157–173
29. Ireland, R. C., Li, S. Y., and Dougherty, J. J. (1995) Arch. Biochem. Biophys.
319, 470–480
30. Vojtek, A. B., Hollenberg, S. M., and Cooper, J. A. (1993) Cell 74, 205–214
31. Bartel, P. L., Chien, C., Sternglanz, R., and Fields, S. (1993) in Cellular
Interactions in Development: A Practical Approach (Hartley, D. A., ed) pp.
153–179, IRL Press, Oxford
32. Chien, C., Bartel, P. L., Sternglanz, R., and Fields, S. (1991) Proc. Natl. Acad.
Sci. U. S. A. 88, 9578–9582
33. Hogenesch, J. B., Chan, W. C., Jackiw, V. H., Brown, R. C., Gu, Y.-Z., Perdew,
G. H., and Bradfield, C. A. (1997) J. Biol. Chem. 272, 8581–8593
34. Schiestl, R. H., and Giest, R. D. (1989) Curr. Genet. 16, 339–346
35. Bohen, S. P., and Yamamoto, K. R. (1993) Proc. Natl. Acad. Sci. U. S. A. 90,
11424–11428
36. Jain, S., Dolwick, K. M., Schmidt, J. V., and Bradfield, C. A. (1994) J. Biol.
Chem. 269, 31518–31524
37. Durfee, T., Becherer, K., Chen, P. L., Yeh, S. H., Yang, Y., Kilburn, A. E., Lee,
W. H., and Elledge, S. J. (1993) Genes Dev. 7, 555–569
38. Bartel, P., Chien, C. T., Sternglanz, R., and Fields, S. (1993) BioTechniques 14,
920–924
39. Kozak, M. (1987) Nucleic Acids Res. 15, 8125–8132
40. Sikorski, R. S., Boguski, M. S., Goebl, M., and Hieter, P. (1990) Cell 60,
307–317
41. Hirano, T., Kinoshita, N., Morikawa, K., and Yanagida, M. (1990) Cell 60,
319–328
42. Goebl, M., and Yanagida, M. (1991) Trends Biochem. Sci. 16, 173–177
43. Perdew, G. H., and Whitelaw, M. L. (1991) J. Biol. Chem. 266, 6708–6713
44. Callebaut, I., Renoir, J. M., Lebeau, M. C., Massol, N., Burny, A., Baulieu, E.
E., and Mornon, J. P. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 6270–6274
45. Radanyi, C., Chambraud, B., and Baulieu, E. E. (1994) Proc. Natl. Acad. Sci.
U. S. A. 91, 11197–11201
46. Chambraud, B., Rouviere-Fourmy, N., Radanyi, C., Hsiao, K., Peattie, D. A.,
Livingston, D. J., and Baulieu, E. E. (1993) Biochem. Biophys. Res.
Commun. 196, 160–166
47. Hutchison, K. A., Scherrer, L. C., Czar, M. J., Ning, Y., Sanchez, E. R., Leach,
K. L., Deibel, M. R., and Pratt, W. B. (1993) Biochemistry 32, 3953–3957
48. Dittmar, K. D., Hutchison, K. A., Owens-Grillo, J. K., and Pratt, W. B. (1996)
J. Biol. Chem. 271, 12833–12839
49. Lee, J. W., Ryan, F., Swaffield, J. C., Johnston, J. C., and Moore, D. D. (1995)
Nature 374, 91–94
50. Onate, S. A., Tsai, S. Y., Tsai, M. J., and O’Malley, B. W. (1995) Science 270,
1354–1357
AHR-associated Protein11456
by guest on December 25, 2015http://www.jbc.org/Downloaded from
Lucy A. Carver and Christopher A. Bradfield
in VivoImmunophilin Homolog
Hydrocarbon Receptor with a Novel
Ligand-dependent Interaction of the Aryl
Molecular Genetics:
Nucleic Acids, Protein Synthesis, and
1997, 272:11452-11456.J. Biol. Chem.
http://www.jbc.org/content/272/17/11452Access the most updated version of this article at
.JBC Affinity SitesFind articles, minireviews, Reflections and Classics on similar topics on the
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
http://www.jbc.org/content/272/17/11452.full.html#ref-list-1
This article cites 49 references, 25 of which can be accessed free at
by guest on December 25, 2015http://www.jbc.org/Downloaded from
