No full-text available
To read the full-text of this research,
you can request a copy directly from the authors.
Conservation of PDX-1 Structure, Function, and Expression in Zebrafish 1
Abstract
Development of the mammalian pancreas has been studied extensively in mice. The stages from budding of the pancreatic anlaga through endocrine and exocrine cell differentiation and islet formation have been described in detail. Recently, the homeodomain transcription factor PDX-1 has been identified as an important factor in the proliferation and differentiation of the pancreatic buds to form a mature pancreas. To evaluate the possibility of using zebrafish as a model for the genetic analysis of pancreas development, we have cloned and characterized PDX-1 from this organism. The deduced sequence of zebrafish PDX-1 contains 246 amino acids and is 95% identical to mammalian PDX-1 in the homeodomain. We also cloned zebrafish preproinsulin complementary DNA as a marker for islet tissue. By in situ hybridization we demonstrate that PDX-1 and insulin are coexpressed during embryonic development and in adults, although PDX-1 expression appears to be biphasic. Insulin expression apparently begins before 44 hpf, the earliest stage examined in this study. Additionally, very high levels of PDX-1 expression were observed in the pyloric caeca, the accessory digestive organs that also are derived from the proximal region of the intestine in teleosts. Finally, our data show that the evolutionary conservation of zebrafish PDX-1 extends to its DNA binding properties. Zebrafish PDX-1 was equally as effective as mouse PDX-1 in stimulating insulin gene transcription, and maximum promoter activation was dependent on the presence of four intact A elements. The demonstration of this capability suggests that transcriptional regulatory mechanisms that control pancreatic development and insulin gene expression have been conserved among vertebrates.
... Zebra®sh NR2B1 (I50515) was used as an outgroup. (Milewski et al., 1998). ac, anterior commissure; drd, dorso-rostral diencephalon; e, epiphysis; hb, hindbrain; p, pituitary; poc, post-optic commissure; vrd, ventro-rostral diencephalon; te, telencephalon; tg, trigeminal ganglia. ...
... onwards, a second expression domain for ff1b begins to appear in the trunk, emerging as a cluster of cells displaced just to the right of the midline of the 3rd somite. This region was identi®ed to be immediately anterior to the endocrine pancreas as established by immunocytological colocalization with antibody against the zebra®sh LIM homeodomain protein Islet (Korzh et al., 1993) (Fig. 3A,B) as well as by double staining with zebra®sh proinsulin probe (Milewski et al., 1998) (Fig. 3C,D), both of which mark the islet cells of the endocrine pancreas. ff1b-expressing cells are clearly distinct from those expressing Isl-1 and proinsulin (Fig. 3A±D). ...
... ff1b-expressing cells are clearly distinct from those expressing Isl-1 and proinsulin (Fig. 3A±D). The onset of expression of both ff1b and proinsulin is preceded by that of pdx1 (Milewski et al., 1998). In our study, pdx1 expression begins at around 22 h.p.f. and its staining pattern appears as a thin wedge-shaped epithelial layer that underlies the presumptive expression domains of ff1b and proinsulin. ...
The Ftz-F1 genes encode orphan receptors of the nuclear receptor superfamily. The mammalian Ftz-F1 homologue, SF-1, has been found to be essential for the proper development of the adrenal-gonadal axis and it also plays a critical role in mammalian sex-determination. We report here the isolation and characterisation of a novel zebrafish Ftz-F1 gene, ff1b. Whole-mount in situ hybridization revealed onset of expression in the developing rostral diencephalon at 22 h post-fertilization (h.p.f.). Later, at 30 h.p.f., transcripts could be detected in the anterior regions of the pancreatic anlagen. Expression in both locations peaks at 36 h.p.f. and disappears at around 48 h.p.f.
... 18 In addition, the developmental pathways building and maintaining the cell types of the pancreas are generally equivalent in vertebrates. For example, the well characterized marker of pancreatic development, pdx-1, is highly conserved between zebrafish and mammals 19 and perturbation of pancreatic genes, such as hnf1b, in the zebrafish produce phenotypes that closely resemble diabetes. [19][20][21][22][23] Similarly, the zebrafish liver, like that of mammals, stores glycogen, performs gluconeogenesis, and is the site of glucose and lipid metabolism. ...
... For example, the well characterized marker of pancreatic development, pdx-1, is highly conserved between zebrafish and mammals 19 and perturbation of pancreatic genes, such as hnf1b, in the zebrafish produce phenotypes that closely resemble diabetes. [19][20][21][22][23] Similarly, the zebrafish liver, like that of mammals, stores glycogen, performs gluconeogenesis, and is the site of glucose and lipid metabolism. Similar to mouse, its development is tightly regulated by BMP and FGF signaling pathways. ...
Fish are good for your health ‐ in more ways than you might expect. For one, eating fish is a common dietary recommendation for a healthy diet. But fish have much more to provide than omega‐3 fatty acids to your circulatory system. Some fish species now serve as important and innovative model systems for diabetes research providing novel and unique advantages compared to classical research models. Not surprisingly, the largest share of diabetes research in fish occurs in the laboratory workhorse amongst the fishes, the so‐called zebrafish (Danio rerio). Established as a genetic model system to study development, these small cyprinid fish have eventually conquered almost every scientific discipline, and over the last decade emerged as an important model system for metabolic diseases, including diabetes mellitus. In this review, we highlight the practicability of zebrafish to study diabetes and hyperglycemia, and summarize some of the recent research and breakthroughs using this model. Equally exciting, however, is the appearance of another emerging discipline, one that is taking advantage of evolution by studying cases of naturally occurring insulin resistance in fish species. We will briefly discuss two such models in this review, the rainbow trout (Oncorhynchus mykiss) and the cavefish (Astyanax mexicanus).
... As with similar tables in this book, this list will become obsolete as soon as published; we therefore advise readers to also make use of the regularly updated information at www.zfin.org. Some lines we showcase conveniently label a specific differentiated cell type, (Xu et al., 2010 #78) ins (Milewski, Duguay, Chan, & Steiner, 1998) Insulin Tg(ins:dsRed) m1081Tg (Shin et al., 2008 #305) Tg(ins:GFP) jh3Tg (Pisharath, Rhee, Swanson, Leach, & Parsons, 2007) Anti C-peptide antibody (Eames, Kinkel, Rajan, Prince, & Philipson, 2013) Tg(ins:GFP) zf5Tg (Huang, Vogel, Liu, Melton, & Lin, 2001) Tg(ins:kaede) jh6Tg (Pisharath et al., 2007) Tg3(ins:kaede) s949Tg (Andersson et al., 2012) Tg(ins:mCherry) jh2Tg (Pisharath et al., 2007 #220) Tg(ins:Cre) s924Tg (Hesselson, Anderson, Beinat, & Stainier, 2009) Delta cells Tg(sst2:GFP) gz18Tg (Li, Wen, Peng, Korzh, & Gong, 2009) sst2 (Argenton, Zecchin, & Bortolussi, 1999) Somatostatin Tg(sst2:RFP) gz19Tg (Li et al., 2009) Tg(À2.5sst2:GFP) jh20Tg (Wang, Rovira, Yusuff, & Parsons, 2011) Tg(sst2:Cre) s963Tg (Ye, Robertson, Hesselson, Stainier, & Anderson, 2015) Alpha cells Tg(gcga:GFP) ia1Tg gcga (Argenton et al., 1999) Glucagon ...
... ia6Tg (Leung, Klopper, Grill, Harris, & Norden, 2011) TgBAC(ptf1a:Cre-ERT2) mk201Tg (Wang, Park, Parsons, & Leach, 2015) Tg(ela3l:Cre) s932Tg (Hesselson, Anderson, & Stainier, 2011) Pancreatic progenitors Tg(À6.5pdx1:GFP) (Huang et al., 2001) pdx1 (Milewski et al., 1998) Pax6a/b (Verbruggen et al., 2010) pax6b (Biemar et al., 2001) hnf1ba (vhnf1, tcf2) (Sun & Hopkins, 2001) (Sakaguchi, Kikuchi, Kuroiwa, Takeda, & Stainier, 2006) sox17 (Alexander & Stainier, 1999) Tg(À5.0sox17:EGFP) zf99 (Mizoguchi, Verkade, Heath, Kuroiwa, & Kikuchi, 2008) sox32 (Alexander & Stainier, 1999) Tg(sox17:DsRed) s930Tg foxa2 (hnf3b/axial) (Chang, Blader, Fischer, Ingham, & Strahle, 1997) Tg(Xla.Eef1a1:GFP) s852Tg (gut:GFP) (Field et al., 2003) Tg(EPV.TP1-Mmu.Hbb:hist2h2l-mCherry) s939Tg (Delous et al., 2012) Notchresponsive cells Tg(Tp1glob:hmgb1-mCherry) fh32 (nuclear mCherry) Tg(Tp1bglob:eGFP) um14 Tp1 (cytoplasmic eGFP) Tg(Tp1glob:H2BmCherry) S939 , (nuclear mCherry; long half-life) (Ninov, Borius, & Stainier, 2012) Tg(Tp1glob:VenusPEST) S940 Tp1 , VenusPEST (destabilized protein) ...
The zebrafish pancreas shares its basic organization and cell types with the mammalian pancreas. In addition, the developmental pathways that lead to the establishment of the pancreatic islets of Langherhans are generally conserved from fish to mammals. Zebrafish provides a powerful tool to probe the mechanisms controlling establishment of the pancreatic endocrine cell types from early embryonic progenitor cells, as well as the regeneration of endocrine cells after damage. This knowledge is, in turn, applicable to refining protocols to generate renewable sources of human pancreatic islet cells that are critical for regulation of blood sugar levels. Here, we review how previous and ongoing studies in zebrafish and beyond are influencing the understanding of molecular mechanisms underlying various forms of diabetes and efforts to develop cell-based approaches to cure this increasingly widespread disease.
... We also observed a novel osr2 expression domain in a specific cluster of anterior endoderm-associated cells at the level of the pectoral fin and on the right side of the embryonic midline ( Figure 1G and I). Two-color in situ hybridization using osr2 and insulin (Milewski et al., 1998) probes showed that osr2 expressing cells lie just anterior to the pancreas ( Figure 1J). osr2 positive cells could be distinguished from pancreatic endodermal cells based on two-color in situ hybridization using osr2 and fgf24 or osr2 and agr2 probes (Manfroid et al., 2007;Shih et al., 2007) (Supplemental figure 1). ...
... The full-length insert was isolated and recloned into pBluescriptII-SK+ to enable transcription of sense and antisense RNA. The additional plasmid constructs used in this work (ntla (Schulte-Merker et al., 1994), insulin (Milewski et al., 1998), wnt2 (Blader, 1996), collagen IIa1 (col2a1) (Lele and Krone, 1997), tbx5a (Ruvinsky et al., 2000) (gift from Chi-Bin Chien), sox9a (Chiang et al., 2001), pax2a (Krauss et al., 1991), ae2 (Shmukler et al., 2005), nephrin (Kramer-Zucker et al., 2005), nbc1 (Nichane et al., 2006), trpm7 (Elizondo et al., 2005), ret1 (Bisgrove et al., 1997), agr2 (Shih et al., 2007), fgf24 (Manfroid et al., 2007) and foxa2 (previously named as axial) (Strahle et al., 1993) have been previously described. ...
Background:
odd-skipped related 2 (osr2) encodes a vertebrate ortholog of the Drosophila odd-skipped zinc-finger transcription factor. Osr2 in mouse is required for proper palate, eyelid, and bone development. Zebrafish knock-down experiments have also suggested a role for osr2, along with its paralog osr1, in early pectoral fin specification and pronephric development.
Results:
We show here that osr2 has a specific function later in development, independent of osr1, in the regulation of sox9a expression and promoting fin chondrogenesis. mRNA in situ hybridization demonstrated osr2 expression in the developing floorplate and later during organogenesis in the pronephros and gut epithelium. In the pectoral fin buds, osr2 was specifically expressed in fin mesenchyme. osr2 knock down in zebrafish embryos disrupted both three and five zinc finger alternatively spliced osr2 isoforms and eliminated wild-type osr2 mRNA. osr2 morphants exhibited normal pectoral fin bud specification but exhibited defective fin chondrogenesis, with loss of differentiated chondrocytes. Defects in chondrogenesis were paralleled by loss of sox9a as well as subsequent col2a1 expression, linking osr2 function to essential regulators of chondrogenesis.
Conclusions:
The zebrafish odd-skipped related 2 gene regulates sox9a and col2a1 expression in chondrocyte development and is specifically required for zebrafish fin morphogenesis.
... They were subsequently purified on NucAway spin columns (Ambion) and ethanol-precipitated. The zebrafish ascl1a [69], ascl1b [69], sox4b [37], isl1 [70], neurod1 [71], pax6b [72], neurog3 [30], atoh1a [73], atoh1b [73], neurod6a [74], neurod6b [74], atoh1c [75], atoh7 [76], atoh8 [77], mnx1/hb9 [42], arx [78], pdx1 [79], insulin [79], somatostatin 2 (PPS2) [80], ghrelin [81] and glucagon [80] probes have been described elsewhere. The neurod2, neurod4 and neurog1 probes were obtained from Imagene clones MAGp998E0411982Q (Pst1, SP6), IRBOp991C31D (Pst1, T7) and IRBOp991BO232D (EcoRI, T7), respectively. ...
... They were subsequently purified on NucAway spin columns (Ambion) and ethanol-precipitated. The zebrafish ascl1a [69], ascl1b [69], sox4b [37], isl1 [70], neurod1 [71], pax6b [72], neurog3 [30], atoh1a [73], atoh1b [73], neurod6a [74], neurod6b [74], atoh1c [75], atoh7 [76], atoh8 [77], mnx1/hb9 [42], arx [78], pdx1 [79], insulin [79], somatostatin 2 (PPS2) [80], ghrelin [81] and glucagon [80] probes have been described elsewhere. The neurod2, neurod4 and neurog1 probes were obtained from Imagene clones MAGp998E0411982Q (Pst1, SP6), IRBOp991C31D (Pst1, T7) and IRBOp991BO232D (EcoRI, T7), respectively. ...
NEUROG3 is a key regulator of pancreatic endocrine cell differentiation in mouse, essential for the generation of all mature hormone producing cells. It is repressed by Notch signaling that prevents pancreatic cell differentiation by maintaining precursors in an undifferentiated state.
We show herein that, in zebrafish, neurog3 is not expressed in the pancreas and null neurog3 mutant embryos do not display any apparent endocrine defects. The control of endocrine cell fate is instead fulfilled by a couple of bHLH factors, Ascl1b and Neurod1, that are both repressed by Notch signaling. ascl1b is transiently expressed in the mid-trunk endoderm just after gastrulation and is required for the generation of the first pancreatic endocrine precursor cells. Neurod1 is expressed afterwards in the pancreatic anlagen and pursues the endocrine cell differentiation program initiated by Ascl1b. Their complementary role in endocrine differentiation of the dorsal bud is demonstrated by the loss of all hormone-secreting cells following their simultaneous inactivation. This defect is due to a blockage of the initiation of endocrine cell differentiation.
This study demonstrates that NEUROG3 is not the unique pancreatic endocrine cell fate determinant in vertebrates. A general survey of endocrine cell fate determinants in the whole digestive system among vertebrates indicates that they all belong to the ARP/ASCL family but not necessarily to the Neurog3 subfamily. The identity of the ARP/ASCL factor involved depends not only on the organ but also on the species. One could therefore consider differentiating stem cells into insulin-producing cells without the involvement of NEUROG3 but via another ARP/ASCL factor.
... The pegasus morphant embryos were further analysed with markers specific for the gut (intestinal fatty acid binding protein, ifabp) (Mudumana et al., 2004), and endocrine pancreas (insulin) (Milewski et al., 1998). Analysis of ifabp expression revealed a similar intensity of staining in pegasus morphants ( Fig. 2E and H), compared to controls (Fig. 2D). ...
... Visual inspection from 3 dpf revealed altered intestinal looping in a significant proportion of Pegasus morphants, consistent with the strong expression of pegasus in this region. Therefore, further analysis examined the expression of ifabp and insulin as markers of the intestine and endocrine pancreas, respectively (Milewski et al., 1998;Mudumana et al., 2004). The expression level of ifabp was unaltered in pegasus morphants, but a substantial number showed incorrect looping of the intestine, that either looped to the right or lay on the midline. ...
Members of the Ikaros family of zinc-finger transcription factors have been shown to be critical for immune and blood cell development. However, the role of the most divergent family member, Pegasus, has remained elusive, although it shows conservation to invertebrate Hunchback proteins that influence embryonic patterning through regulation of homeodomain genes. Zebrafish was employed as a relevant model to investigate the function of Pegasus since it possesses a single pegasus orthologue with high homology to its mammalian counterparts. During zebrafish embryogenesis pegasus transcripts were initially maternally-derived and later replaced by zygotic expression in the diencephalon, tectum, hindbrain, thymus, eye, and ultimately the exocrine pancreas and intestine. Morpholino-mediated knockdown of the zebrafish pegasus gene resulted in disrupted left-right asymmetry of the gut and pancreas. Molecular analysis indicated that zebrafish Pegasus localised to the nucleus in discrete non-nucleolar structures and bound the 'atypical' DNA sequence GN3GN2G, confirming its presumed role as a transcriptional regulator. In vivo transcriptome analysis identified candidate target genes, several of which encoded homeodomain transcription factors. One of these, pitx2, implicated in left-right asymmetry, possessed appropriate 'atypical' Pegasus binding sites in its promoter. Knockdown of Pegasus affected both the level and asymmetry of pitx2 expression, as well as disrupting the asymmetry of the lefty2 and spaw genes, explaining the perturbed left-right patterning in pegasus morphants. Collectively these results provide the first definitive insights into the in vivo role of Pegasus, supporting the notion that it acts as a broader regulator of development, with potential parallels to the related invertebrate Hunchback proteins.
... Whole-mount in situ hybridization was performed on 48 hpf embryos as described (Chen and Fishman, 1996) using digoxigenin-labelled antisense RNA probes. fkd2 was used to analyze the position of liver, and pdx for gut and pancreas (Milewski et al., 1998). For the assessment of visceral organ laterality, only pdx and fkd2 proved particularly instructive, and are described here. ...
... After 3 days of development, its expression becomes prominent in the liver and pancreas as well (Figure 1A). pdx is a homeodomain gene that marks the developing gut and pancreas (Milewski et al., 1998) (Figure 1B). With these two probes, we are able to visualize the liver and gut primordia on the left and pancreas on the right of the embryo after 2 days of development. ...
All internal organs are asymmetric along the left–right axis. Here we report a genetic screen to discover mutations which perturb organ laterality. Our particular focus is upon whether, and how, organs are linked to each other as they achieve their laterally asymmetric positions. We generated mutations by ENU mutagenesis and examined F3 progeny using a cocktail of probes that reveal early primordia of heart, gut, liver and pancreas. From the 750 genomes examined, we isolated seven recessive mutations which affect the earliest left–right positioning of one or all of the organs. None of these mutations caused discernable defects elsewhere in the embryo at the stages examined. This is in contrast to those mutations we reported previously (Chen et al., 1997) which, along with left–right abnormalities, cause marked perturbation in gastrulation, body form or midline structures. We find that the mutations can be classified on the basis of whether they perturb relationships among organ laterality. In Class 1 mutations, none of the organs manifest any left–right asymmetry. The heart does not jog to the left and normally left-predominant BMP4 in the early heart tube remains symmetric. The gut tends to remain midline. There frequently is a remarkable bilateral duplication of liver and pancreas. Embryos with Class 2 mutations have organotypic asymmetry but, in any given embryo, organ positions can be normal, reversed or randomized. Class 3 reveals a hitherto unsuspected gene that selectively affects laterality of heart. We find that visceral organ positions are predicted by the direction of the preceding cardiac jog. We interpret this as suggesting that normally there is linkage between cardiac and visceral organ laterality. Class 1 mutations, we suggest, effectively remove the global laterality signals, with the consequence that organ positions are effectively symmetrical. Embryos with Class 2 mutations do manifest linkage among organs, but it may be reversed, suggesting that the global signals may be present but incorrectly orientated in some of the embryos. That laterality decisions of organs may be independently perturbed, as in the Class 3 mutation, indicates that there are distinctive pathways for reception and organotypic interpretation of the global signals. Copyright © 2001 John Wiley & Sons, Ltd.
... Tilapia display several E elements that may bind IEF-1 and activate INS gene transcription similar to what is observed in mammals [152]. PDX-1 also binds to elements of the zebrafish INS promoter and is essential for gene transcription [115] [160]. Deletion analysis of the trout INS promoter indicated the region from À160 to À280 to be the most critical in enhancing INS gene transcription [8], whereas deletion analysis of the tilapia INS promoter suggested further upstream sequence from À535 to À1575 is necessary for enhanced gene transcription [152]. ...
... These findings are consistent with reports of INS in developing mammals [107]. In zebrafish, INS gene expression occurred as early as 44 h post-fertilization (hpf) [160]; however, zebrafish INSa (zfINSa) and zfINSb mRNA have been detected one hpf, but these early-appearing mRNAs are thought to be of material origin [183]. zfINSa and zfINSb were identified in the head region of developing zebrafish, along with IGF-2 [183]. ...
Fish have provided essential information about the structure, biosynthesis, evolution, and function of insulin (INS) as well as about the structure, evolution, and mechanism of action of insulin receptors (IR). INS, insulin-like growth factor (IGF)-1, and IGF-2 share a common ancestor; INS and a single IGF occur in Agnathans, whereas INS and distinct IGF-1 and IGF-2s appear in Chondrichthyes. Some but not all teleost fish possess multiple INS genes, but it is not clear if they arose from a common gene duplication event or from multiple separate gene duplications. INS is produced by the endocrine pancreas of fish as well as by several other tissues, including brain, pituitary, gastrointestinal tract, and adipose tissue. INS regulates various aspects of feeding, growth, development, and intermediary metabolism in fish. The actions of INS are mediated through the insulin receptor (IR), a member of the receptor tyrosine kinase family. IRs are widely distributed in peripheral tissues of fish, and multiple IR subtypes that derive from distinct mRNAs have been described. The IRs of fish link to several cellular effector systems, including the ERK and IRS-PI3k-Akt pathways. The diverse effects of INS can be modulated by altering the production and release of INS as well as by adjusting the production/surface expression of IR. The diverse actions of INS in fish as well as the diverse nature of the neural, hormonal, and environmental factors known to affect the INS signaling system reflects the various life history patterns that have evolved to enable fish to occupy a wide range of aquatic habitats.
... Permeabilization was carried out using Proteinase K (10 g/ml, Roche, Mannheim, Germany). For whole-mount in situ hybridization, embryos and larvae were hybridized overnight at 68°C with the following digoxigeninlabelled probes: cdc14b_tv1, cdc14b_tv2, nkx2.5 (Chen and Fishman, 1996), foxa3 (Odenthal and Nusslein-Volhard, 1998), southpaw (Long et al., 2003), insulin (Milewski et al., 1998), no tail (Schulte-Merker et al., 1994), myo7a (Ernest et al., 2000), erm1 (Munchberg et al., 1999), pea3 (Munchberg et al., 1999) and pax2a (Krauss et al., 1991). Detection and staining were carried out as previously described (Thisse and Thisse, 2008). ...
... Development 138 (2) LR asymmetry using markers for asymmetrically positioned organs. Expression of heart markers nkx2.5 and cmlc2 (Chen and Fishman, 1996;Yelon et al., 1999) at 31 hpf showed that, as expected, the heart tube shifted to the left in most uninjected control embryos, whereas in the cdc14b morphants the shifting direction was random ( Fig (Milewski et al., 1998;Odenthal and Nusslein-Volhard, 1998), at 49 hpf, indicated that gut looping and localization of the liver and pancreas were also randomized in cdc14b morphants (Fig. 2E-H; see Fig. S6E-H in the supplementary material). We analyzed the expression of the earliest known marker asymmetrically expressed, southpaw (spaw), encoding a Nodal-related ligand (Long et al., 2003), at 18 hpf. ...
Progression through the cell cycle relies on oscillation of cyclin-dependent kinase (Cdk) activity. One mechanism for downregulating Cdk signaling is to activate opposing phosphatases. The Cdc14 family of phosphatases counteracts Cdk1 phosphorylation in diverse organisms to allow proper exit from mitosis and cytokinesis. However, the role of the vertebrate CDC14 phosphatases, CDC14A and CDC14B, in re-setting the cell for interphase remains unclear. To understand Cdc14 function in vertebrates, we cloned the zebrafish cdc14b gene and used antisense morpholino oligonucleotides and an insertional mutation to inhibit its function during early development. Loss of Cdc14B function led to an array of phenotypes, including hydrocephaly, curved body, kidney cysts and left-right asymmetry defects, reminiscent of zebrafish mutants with defective cilia. Indeed, we report that motile and primary cilia were shorter in cdc14b-deficient embryos. We also demonstrate that Cdc14B function in ciliogenesis requires its phosphatase activity and can be dissociated from its function in cell cycle control. Finally, we propose that Cdc14B plays a role in the regulation of cilia length in a pathway independent of fibroblast growth factor (FGF). This first study of a loss of function of a Cdc14 family member in a vertebrate organism reveals a new role for Cdc14B in ciliogenesis and consequently in a number of developmental processes.
... The riboprobes used were nkx6.1(Cheesman et al., 2004), foxa1 (Odenthal and NussleinVolhard, 1998), neuroD (Korzh et al., 1998), glucagon (Argenton et al., 1999), insulin (Milewski et al., 1998), somatostatin (Argenton et al., 1999), ghrelin (Pauls et al., 2007), sox4b (Mavropoulos et al., 2005), pdx1 (Milewski et al., 1998), pax6b (Nornes et al., 1998), myod (Weinberg et al., 1996) and isl1 (Korzh et al., 1993). The analyses of global hormone expression were obtained by using a mix of glucagon, insulin, somatostatin and ghrelin riboprobes. ...
... The riboprobes used were nkx6.1(Cheesman et al., 2004), foxa1 (Odenthal and NussleinVolhard, 1998), neuroD (Korzh et al., 1998), glucagon (Argenton et al., 1999), insulin (Milewski et al., 1998), somatostatin (Argenton et al., 1999), ghrelin (Pauls et al., 2007), sox4b (Mavropoulos et al., 2005), pdx1 (Milewski et al., 1998), pax6b (Nornes et al., 1998), myod (Weinberg et al., 1996) and isl1 (Korzh et al., 1993). The analyses of global hormone expression were obtained by using a mix of glucagon, insulin, somatostatin and ghrelin riboprobes. ...
In mice, the Nkx6 genes are crucial to alpha- and beta-cell differentiation, but the molecular mechanisms by which they regulate pancreatic subtype specification remain elusive. Here it is shown that in zebrafish, nkx6.1 and nkx6.2 are co-expressed at early stages in the first pancreatic endocrine progenitors, but that their expression domains gradually segregate into different layers, nkx6.1 being expressed ventrally with respect to the forming islet while nkx6.2 is expressed mainly in beta-cells. Knockdown of nkx6.2 or nkx6.1 expression leads to nearly complete loss of alpha-cells but has no effect on beta-, delta-, or epsilon-cells. In contrast, nkx6.1/nkx6.2 double knockdown leads additionally to a drastic reduction of beta-cells. Synergy between the effects of nkx6.1 and nkx6.2 knockdown on both beta- and alpha-cell differentiation suggests that nkx6.1 and nkx6.2 have the same biological activity, the required total nkx6 threshold being higher for alpha-cell than for beta-cell differentiation. Finally, we demonstrate that the nkx6 act on the establishment of the pancreatic endocrine progenitor pool whose size is correlated with the total nkx6 expression level. On the basis of our data, we propose a model in which nkx6.1 and nkx6.2, by allowing the establishment of the endocrine progenitor pool, control alpha- and beta-cell differentiation.
... The sst1.1 and sst2 probes were described in Devos et al., 2002. The ins probe has been described in Milewski et al., 1998. Fluorescent in situ hybridization were performed as described in Tarifeño-Saldivia et al., 2017 on 3 or 6 days post fertilization embryos (dpf). ...
Restoring damaged b-cells in diabetic patients by harnessing the plasticity of other pancreatic cells raises the questions of the efficiency of the process and of the functionality of the new Insulin -expressing cells. To overcome the weak regenerative capacity of mammals, we used regeneration-prone zebrafish to study b-cells arising following destruction. We show that most new insulin cells differ from the original b-cells as they coexpress Somatostatin and Insulin. These bihormonal cells are abundant, functional and able to normalize glycemia. Their formation in response to b-cell destruction is fast, efficient and age-independent. Bihormonal cells are transcriptionally close to a subset of d-cells that we identified in control islets and which are characterized by the expression of somatostatin 1.1 ( sst1.1 ) and by genes essential for glucose-induced Insulin secretion in β-cells such as pdx1 , slc2a2 and gck . We observed in vivo the conversion of monohormonal sst1.1- expressing cells to sst1.1+ ins+ bihormonal cells following b-cell destruction. Our findings support the conclusion that sst1.1 d-cells possess a pro-b identity enabling them to contribute to the neogenesis of Insulin-producing cells during regeneration. This work unveils that abundant and functional bihormonal cells benefit to diabetes recovery in zebrafish.
... The sst1.1 and sst2 probes were described in Devos et al., 2002. The ins probe has been described in Milewski et al., 1998. Fluorescent in situ hybridization were performed as described in Tarifeño-Saldivia et al., 2017 on 3 or 6 days post fertilization embryos (dpf). ...
Restoring damaged β-cells in diabetic patients by harnessing the plasticity of other pancreatic cells raises the questions of the efficiency of the process and of the functionality of the new Insulin-expressing cells. To overcome the weak regenerative capacity of mammals, we used regeneration-prone zebrafish to study β-cells arising following destruction. We show that most new insulin cells differ from the original β-cells as they are Somatostatin+ Insulin+, but are nevertheless functional and normalize glycemia. These bihormonal cells are transcriptionally close to a subset of δ-cells in normal islets characterized by the expression of somatostatin 1.1 (sst1.1), the β-cell genes pdx1, slc2a2 and gck, and the machinery for glucose-induced Insulin secretion. β-cell destruction triggers massive sst1.1 δ-cell conversion to bihormonal cells. Our work shows that their pro- β-cell identity predisposes this zebrafish δ-cell subpopulation to efficient age-independent neogenesis of Insulin-producing cells and provides clues to restoring functional β-cells in mammalian diabetes models.
... The effect of stigmasterol-3-O-β-d-glucoside (1) was attributed to the increase in ERK1/2 phosphorylation. It has been demonstrated that ERK1/2 is a proline-directed Ser/Thr kinase that upregulates the expression of PDX-1, which has three proline-directed Ser/Thr residues [48,49]. Moreover, treatment with stigmasterol-3-O-β-d-glucoside (1) increased the phosphorylation of IRS-2 at Ser731, which can potentially activate the PI3K/Akt signaling pathway. ...
Chocolate vine (Akebia quinata) is consumed as a fruit and is also used in traditional medicine. In order to identify the bioactive components of A. quinata, a phytosterol glucoside stigmasterol-3-O-β-d-glucoside (1), three triterpenoids maslinic acid (2), scutellaric acid (3), and hederagenin (4), and three triterpenoidal saponins akebia saponin PA (5), hederacoside C (6), and hederacolchiside F (7) were isolated from a 70% EtOH extract of the fruits of A. quinata (AKQU). The chemical structures of isolates 1–7 were determined by analyzing the 1D and 2D nuclear magnetic resonance (NMR) spectroscopic data. Here, we evaluated the effects of AKQU and compounds 1–7 on insulin secretion using the INS-1 rat pancreatic β-cell line. Glucose-stimulated insulin secretion (GSIS) was evaluated in INS-1 cells using the GSIS assay. The expression levels of the proteins related to pancreatic β-cell function were detected by Western blotting. Among the isolates, stigmasterol-3-O-β-d-glucoside (1) exhibited strong GSIS activity and triggered the overexpression of pancreas/duodenum homeobox protein-1 (PDX-1), which is implicated in the regulation of pancreatic β-cell survival and function. Moreover, isolate 1 markedly induced the expression of extracellular signal-regulated protein kinases 1 and 2 (ERK1/2), insulin receptor substrate-2 (IRS-2), phosphoinositide 3-kinase (PI3K), and Akt, which regulate the transcription of PDX-1. The results of our experimental studies indicated that stigmasterol-3-O-β-d-glucoside (1) isolated from the fruits of A. quinata can potentially enhance insulin secretion, and might alleviate the reduction in GSIS during the development of T2DM.
... The isolation of the islet 1 gene (Inoue et al., 1994), and more recently the p d xl gene (Milewski et al., 1998), has enabled significant progress. A p d x l 'knock-down' zebrafish has been generated to study development at a molecular level (Huang et al, 2001a;Yee et al., 2001), and a GFP-transgenic line has been developed to follow the morphological progress of the developing pancreas, utilising regulatory elements from the p dxl and insulin genes (Huang et al., 2001b). ...
The pituitary gland is an endocrine organ with roles in growth, maturation and homeostasis. It is derived from two distinct cell populations in the embryo, which give rise to a mature gland with six distinct hormone secreting cell types. This organ, combined with the attributes of the zebrafish, provides an ideal model system in which to study cell differentiation and intercellular communication, fundamentals of developmental biology. Initially a characterisation of gene expression within the anterior pituitary gland over the first four days of development was carried out using in situ hybridisation and antibody labelling. This provides a description of normal development. This information was used to identify mutant zebrafish lines in which anterior pituitary development was in some way disrupted. Two such lines investigated in this work carry novel alleles. A novel zebrafish gene, ptx1/3, with expression in the developing anterior pituitary gland was studied, firstly to determine the identity of the gene in relation to a number of possible homologues from other species and then to assess its role in pituitary development. An anti-sense approach was used to address function by preventing translation of the protein within the zebrafish embryo. Large-scale genetic screening is an invaluable method of isolating novel mutant lines. I contributed to two such screens were conducted during the course of my studies; the first was at UCL and the second in Tuebingen, Germany, co-ordinated by Artemis pharmaceuticals. Both focused on isolating mutants with defects in early neurogenesis and axon pathway patterning in the embryonic forebrain. Embryos were screened by morphology and anti-tubulin antibody labelling, with more than 100 mutant lines being identified. Novel mutant lines are useful tools in the study of development. One such line studied here, named u320, was genetically mapped to identify the location of the mutant locus. A phenotypic characterisation of the line was conducted including gene expression analysis and transplantation experiments. This work provides information as to the likely activity of the mutated locus in this novel zebrafish line and the role of the affected gene in the context of development, with a focus on the anterior pituitary. The work described here provides an outline of the developing pituitary gland in the zebrafish embryo. A number of studies then provide examples as to how this information can be used to understand the role of specific genes in a more general developmental context
... The following probes were synthesized: insulin (Milewski et al., 1998); pdx1 was amplified from cDNA of 24 hpf embryos using the primers 5′caggtagagcagaggtcctga-3′ ( pdx1-forward) and 5′-tcacatcactttaatgtttgtggtaa-3′ ( pdx1-reverse). The T7 promoter was added to the 5′ end of the reverse primer in a second round of amplification. ...
An early step in pancreas development is marked by the expression of the transcription factor Pdx1 within the pancreatic endoderm, where it is required for the specification of all endocrine cell types. Subsequently, Pdx1 expression becomes restricted to the β-cell lineage, where it plays a central role in β-cell function. This pivotal role of Pdx1 at various stages of pancreas development makes it an attractive target to enhance pancreatic β-cell differentiation and increase β-cell function. In this study, we used a newly generated zebrafish reporter to screen over 8000 small molecules for modulators of pdx1 expression. We found four hit compounds and validated their efficacy at different stages of pancreas development. Notably, valproic acid treatment increased pancreatic endoderm formation, while inhibition of TGFβ signaling led to α-cell to β-cell transdifferentiation. HC toxin, another HDAC inhibitor, enhances β-cell function in primary mouse and human islets. Thus, using a whole organism screening strategy, this study identified new pdx1 expression modulators that can be used to influence different steps in pancreas and β-cell development.
... preproinsulin (ins) [81]; slc25a25b (ENSDART00000098163); southpaw [82]. ...
Author summary
Cilia are extensions of the cell that project from the cell body and serve as cellular sensors that transduce extracellular stimuli into the cell. The molecular mechanisms involved in ciliary signal transduction include ciliary receptors and ion channels. The transient receptor potential channel polycystin-2 (TRPP2) is known to control cilia-dependent biological processes throughout the animal kingdom ranging from male fertility to left–right organ patterning. However, the mechanisms mediating TRPP2 function in vivo remain unclear. Here, we have analyzed these mechanisms in the fruit fly and zebrafish and identified the mitochondrial solute carrier 25 A 25 (SLC25A25) as an intracellular effector of Ca²⁺-permeable TRPP2 cation channel in cilia. We show that SLC25A25 cooperates with TRPP2 in an evolutionarily conserved metabolic signaling pathway acting as a Ca²⁺-activated mitochondrial ATP transporter. Loss of this signaling pathway impairs cellular metabolism and causes severe defects in flies and fish, such as left–right patterning or male fertility problems. Our findings establish a molecular link between ciliary signaling and mitochondrial metabolism, raising the fascinating question of how SLC25A25-mediated metabolic fluctuations control male fertility and organ patterning in vivo.
... CCTCCAGAAAAGCTTTCTTCT CTAT In situ hybridization was performed as described (Jowett and Lettice, 1994). Dioxygenin-labelled RNA probes for sox32 , sox17 , foxa3 (Odenthal and Nusslein-Volhard, 1998), ins (Milewski et al., 1998) and cp (Korzh et al., 2001) were produced as previously described. ...
... ERK is a proline-directed Ser/Thr kinase [50]. PDX-1 has three proline-directed Ser/Thr residues, Ser 61, Ser 66 and Ser 268 [51]. Although PDX-1 Ser 61 and Ser 66 can be phosphorylated by ERK in vitro [52], it is unlikely that these phosphorylation events occur in cells. ...
Pancreatic ductal adenocarcinoma (PDAC) is one of the most potent and perilous diseases known, with a median survival rate of 3-5 months due to the combination of only advanced stage diagnosis and ineffective therapeutic options. Metformin (1,1-Dimethylbiguanide hydrochloride), the leading drug used for type 2 diabetes mellitus, emerges as a potential therapy for PDAC and other human cancers. Metformin exerts its anticancer action via a variety of adenosine monophosphate (AMP)-activated protein kinase (AMPK)-dependent and/or AMPK-independent mechanisms. We present data here showing that metformin down-regulated pancreatic transcription factor pancreatic duodenal homeobox-1 (PDX-1), suggesting a potential novel mechanism by which metformin exerts its anticancer action. Metformin inhibited PDX-1 expression at both protein and mRNA levels and PDX-1 transactivity as well in PDAC cells. Extracellular signal-regulated kinase (ERK) was identified as a PDX-1-interacting protein by antibody array screening in GFP-PDX-1 stable HEK293 cells. Co-transfection of ERK1 with PDX-1 resulted in an enhanced PDX-1 expression in HEK293 cells in a dose-dependent manner. Immunoprecipitation/Western blotting analysis confirmed the ERK-PDX-1 interaction in PANC-1 cells stimulated by epidermal growth factor (EGF). EGF induced an enhanced PDX-1 expression in PANC-1 cells and this stimulation was inhibited by MEK inhibitor PD0325901. Metformin inhibited EGF-stimulated PDX-1 expression with an accompanied inhibition of ERK kinase activation in PANC-1 cells. Taken together, our studies show that PDX-1 is a potential novel target for metformin in PDAC cells and that metformin may exert its anticancer action in PDAC by down-regulating PDX-1 via a mechanism involving inhibition of ERK signaling.
... Many pancreatic developmental genes and hormones that regulate glucose metabolism in zebrafish, such as insulin and glucagon, resemble those of mammals [61,62]. For example, the well-characterized early marker of pancreatic development, pdx-1 (pancreatic and duodenal homeobox-1), is conserved between mammals and zebrafish [63]. Both zebrafish and mammalian embryos share the positive regulatory relationship between hedgehog and pdx-1 in pancreas precursor cell specification [64]. ...
Diabetes mellitus affects millions of people worldwide and significantly impacts their quality of life. Moreover, life threatening diseases, such as myocardial infarction, blindness, and renal disorders, increase the morbidity rate associated with diabetes. Various natural products from medicinal plants have shown potential as antidiabetes agents in cell-based screening systems. However, many of these potential “hits” fail in mammalian tests, due to issues such as poor pharmacokinetics and/or toxic side effects. To address this problem, the zebrafish (
Danio rerio
) model has been developed as a “bridge” to provide an experimentally convenient animal-based screening system to identify drug candidates that are active
in vivo
. In this review, we discuss the application of zebrafish to drug screening technologies for diabetes research. Specifically, the discovery of natural product-based antidiabetes compounds using zebrafish will be described. For example, it has recently been demonstrated that antidiabetic natural compounds can be identified in zebrafish using activity guided fractionation of crude plant extracts. Moreover, the development of fluorescent-tagged glucose bioprobes has allowed the screening of natural product-based modulators of glucose homeostasis in zebrafish. We hope that the discussion of these advances will illustrate the value and simplicity of establishing zebrafish-based assays for antidiabetic compounds in natural products-based laboratories.
... Recent studies confirmed similar requirements for Pdx1 in beta cell development between zebrafish and mammals, specifically that Pdx1 is essential for formation of the later population ("second wave") of definitive endocrine cells 24 . Zebrafish Pdx1 regulates embryonic glucose metabolism 10,25 , and activates insulin gene expression in reporter assays 26 . ...
Diabetes mellitus is characterized by disrupted glucose homeostasis due to loss or dysfunction of insulin-producing beta cells. In this work, we characterize pancreatic islet development and function in zebrafish mutant for pdx1, a gene which in humans is linked to genetic forms of diabetes and is associated with increased susceptibility to Type 2 diabetes. Pdx1 mutant zebrafish have the key diabetic features of reduced beta cells, decreased insulin and elevated glucose. The hyperglycemia responds to pharmacologic anti-diabetic treatment and, as often seen in mammalian diabetes models, beta cells of pdx1 mutants show sensitivity to nutrient overload. This unique genetic model of diabetes provides a new tool for elucidating the mechanisms behind hyperglycemic pathologies and will allow the testing of novel therapeutic interventions in a model organism that is amenable to high-throughput approaches.
... In situ hybridizations were performed using a standard protocol (Thisse and Thisse, 2008). Antisense digoxigenin (DIG) labeled riboprobes against southpaw (spaw) (Ahmad et al., 2004), lefty1 (Bisgrove et al., 1999), lefty2 (Bisgrove et al., 1999), myosin light polypeptide 7 (myl7) or cardiac myosin light chain (cmlc2) (Yelon et al., 1999), forkhead box A3 (foxa3) or forkhead (fkd2) (Odenthal and Nusslein-Volhard, 1998), preproinsulin (ins) (Milewski et al., 1998), goosecoid (gsc) (Schulte-Merker et al., 1994), and no tail (ntl) (Schulte-Merker et al., 1994) were synthesized using standard methods. Stained embryos were imaged using a Leica MZ16 stereomicroscope and an Optronics digital camera. ...
... 7 To detect insulin transcripts in 3-dpf zebrafish, the larvae were fixed with 4% (w/v) paraformaldehyde in 1X PBS for 1 h at RT. Whole-mount in situ hybridization was then performed, 30 using an insulin antisense riboprobe labeled with digoxigenin. 31 To generate the insulin riboprobe, RNA was isolated from wildtype 3-dpf zebrafish embryos using an RNeasy Plus kit (Qiagen) and then converted to cDNA using the SuperScript III First-Strand Synthesis System (Invitrogen). The primers 5′-CCATATCCACCATTCCTCG-CC-3′ and 5′-TAATACGACTCACTATAGGCAAACGGAGAGCA-TTAAGGCC-3′ were then used to amplify the full-length proproinsulin gene and add a T7 promoter. ...
Phosphorodiamidate
morpholino oligonucleotides are widely used
to interrogate gene function in whole organisms, and light-activatable
derivatives can reveal spatial and temporal differences in gene activity.
We describe here a new class of caged morpholino oligonucleotides
that can be activated by the bacterial nitroreductase NfsB. We characterize
the activation kinetics of these reagents in vitro and demonstrate their efficacy in zebrafish embryos that express
NfsB either ubiquitously or in defined cell populations. In combination
with transgenic organisms, such enzyme-actuated antisense tools will
enable gene silencing in specific cell types, including tissues that
are not amenable to optical targeting.
... Whole-mount in situ hybridization was performed on zebrafish embryos as described (Thisse and Thisse, 2008) using riboprobes for spaw (Ahmad et al., 2004), lefty1 (Bisgrove et al., 1999), lefty2 (Bisgrove et al., 1999), cmlc2 (Yelon et al., 1999), fkd2 (Odenthal and Nusslein-Volhard, 1998), ins (Milewski et al., 1998), gsc (Schulte-Merker et al., 1994, and ntl (Schulte-Merker et al., 1994). ...
Asymmetric fluid flow in the node and Nodal signaling in the left lateral plate mesoderm (LPM) drive left-right patterning of the mammalian body plan. However, the mechanisms linking fluid flow to asymmetric gene expression in the LPM remain unclear. Here we show that the small GTPase Rab23, known for its role in Hedgehog signaling, plays a separate role in Nodal signaling and left-right patterning in the mouse embryo. Rab23 is not required for initial symmetry breaking in the node, but it is required for expression of Nodal and Nodal target genes in the LPM. Microinjection of Nodal protein and transfection of Nodal cDNA in the embryo indicate that Rab23 is required for the production of functional Nodal signals, rather than the response to them. Using gain- and loss-of function approaches, we show that Rab23 plays a similar role in zebrafish, where it is required in the teleost equivalent of the mouse node, Kupffer's vesicle. Collectively, these data suggest that Rab23 is an essential component of the mechanism that transmits asymmetric patterning information from the node to the LPM.
... Using Both the sense and anti-sense riboprobes were synthesized from the cDNAs corresponding to PC5.1, PC5.2 6 , SCL/tal-1 7 , gata-1 8,9 , flk/ kdrl 10 , shh 11 , dlx2 12 , fkd7/foxa1 13 , insulin 14,15 , and trypsin 16 have been constructed by amplifying a segment of the full-length mRNA using Taq DNA polymerase, and cloned into pCRII-TOPO (Invitrogen). The authenticity of individual amplicons was confirmed by sequencing. ...
This article focuses on whole-mount in situ hybridization (WISH) of zebrafish embryos. The WISH technology facilitates the assessment of gene expression both in terms of tissue distribution and developmental stage. Protocols are described for the use of WISH of zebrafish embryos using antisense RNA probes labeled with digoxigenin. Probes are generated by incorporating digoxigenin-linked nucleotides through in vitro transcription of gene templates that have been cloned and linearized. The chorions of embryos harvested at defined developmental stages are removed before incubation with specific probes. Following a washing procedure to remove excess probe, embryos are incubated with anti-digoxigenin antibody conjugated with alkaline phosphatase. By employing a chromogenic substrate for alkaline phosphatase, specific gene expression can be assessed. Depending on the level of gene expression the entire procedure can be completed within 2-3 days.
... Complementing these mammalian studies, the zebrafish (Danio rerio) has emerged as a highly productive model organism in which to study mechanisms of pancreas development and β-cell differentiation, with multiple studies demonstrating that fish and mammals rely on shared transcriptional and signaling networks during pancreas development. Among these shared mechanisms are multiple transcription factors, including pdx1, isl1, mnx1, neurod, nkx2.2, nkx6.1, pax6, prox1, sox9b, hnf1α, hnf1β, hnf3β, and hnf3γ, which appear to have similar functions in developing mouse and zebrafish pancreas56789101112131415161718. However, inter-species differences also exist in the pancreatic developmental programs employed in mammals and in zebrafish. ...
Aldh1 expression is known to mark candidate progenitor populations in adult and embryonic mouse pancreas, and Aldh1 enzymatic activity has been identified as a potent regulator of pancreatic endocrine differentiation in zebrafish. However, the location and identity of Aldh1-expressing cells in zebrafish pancreas remain unknown. In this study we demonstrate that Aldh1-expressing cells are located immediately adjacent to 2F11-positive pancreatic ductal epithelial cells, and that their abundance dramatically increases during zebrafish secondary islet formation. These cells also express neurod, a marker of endocrine progenitor cells, but do not express markers of more mature endocrine cells such as pax6b or insulin. Using formal cre/lox-based lineage tracing, we further show that Aldh1-expressing pancreatic epithelial cells are the direct progeny of pancreatic notch-responsive progenitor cells, identifying them as a critical intermediate between multi-lineage progenitors and mature endocrine cells. Pharmacologic manipulation of Aldh1 enzymatic activity accelerates cell entry into the Aldh1-expressing endocrine progenitor pool, and also leads to the premature maturation of these cells, as evidenced by accelerated pax6b expression. Together, these findings suggest that Aldh1-expressing cells act as both participants and regulators of endocrine differentiation during zebrafish secondary islet formation.
... The following probes were also used: arx[23], nkx6.1[37], neuroD[38], glucagon[39], insulin[40], somatostatin[39], ghrelin[41], sox4b[25], and isl1[42]. The cocktail of four hormones probes namely glucagon, insulin, somatostatin and ghrelin were used to analyse global hormone expression. ...
Background
Genetic studies in mouse have demonstrated the crucial function of PAX4 in pancreatic cell differentiation. This transcription factor specifies β- and δ-cell fate at the expense of α-cell identity by repressing Arx gene expression and ectopic expression of PAX4 in α-cells is sufficient to convert them into β-cells. Surprisingly, no Pax4 orthologous gene can be found in chicken and Xenopus tropicalis raising the question of the function of pax4 gene in lower vertebrates such as in fish. In the present study, we have analyzed the expression and the function of the orthologous pax4 gene in zebrafish.
Results
pax4 gene is transiently expressed in the pancreas of zebrafish embryos and is mostly restricted to endocrine precursors as well as to some differentiating δ- and ε-cells but was not detected in differentiating β-cells. pax4 knock-down in zebrafish embryos caused a significant increase in α-cells number while having no apparent effect on β- and δ-cell differentiation. This rise of α-cells is due to an up-regulation of the Arx transcription factor. Conversely, knock-down of arx caused to a complete loss of α-cells and a concomitant increase of pax4 expression but had no effect on the number of β- and δ-cells. In addition to the mutual repression between Arx and Pax4, these two transcription factors negatively regulate the transcription of their own gene. Interestingly, disruption of pax4 RNA splicing or of arx RNA splicing by morpholinos targeting exon-intron junction sites caused a blockage of the altered transcripts in cell nuclei allowing an easy characterization of the arx- and pax4-deficient cells. Such analyses demonstrated that arx knock-down in zebrafish does not lead to a switch of cell fate, as reported in mouse, but rather blocks the cells in their differentiation process towards α-cells.
Conclusions
In zebrafish, pax4 is not required for the generation of the first β- and δ-cells deriving from the dorsal pancreatic bud, unlike its crucial role in the differentiation of these cell types in mouse. On the other hand, the mutual repression between Arx and Pax4 is observed in both mouse and zebrafish. These data suggests that the main original function of Pax4 during vertebrate evolution was to modulate the number of pancreatic α-cells and its role in β-cells differentiation appeared later in vertebrate evolution.
... Solnica - Krezel et al . 1996 ; Milewski , Duguay et al . 1998 ) . ...
The pancreas is located below the liver and adjacent to the small intestine where it connects to the duodenum. It consists of exocrine and endocrine components. The exocrine portion makes enzymes which are deposited in the duodenum to digest fats, proteins, and carbohydrates. Exocrine tissue also makes bicarbonates that neutralize stomach acids. The endocrine portion produces hormones such as insulin and glucagon which are released into the blood stream. These hormones regulate glucose transport into the body's cells and are crucial for energy production. The pancreas is associated with diseases such as cancer, diabetes, Annular pancreas and Nesidioblastosis. Annular pancreas and Nesidioblastosis are congenital malformations associated with excess endocrine tissue of the pancreas and its structures. Understanding the development of the pancreas might lead to insight of these diseases.
The pancreas arises from the endoderm. In zebrafish, Nodal signaling activates mix-type and gata genes that then function together to regulate sox32 expression which is necessary and sufficient to induce endoderm formation. Interestingly, sox32 is exclusive to zebrafish and works synergistically with pou5f1 to regulate its own expression and turn on sox17 expression. sox17 is evolutionarily conserved from zebrafish to mouse and is necessary for endoderm formation.
Signals from within the endoderm and the surrounding mesoderm specify regions in the endoderm to develop into the pancreas and other endodermal organs. Sonic hedgehog (shh) expression in the foregut establishes the anterior boundary of the pancreas primordium while cdx4 expression establishes the posterior boundary, but what regulates these factors is unclear. We determined that two Three Amino Acid Loop Extension (TALE) homeodomain transcription cofactors, Meis3 and Pbx4, regulate shh expression in the anterior endoderm. Disrupting either meis3 or pbx4 reduces shh expression in the anterior endoderm. As a result, anterior ectopic insulin expression occurs outside the normal pancreatic domain. Therefore, we discovered upstream regulatory factors of shh expression in the anterior endoderm, which is necessary for patterning the endoderm and pancreas primordium.
We performed an ENU (N-ethyl-N-nitrosurea) haploid screen to look for endocrine pancreas mutants and to find other factors involved in pancreas development and patterning. From the screen, we characterized two mutants. We identified an aldh1a2 mutant, aldh1a2um22, which blocks the production of Retinoic Acid (RA) from vitamin A. While RA is known to be necessary for differentiation of the pancreas and liver, we also found it to be necessary for intestine differentiation. Two other aldh family genes exist in the zebrafish genome, but our data suggests that aldh1a2 is the only Aldh that functions in endoderm differentiation and it is maternally deposited.
From the screen, we discovered a second mutant, 835.4, that spontaneously arose within the background. pou5f1 expression is normal in mutant embryos, but sox32 expression is reduced and sox17 expression is lost. Downstream endoderm genes of sox17 are also lost and as a result no endodermal organs develop. Rescue experiments indicate that the mutation is located between sox32 and sox17 in the endoderm pathway. We currently have not been successful at mapping this mutation and therefore are unable to rule out the possibility that it lies in the sox17 gene. However, our data suggest that the mutation occurs in a new gene that is necessary for sox17 expression, potentially working with sox32 and/or pou5f1.
... T7 polymerase was used to generate antisense RNA. Riboprobes were also generated from the following plasmids: vsx2 (Batista et al., 2008), trypsin (Biemar et al., 2001), ifabp (Mudumana et al., 2004), c-myb (Thompson et al., 1998), insulin (Milewski et al., 1998), dlx2a (Akimenko et al., 1994), and nkx2.3 (Lee et al., 1996). ...
The regulation of cell cycle rate is essential for the correct timing of proliferation and differentiation during development. Changes to cell cycle rate can have profound effects on the size, shape and cell types of a developing organ. We previously identified a zebrafish mutant ceylon (cey) that has a severe reduction in T cells and hematopoietic stem/progenitor cells (HSPCs). Here we find that the cey phenotype is due to absence of the gene transducin (beta)-like 3 (tbl3). The tbl3 homolog in yeast regulates the cell cycle by maintaining rRNA levels and preventing p53-induced cell death. Zebrafish tbl3 is maternally expressed, but later in development its expression is restricted to specific tissues. Tissues expressing tbl3 are severely reduced in cey mutants, including HSPCs, the retina, exocrine pancreas, intestine, and jaw cartilage. Specification of these tissues is normal, suggesting the reduced size is due to a reduced number of differentiated cells. Tbl3 MO injection into either wild-type or p53-/- mutant embryos phenocopies cey, indicating that loss of tbl3 causes specific defects in cey. Progression of both hematopoietic and retinal development is delayed beginning at 3 day post fertilization due to a slowing of the cell cycle. In contrast to yeast, reduction of Tbl3 causes a slowing of the cell cycle without a corresponding increase in p53 induced cell death. These data suggest that tbl3 plays a tissue-specific role regulating cell cycle rate during development.
... Fluorescent and colorimetric whole mount in situ hybridisation was performed as previously described (Hauptmann and Gerster, 1994; Manfroid et al., 2007) with the following probes: sox9b (Yan et al., 2005), neurod (Korzh et al., 1998), pdx1 (Milewski et al., 1998), cp (Korzh et al., 2001), try (Biemar et al., 2001), ptf1a (Zecchin et al., 2004), tfa (Mudumana et al., 2004) and prox1a (Glasgow and Tomarev, 1998). Whole mount immunohistochemistry was described in Dong et al. (2007). ...
Recent zebrafish studies have shown that the late appearing pancreatic endocrine cells are derived from pancreatic ducts but the regulatory factors involved are still largely unknown. Here, we show that the zebrafish sox9b gene is expressed in pancreatic ducts where it labels the pancreatic Notch-responsive cells previously shown to be progenitors. Inactivation of sox9b disturbs duct formation and impairs regeneration of beta cells from these ducts in larvae. sox9b expression in the midtrunk endoderm appears at the junction of the hepatic and ventral pancreatic buds and, by the end of embryogenesis, labels the hepatopancreatic ductal system as well as the intrapancreatic and intrahepatic ducts. Ductal morphogenesis and differentiation are specifically disrupted in sox9b mutants, with the dysmorphic hepatopancreatic ducts containing misdifferentiated hepatocyte-like and pancreatic-like cells. We also show that maintenance of sox9b expression in the extrapancreatic and intrapancreatic ducts requires FGF and Notch activity, respectively, both pathways known to prevent excessive endocrine differentiation in these ducts. Furthermore, beta cell recovery after specific ablation is severely compromised in sox9b mutant larvae. Our data position sox9b as a key player in the generation of secondary endocrine cells deriving from pancreatic ducts in zebrafish.
... In humans, mutations in the Pdx1 gene have been associated with type 2 diabetes and maturity onset diabetes of the young 4 (MODY4) [12,13]. This role is conserved in evolution and impaired glucose tolerance has been observed in several animal models where Pdx1 protein levels have been depleted or reduced [10,14,15,16,17,18]. Furthermore, the diabetic phenotype observed following Pdx1 inactivation is reversible and blood glucose levels can be normalized if Pdx1 expression is reactivated [19]. ...
Maintaining sufficient levels of Pdx1 activity is a prerequisite for proper regulation of blood glucose homeostasis and beta cell function. Mice that are haploinsufficient for Pdx1 display impaired glucose tolerance and lack the ability to increase beta cell mass in response to decreased insulin signaling. Several studies have shown that post-translational modifications are regulating Pdx1 activity through intracellular localization and binding to co-factors. Understanding the signaling cues converging on Pdx1 and modulating its activity is therefore an attractive approach in diabetes treatment. We employed a novel technique called Nanofluidic Proteomic Immunoassay to characterize the post-translational profile of Pdx1. Following isoelectric focusing in nano-capillaries, this technology relies on a pan specific antibody for detection and it therefore allows the relative abundance of differently charged protein species to be examined simultaneously. In all eukaryotic cells tested we find that the Pdx1 protein separates into four distinct peaks whereas Pdx1 protein from bacteria only produces one peak. Of the four peaks in eukaryotic cells we correlate one of them to a phosphorylation Using alanine scanning and mass spectrometry we map this phosphorylation to serine 61 in both Min6 cells and in exogenous Pdx1 over-expressed in HEK293 cells. A single phosphorylation is also present in cultured islets but it remains unaffected by changes in glucose levels. It is present during embryogenesis but is not required for pancreas development.
... In addition, we found that the expressions of intestinal epithelium marker fabp2 [22], liver marker fabp10a [23], and exocrine pancratic marker pancreas specific transcription factor, 1a (ptf1a) [24] were also markedly reduced in the Ddx46 mutants at 3.5 dpf ( Figures 5E-5J). In contrast, expressions of endocrine pancreatic marker preproinsulin (ins) [25] and a myogenesis marker of the somite, myogenic differentiation 1 (myod1) [26], did not change in the Ddx46 hi2137/hi2137 mutant ( Figure 5K and L; Figure S5). Consistent with this result, Ddx46 was not expressed in pancreatic endocrine tissues ( Figure 4M) or the somite ( Figure 4H). ...
Spatially and temporally controlled gene expression, including transcription, several mRNA processing steps, and the export of mature mRNA to the cytoplasm, is essential for developmental processes. It is well known that RNA helicases of the DExD/H-box protein family are involved in these gene expression processes, including transcription, pre-mRNA splicing, and rRNA biogenesis. Although one DExD/H-box protein, Prp5, a homologue of vertebrate Ddx46, has been shown to play important roles in pre-mRNA splicing in yeast, the in vivo function of Ddx46 remains to be fully elucidated in metazoans. In this study, we isolated zebrafish morendo (mor), a mutant that shows developmental defects in the digestive organs and brain, and found that it encodes Ddx46. The Ddx46 transcript is maternally supplied, and as development proceeds in zebrafish larvae, its ubiquitous expression gradually becomes restricted to those organs. The results of whole-mount in situ hybridization showed that the expression of various molecular markers in these organs is considerably reduced in the Ddx46 mutant. Furthermore, splicing status analysis with RT-PCR revealed unspliced forms of mRNAs in the digestive organ and brain tissues of the Ddx46 mutant, suggesting that Ddx46 may be required for pre-mRNA splicing during zebrafish development. Therefore, our results suggest a model in which zebrafish Ddx46 is required for the development of the digestive organs and brain, possibly through the control of pre-mRNA splicing.
... The riboprobes used were ptf1a (Zecchin et al., 2004), hlxb9la (Wendik et al., 2004), trypsin (Biemar et al., 2001), pdx1 (Milewski et al., 1998), bmp2a (Thisse and Thisse, 2005), tfa (Mudumana et al., 2004), prox1 (Glasgow and Tomarev, 1998), and hhex (Ho et al., 1999). Whole-mount immunohistochemistry was described in Dong et al. (2007). ...
In vertebrates, pancreas and liver arise from bipotential progenitors located in the embryonic gut endoderm. Bone morphogenic protein (BMP) and fibroblast growth factor (FGF) signaling pathways have been shown to induce hepatic specification while repressing pancreatic fate. Here we show that BMP and FGF factors also play crucial function, at slightly later stages, in the specification of the ventral pancreas. By analyzing the pancreatic markers pdx1, ptf1a, and hlxb9la in different zebrafish models of BMP loss of function, we demonstrate that the BMP pathway is required between 20 and 24 h postfertilization to specify the ventral pancreatic bud. Knockdown experiments show that bmp2a, expressed in the lateral plate mesoderm at these stages, is essential for ventral pancreas specification. Bmp2a action is not restricted to the pancreatic domain and is also required for the proper expression of hepatic markers. By contrast, through the analysis of fgf10(-/-); fgf24(-/-) embryos, we reveal the specific role of these two FGF ligands in the induction of the ventral pancreas and in the repression of the hepatic fate. These mutants display ventral pancreas agenesis and ectopic masses of hepatocytes. Overall, these data highlight the dynamic role of BMP and FGF in the patterning of the hepatopancreatic region.
... Experimental and control embryos were developed for the same amount of time in the final colorimetric reaction for each probe tested. The dachb (Hammond et al., 2002), preproinsulin (Milewski et al., 1998), glucagon (Argenton et al., 1999), and somatostatin2 (Devos et al., 2002) probes were described previously. ...
All metazoans use insulin to control energy metabolism, but they secrete it from different cells: neurons in the central nervous system in invertebrates and endocrine cells in the gut or pancreas in vertebrates. Despite their origins in different germ layers, all of these insulin-producing cells share common functional features and gene expression patterns. In this study, we tested the role in insulin-producing cells of the vertebrate homologues of Dachshund, a transcriptional regulator that marks the earliest committed progenitors of the neural insulin-producing cells in Drosophila. Both zebrafish and mice expressed a single dominant Dachshund homologue in the pancreatic endocrine lineage, and in both species loss of this homologue reduced the numbers of all islet cell types including the insulin-producing β-cells. In mice, Dach1 gene deletion left the pancreatic progenitor cells unaltered, but blocked the perinatal burst of proliferation of differentiated β-cells that normally generates most of the β-cell mass. In β-cells, Dach1 bound to the promoter of the cell cycle inhibitor p27Kip1, which constrains β-cell proliferation. Taken together, these data demonstrate a conserved role for Dachshund homologues in the production of insulin-producing cells.
... The mouse Ipf1 gene was mapped to distal chromosome 5 and the human orthologue to 13q12 (Fiedorek and Kay 1995;Stoffel et al. 1995). An orthologous gene was also described in zebrafish, medaka, and Xenopus tropicalis (Milewski et al. 1998;Assouline et al. 2002;Illes et al. 2009). The approved gene name according to the gene nomenclature committees for human and mouse is pancreatic and duodenal homeobox 1 (Pdx1), and here, we utilize this nomenclature for the orthologous gene in all vertebrate species. ...
The Pdx1 or Ipf1 gene encodes an important homeodomain-containing protein with key roles in pancreas development and function. Mutations in human PDX1 are implicated in developmental defects and disease of the pancreas. Extensive research, including genome sequencing, has indicated that Pdx1 is the only member of its gene family in mammals, birds, amphibians, and ray-finned fish, and with the exception of teleost fish, this gene forms part of the ParaHox gene cluster along with Gsx1 and Cdx2. The ParaHox cluster, however, is a remnant of a 4-fold genome duplication; the three other ParaHox paralogues lack a Pdx-like gene in all vertebrate genomes examined to date. We have used bacterial artificial chromosome cloning and synteny analysis to show that the ancestor of living jawed vertebrates in fact had more ParaHox genes, including two Pdx genes (Pdx1 and Pdx2). Surprisingly, the two Pdx genes have been retained in parallel in two quite distantly related lineages, the cartilaginous fish (sharks, skates, and chimeras) and the Indonesian coelacanth, Latimeria menadoensis. The Pdx2 gene has been lost independently in ray-finned fish and in tetrapods.
... They were subsequently purified on NucAway spin columns (Ambion) and ethanol-precipitated. The zebrafish sox4b (Mavropoulos et al., 2005), isl1 (Korzh et al., 1993), neurod (Korzh et al., 1998), insulin (Milewski et al., 1998), somatostatin 2 (Devos et al., 2002), ghrelin (NCBI: AL918922) and glucagon (Argenton et al., 1999) probes have been described elsewhere. Single-wholemount, doublefluorescent in situ hybridizations and fluorescent imaging were carried out as described (Mavropoulos et al., 2005). ...
The transcription factor neurogenin 3 (Neurog3 or Ngn3) controls islet cell fate specification in multipotent pancreatic progenitor cells in the mouse embryo. However, our knowledge of the genetic programs implemented by Ngn3, which control generic and islet subtype-specific properties, is still fragmentary. Gene expression profiling in isolated Ngn3-positive progenitor cells resulted in the identification of the uncharacterized winged helix transcription factor Rfx6. Rfx6 is initially expressed broadly in the gut endoderm, notably in Pdx1-positive cells in the developing pancreatic buds, and then becomes progressively restricted to the endocrine lineage, suggesting a dual function in both endoderm development and islet cell differentiation. Rfx6 is found in postmitotic islet progenitor cells in the embryo and is maintained in all developing and adult islet cell types. Rfx6 is dependent on Ngn3 and acts upstream of or in parallel with NeuroD, Pax4 and Arx transcription factors during islet cell differentiation. In zebrafish, the Rfx6 ortholog is similarly found in progenitors and hormone expressing cells of the islet lineage. Loss-of-function studies in zebrafish revealed that rfx6 is required for the differentiation of glucagon-, ghrelin- and somatostatin-expressing cells, which, in the absence of rfx6, are blocked at the progenitor stage. By contrast, beta cells, whose number is only slightly reduced, were no longer clustered in a compact islet. These data unveil Rfx6 as a novel regulator of islet cell development.
... Two-color mRNA in situ hybridization was performed as described by Jowett and Lettice (Jowett and Lettice, 1994) with modifications according to Hauptmann and Gerster (Hauptmann and Gerster, 1994) and a combination of INT (2-(4-iodophenyl)-3-(4-nitrophenyl)-5phenyl-tetrazolium chloride) and BCIP (5-bromo-4-chloro-3-indolylphosphate), both at 175 µg/ml, was used as alkaline phosphatase substrate in the second color reaction producing a red-brown color. The following probes were used: cmlc2 (Yelon and Stainier, 1999), cathepsin L (hgg1 -Zebrafish Information Network) (Vogel and Gerster, 1997), krox20 (egr2 -Zebrafish Information Network) (Oxtoby and Jowett, 1993), preproinsulin (ins -Zebrafish Information Network) (Milewski et al., 1998), myoD (myod -Zebrafish Information Network) (Weinberg et al., 1996), nos1 (a zebrafish nanos homolog expressed specifically in PGCs) (Köprunner et al., 2001), ntl (Schulte-Merker et al., 1994), papc (pcdh8 -Zebrafish Information Network) (Yamamoto et al., 1998), pax2.1 (pax2a -Zebrafish Information Network) (Krauss et al., 1991), pax8 (Pfeffer et al., 1998), wt1 (Serluca and Fishman, 2001). ...
Migration of primordial germ cells (PGCs) from their site of specification towards the developing gonad is controlled by directional cues from somatic tissues. Although in several animals the PGCs are attracted by signals emanating from their final target, the gonadal mesoderm, little is known about the mechanisms that control earlier steps of migration. We provide evidence that a key step of zebrafish PGC migration, in which the PGCs become organized into bilateral clusters in the anterior trunk, is regulated by attraction of PGCs towards an intermediate target. Time-lapse observations of wild-type and mutant embryos reveal that bilateral clusters are formed at early somitogenesis, owing to migration of PGCs towards the clustering position from medial, posterior and anterior regions. Furthermore, PGCs migrate actively relative to their somatic neighbors and they do so as individual cells. Using mutants that exhibit defects in mesoderm development, we show that the ability to form PGC clusters depends on proper differentiation of the somatic cells present at the clustering position. Based on these findings, we propose that these somatic cells produce signals that attract PGCs. Interestingly, fate-mapping shows that these cells do not give rise to the somatic tissues of the gonad, but rather contribute to the formation of the pronephros. Thus, the putative PGC attraction center serves as an intermediate target for PGCs, which later actively migrate towards a more posterior position. This final step of PGC migration is defective in hands off mutants, where the intermediate mesoderm of the presumptive gonadal region is mispatterned. Our results indicate that zebrafish PGCs are guided by attraction towards two signaling centers, one of which may represent the somatic tissues of the gonad.
Vital internal organs display a left-right (LR) asymmetric arrangement that is established during embryonic development. Disruption of this LR asymmetry—or laterality—can result in congenital organ malformations. Situs inversus totalis (SIT) is a complete concordant reversal of internal organs that results in a low occurrence of clinical consequences. Situs ambiguous, which gives rise to Heterotaxy syndrome (HTX), is characterized by discordant development and arrangement of organs that is associated with a wide range of birth defects. The leading cause of health problems in HTX patients is a congenital heart malformation. Mutations identified in patients with laterality disorders implicate motile cilia in establishing LR asymmetry. However, the cellular and molecular mechanisms underlying SIT and HTX are not fully understood. In several vertebrates, including mouse, frog and zebrafish, motile cilia located in a “left-right organizer” (LRO) trigger conserved signaling pathways that guide asymmetric organ development. Perturbation of LRO formation and/or function in animal models recapitulates organ malformations observed in SIT and HTX patients. This provides an opportunity to use these models to investigate the embryological origins of laterality disorders. The zebrafish embryo has emerged as an important model for investigating the earliest steps of LRO development. Here, we discuss clinical characteristics of human laterality disorders, and highlight experimental results from zebrafish that provide insights into LRO biology and advance our understanding of human laterality disorders.
Diese Arbeit widmet sich dem Aufbau und den Funktionen von TRPP2.
TRPP2-Mutationen verursachen im Menschen die Autosomal Dominante Polyzystische Nierenerkrankung. Sie gehört zu den häufigsten, monogenetischen, potentiell letalen, hereditären Erkrankungen [1; 84; 113]. Die verantwortlichen Gene PKD1 und PKD2 kodieren für die membranständigen Zilienproteine Polycystin-1 und TRPP2 [84; 113]. Bisher ist der molekulare Mechanismus der Entstehung der ADPKD nicht geklärt und es mangelt an kausalen Therapieansätzen.
Aufgrund der guten Anwendbarkeit genetischer Methoden und dem hohen Anteil an phylogenetisch zusammenhängenden Genen wurde TRPP2 in D. melanogaster untersucht. Das TRPP2-Homolog in D. melanogaster ist amo. Seine Mutation bewirkt einen Spermienspeicherungsdefekt und eine damit einhergehende männliche Infertilität [94; 196]. In dieser Arbeit wurde die Spermienbewegung in D. melanogaster charakterisiert, die Spermiengeschwindigkeit zu verschiedenen Zeitpunkten erfasst und eine Referenz für das Bewegungsmuster von Wildtyp-Spermien im weiblichen Rezeptakulum von D. melanogaster etabliert. Diese soll die Grundlage für künftige Vergleichsstudien mit amo -/- und anderen Mutationen bieten und Rückschlüsse auf spermienspezifische Proteine, ihre Funktion und ihre Einbettung in Signalwege ermöglichen, die für die physiologische und gerichtete Spermienbewegung, die Orientierung der Zelle im Raum, ihre Polarität und die Zystenentstehung wichtig sein können. Die Durchschnittsgeschwindigkeit von Wildtyp-Spermien im weiblichen Rezeptakulum wurde erstmalig bestimmt und liegt bei etwa 30 μm/s.
Neben der phänotypischen Charakterisierung von Amo wurden auch molekularbiologische und biochemische Untersuchungen zu Amo durchgeführt: Da Zystenbildung unter anderem durch fehlerhafte TRPP2-Glykan-Prozessierung hervorgerufen wird, wurde Amo auf Glykosylierungen untersucht und als Glykoprotein identifiziert.
Desweiteren wurde der Frage nach möglichen Kandidaten im Amo-Signalweg nachgegangen: Die Z3-2147-Fliege wurde in der Zuker-Sammlung erzeugt und aufgrund ihres männlich-infertilen, dem amo -/- ähnlichen Phänotyps identifiziert [80; 96; 193]. Die pathogene Mutation der Fliegenlinie Z32147 wurde weiter charakterisiert und auf das CG32103-Gen zurückgeführt, dessen Protein im Mitochondrium nachgewiesen wurde.
Somit etabliert diese Arbeit eine molekulare Verbindung zwischen Amo/TRPP2 in Zilien und CG32103/SLC25A25 in Mitochondrien.
Building a left-right (L-R) asymmetric organ requires asymmetric information. This comes from various sources, including asymmetries in embryo-scale genetic cascades, organ-intrinsic mechanical forces, and cell-level chirality, but the relative influence of these sources and how they collaborate to drive asymmetric morphogenesis is not understood. During zebrafish heart development, the linear heart tube extends to the left of the midline in a process known as jogging. The jogged heart then undergoes dextral (i.e. rightward) looping to correctly position the heart chambers relative to one another. Left lateralized jogging is governed by the left-sided expression of Nodal in mesoderm tissue, while looping laterality is mainly controlled by heart-intrinsic cell-level asymmetries in the actomyosin cytoskeleton. The purpose of lateralized jogging is not known. Moreover, after jogging, the heart tube returns to a midline position and so it is not clear whether or how jogging may impact the dextral loop. Here, we characterize a novel loss-of-function mutant in the zebrafish Nodal homolog southpaw (spaw) that appears to be a true null. We then assess the relationship between jogging and looping laterality in embryos lacking asymmetric Spaw signals. We found that the probability of a dextral loop occurring, as opposed to improper lateralization of looping, does not depend on asymmetric Spaw signals per se, but does depend on the laterality of jogging. Thus, we conclude that the role of leftward jogging is to spatially position the heart tube in a manner that promotes robust dextral looping. When jogging laterality is abnormal, the robustness of dextral looping decreases. This establishes a cooperation between embryo-scale Spaw-dependent L-R asymmetries and organ-intrinsic cellular chirality in the control of asymmetric heart morphogenesis and shows that the transient laterality of the early heart tube has consequences for later heart morphogenetic events.
DYX1C1 has been associated with dyslexia and neuronal migration in the developing neocortex. Unexpectedly, we found that deleting exons 2-4 of Dyx1c1 in mice caused a phenotype resembling primary ciliary dyskinesia (PCD), a disorder characterized by chronic airway disease, laterality defects and male infertility. This phenotype was confirmed independently in mice with a Dyx1c1 c.T2A start-codon mutation recovered from an N-ethyl-N-nitrosourea (ENU) mutagenesis screen. Morpholinos targeting dyx1c1 in zebrafish also caused laterality and ciliary motility defects. In humans, we identified recessive loss-of-function DYX1C1 mutations in 12 individuals with PCD. Ultrastructural and immunofluorescence analyses of DYX1C1-mutant motile cilia in mice and humans showed disruptions of outer and inner dynein arms (ODAs and IDAs, respectively). DYX1C1 localizes to the cytoplasm of respiratory epithelial cells, its interactome is enriched for molecular chaperones, and it interacts with the cytoplasmic ODA and IDA assembly factor DNAAF2 (KTU). Thus, we propose that DYX1C1 is a newly identified dynein axonemal assembly factor (DNAAF4).
Abstract Experimental studies in the zebrafish have greatly facilitated understanding of genetic regulation of the early developmental events in the pancreas. Various approaches using forward and reverse genetics, chemical genetics, and transgenesis in zebrafish have demonstrated generally conserved regulatory roles of mammalian genes and discovered novel genetic pathways in exocrine pancreatic development. Accumulating evidence has supported the use of zebrafish as a model of human malignant diseases, including pancreatic cancer. Studies have shown that the genetic regulators of exocrine pancreatic development in zebrafish can be translated into potential clinical biomarkers and therapeutic targets in human pancreatic adenocarcinoma. Transgenic zebrafish expressing oncogenic K-ras and zebrafish tumor xenograft model have emerged as valuable tools for dissecting the pathogenetic mechanisms of pancreatic cancer and for drug discovery and toxicology. Future analysis of the pancreas in zebrafish will continue to advance understanding of the genetic regulation and biological mechanisms during organogenesis. Results of those studies are expected to provide new insights into how aberrant developmental pathways contribute to formation and growth of pancreatic neoplasia, and hopefully generate valid biomarkers and targets as well as effective and safe therapeutics in pancreatic cancer.
We have investigated the biological and biochemical functions of the Cripto gene, which encodes an extracellular protein that is a member of the EGF-CFC gene family, and which has been implicated in autocrine/paracrine signaling during human breast carcinogenesis. To elucidate the potential role of Cripto in mammary development and tumorigenesis, we have analyzed the in vivo activities of Cripto using transgenic mice that overexpress Cripto in the mammary gland, as well as the molecular mechanisms of CRIPTO protein function. In the past four years, we have generated molecular genetic and biochemical lines of evidence that Cripto acts as an essential co-factor for signaling by the divergent TGF-% factor Nodal. These findings provide a model for potential mechanisms of Cripto function through modulation of specific TGF-%-related signals in mammary development and tumorigenesis.
The sections in this article are:
Insulin Gene Expression
Principal Factors Regulating Insulin Gene Transcription
C2 Element
Z‐Element Region
A Elements
C1/RIPE3b1 Element
E Element
Other Key Pancreatic Cell Transcriptional Regulators
Targeted Disruption of Insulin Transcriptional Activators
PDX‐1 in Pancreatic Islet and Exocrine Cell Development
Isl‐1, Pax‐6, Pax‐4, and BETA2/NeuroD in Islet Endocrine Cell Development
Other Transcription Factors Necessary for Islet Cell Development
Factors Regulating pdx‐1 Gene Transcription
New Perspectives
Summary
Cilia are essential for fertilization, respiratory clearance, cerebrospinal fluid circulation and establishing laterality. Cilia motility defects cause primary ciliary dyskinesia (PCD, MIM244400), a disorder affecting 1:15,000-30,000 births. Cilia motility requires the assembly of multisubunit dynein arms that drive ciliary bending. Despite progress in understanding the genetic basis of PCD, mutations remain to be identified for several PCD-linked loci. Here we show that the zebrafish cilia paralysis mutant schmalhans (smh(tn222)) encodes the coiled-coil domain containing 103 protein (Ccdc103), a foxj1a-regulated gene product. Screening 146 unrelated PCD families identified individuals in six families with reduced outer dynein arms who carried mutations in CCDC103. Dynein arm assembly in smh mutant zebrafish was rescued by wild-type but not mutant human CCDC103. Chlamydomonas Ccdc103/Pr46b functions as a tightly bound, axoneme-associated protein. These results identify Ccdc103 as a dynein arm attachment factor that causes primary ciliary dyskinesia when mutated.
Presence of all three ParaHox genes has been described in deuterostomes and lophotrochozoans, but to date one of these three genes, Xlox has not been reported from any ecdysozoan taxa and both Xlox and Gsx are absent in nematodes. There is evidence that the ParaHox genes were ancestrally a single chromosomal cluster. Colinear expression of the ParaHox genes in anterior, middle, and posterior tissues of several species studied so far suggest that these genes may be responsible for axial patterning of the digestive tract. So far, there are no data on expression of these genes in molluscs.
We isolated the complete coding sequences of the three Gibbula varia ParaHox genes, and then tested their expression in larval and postlarval development. In Gibbula varia, the ParaHox genes participate in patterning of the digestive tract and are expressed in some cells of the neuroectoderm. The expression of these genes coincides with the gradual formation of the gut in the larva. Gva-Gsx patterns potential neural precursors of cerebral ganglia as well as of the apical sensory organ. During larval development this gene is involved in the formation of the mouth and during postlarval development it is expressed in the precursor cells involved in secretion of the radula, the odontoblasts. Gva-Xolx and Gva-Cdx are involved in gut patterning in the middle and posterior parts of digestive tract, respectively. Both genes are expressed in some ventral neuroectodermal cells; however the expression of Gva-Cdx fades in later larval stages while the expression of Gva-Xolx in these cells persists.
In Gibbula varia the ParaHox genes are expressed during anterior-posterior patterning of the digestive system. This colinearity is not easy to spot during early larval stages because the differentiated endothelial cells within the yolk permanently migrate to their destinations in the gut. After torsion, Gsx patterns the mouth and foregut, Xlox the midgut gland or digestive gland, and Cdx the hindgut. ParaHox genes of Gibbula are also expressed during specification of cerebral and ventral neuroectodermal cells. Our results provide additional support for the ancestral complexity of Gsx expression and its ancestral role in mouth patterning in protostomes, which was secondarily lost or simplified in some species.
Pax6 is a well conserved transcription factor that contains two DNA-binding domains, a paired domain and a homeodomain, and plays a key role in the development of eye, brain, and pancreas in vertebrates. The recent identification of the zebrafish sunrise mutant, harboring a mutation in the pax6b homeobox and presenting eye abnormalities but no obvious pancreatic defects, raised a question about the role of pax6b in zebrafish pancreas. We show here that pax6b does play an essential role in pancreatic endocrine cell differentiation, as revealed by the phenotype of a novel zebrafish pax6b null mutant and of embryos injected with pax6b morpholinos. Pax6b-depleted embryos have almost no beta cells, a strongly reduced number of delta cells, and a significant increase of epsilon cells. Through the use of various morpholinos targeting intron-exon junctions, pax6b RNA splicing was perturbed at several sites, leading either to retention of intronic sequences or to deletion of exonic sequences in the pax6b transcript. By this strategy, we show that deletion of the Pax6b homeodomain in zebrafish embryos does not disturb pancreas development, whereas lens formation is strongly affected. These data thus provide the explanation for the lack of pancreatic defects in the sunrise pax6b mutants. In addition, partial reduction of Pax6b function in zebrafish embryos performed by injection of small amounts of pax6b morpholinos caused a clear rise in alpha cell number and in glucagon expression, emphasizing the importance of the fine tuning of the Pax6b level to its biological activity.
Die Betazellmasse wird durch Apoptose, Proliferation und Neogenese aus Vorläuferzellen an den Bedarf des Organismus angepasst. Fehlregulationen und Verlust der Anpassungsfähigkeit sind Ursachen für Diabetes mellitus Typ-2. IDX-1 ist sowohl ein Hauptentwicklungsfaktor des embryonalen Pankreas als auch an der Regulation von Neogenese und Proliferation der adulten Betazellen beteiligt. Betazellproliferation und Differenzierung werden durch Faktoren wie GLP-1 oder milde Hyperglykämie stimuliert und gehen mit einer Aktivierung von IDX-1 einher. In der Arbeit sollte der Einfluss von GLP-1 und milder Hyperglykämie auf die Expression, besonders die Transkription, des Transkriptionsfaktors IDX-1 in insulinproduzierenden Betazellen des endokrinen Pankreas untersucht werden. Ferner wurde eine mögliche Autoregulation des IDX-1 Promotors durch IDX-1 untersucht. Als Modell für adulte Betazellen wurden klonale Betazellen INS-1 und MIN6 verwendet. Die IDX-1 Expression wurde auf mRNA Ebene im Northern Blot und auf Proteinebene mittels Western Blot untersucht. Der Promotor des IDX-1 Gens wurde Mithilfe von Luziferasereportergenassays und EMSA untersucht. Die Expression von IDX-1 Protein und mRNA wird durch milde Hyperglykämie stimuliert. Dieser Effekt ist auf eine Aktivierung des IDX-1 Promotors zurückzuführen. Die Aktivierung innerhalb des Promotors konnte auf zwei Regionen eingeschränkt werden. Diese befinden sich im IDX Promotor in den -900 bp bis -300 bp und den 230 bp vor Beginn der kodierenden Sequenz des IDX-1 Gens. Im EMSA konnte ein glukoseabhängiger Komplex (-49 bp bis -44 bp) nachgewiesen werden, an den USF-1 und USF-2 binden. USFs sind für glukoseabhängige Genregulation in Leber und Pankreas bekannt. Eine Mutation der Bindungsstelle führte zum Verlust des Bindungskomplexes. In Luziferasereportergenassays beobachtete man eine Verringerung der glukoseinduzierten Aktivierung. Für GLP-1 konnte kein eindeutiger Einfluss auf die Expression von IDX-1 gezeigt werden. Als Anzeichen für eine mögliche Autoregulation des IDX-1 Promotors durch IDX-1 wurde bei Überexpression von IDX-1 in Betazellen eine verringerte Promotoraktivität festgestellt. Der in dieser Arbeit untersuchte Transkriptionsfaktor IDX-1 spielt eine Schlüsselrolle in der Regulation der Betazellmasse des endokrinen Pankreas. Es ist wichtig die molekularen Mechanismen der Regulation der Betazellmasse zu verstehen; Erkenntnisse darüber eröffnen einerseits ein besseres Verständnis der Pathogenese des Diabetes mellitus, andererseits stellen sie hoffnungsvolle neue Therapieansätze da. x
We present a detailed protocol for In Situ hybridization of messenger RNA molecules in brain and other tissues, using 35S-labeled single-stranded RNA transcribed from commercially available plasmid vectors. These vectors contain promoter sequences for specific synthesis of RNA, and polylinker regions that will accept cDNA inserts for virtually any target molecule of interest. The protocol is optimized for studies that include concomitant irnmunohistochemical and cytoarchitectonic evaluations, and it is sufficiently detailed for the molecular biologist unfamiliar with histologic technique or the histologist inexperienced in molecular biological methods. We have used it with consistant results for In Situ hybridization studies using probes to more than twenty different mRNAs; and for several of those we have obtained results showing quantitative differences in experimentally altered mRNA levels. Included are details of perfusion fixation, tissue sectioning and preparation, probe synthesis, hybridization reaction, and signal detection. The introduction and annotated comments include rationale for basic procedures and the purpose of various specific steps in the hybridization histochemistry protocol. (The J HistotechnoL 12:169, 1989).
Evidence for the presence of peptides, related to insulin-like growth factor 1 (IGF-1) has been obtained in serum and various organs of representatives of osteichthyes and chrondrichthyes, i.e., the bony fish Myoxocephalus (Cottus) scorpius and the cartilaginous fish Raja clavata. The peptides were identified by means of gel chromatography and an IGF-1 radioimmunoassay. IGF-1-like immunoreactivity was detected in three different apparent molecular mass forms, i.e., 17 kDa, 6 kDa and 4 kDa, the occurrence of which seemed to depend on the species. When the same antiserum was used immunohistochemically, IGF-1-like immunoreactivity was observed in endocrine cells of the open type in the intestinal mucosal epithelium. These cells exhibited distinct and species-specific distribution patterns. Endocrine cells of the pancreas as well as epithelial cells of the pancreatic duct also showed IGF-1-like immunoreactivity. Occasionally, IGF-1-like immunoreactivity was observed also in interstitial cells. The distribution patterns and densities of the IGF-like immunoreactive cells correlated with the results obtained by radioimmunoassay of the crude extracts. Absorption studies indicated that the IGF-1-like peptides observed differ from mammalian and submammalian insulins as well as from mammalian IGF-1.
A number of homeodomain proteins have been shown to regulate cellular development by stimulating the transcription of specific
target genes. In contrast to their distinct activities in vivo, however, most homeodomain proteins bind indiscriminately to
potential target sites in vitro, suggesting the involvement of cofactors which specify target site selection. One such cofactor,
termed extradenticle, has been shown to influence segmental morphogenesis in Drosophila melanogaster by binding cooperatively
with certain homeodomain proteins to target regulatory elements. Here we demonstrate that STF-1, an orphan homeodomain protein
required for pancreatic development in mammals, binds cooperatively to DNA with Pbx, the mammalian homolog of extradenticle.
Cooperative binding with Pbx requires a pentapeptide motif (FPWMK) which is well conserved among a large subset of homeodomain
proteins. The FPMWK motif is not sufficient to confer Pbx cooperativity on other homeodomain proteins, however; the N-terminal
arm of the STF-1 homeodomain is also essential. As cooperative binding with Pbx occurs on only a subset of potential STF-1
target sites, our results suggest that Pbx may specify target gene selection in the developing pancreas by forming heterodimeric
complexes with STF-1.
A new approach to rapid sequence comparison, basic local alignment search tool (BLAST), directly approximates alignments that optimize a measure of local similarity, the maximal segment pair (MSP) score. Recent mathematical results on the stochastic properties of MSP scores allow an analysis of the performance of this method as well as the statistical significance of alignments it generates. The basic algorithm is simple and robust; it can be implemented in a number of ways and applied in a variety of contexts including straightforward DNA and protein sequence database searches, motif searches, gene identification searches, and in the analysis of multiple regions of similarity in long DNA sequences. In addition to its flexibility and tractability to mathematical analysis, BLAST is an order of magnitude faster than existing sequence comparison tools of comparable sensitivity.
Rats and mice have two, equally expressed, nonallelic genes encoding preproinsulin (genes I and II). Cytological hybridization
with metaphase chromosomes indicated that both genes reside on rat chromosome I but are approximately 100,000 kilobases apart.
In mice the two genes reside on two different chromosomes. DNA sequence comparisons of the gene-flanking regions in rats and
mice indicated that the preproinsulin gene I has lost one of the two introns present in gene II, is flanked by a long (41-base)
direct repeat, and has a remnant of a polydeoxyadenylate acid tract preceding the downstream direct repeat. These structural
features indicated that gene I was generated by an RNA-mediated duplication-transposition event involving a transcript of
gene II which was initiated upstream from the normal capping site. Sequence divergence analysis indicated that the pair of
the original gene and its retroposed, but functional, counterpart (which appeared about 35 million years ago) is maintained
by strong negative selection operating primarily on the segments encoding the chains of the mature hormone, whereas the segments
encoding the parts of the polypeptide that are eliminated during processing and also the introns and the flanking regions
are evolving neutrally.
We have devised a simple and efficient cDNA cloning strategy that overcomes many of the difficulties encountered in obtaining full-length cDNA clones of low-abundance mRNAs. In essence, cDNAs are generated by using the DNA polymerase chain reaction technique to amplify copies of the region between a single point in the transcript and the 3' or 5' end. The minimum information required for this amplification is a single short stretch of sequence within the mRNA to be cloned. Since the cDNAs can be produced in one day, examined by Southern blotting the next, and readily cloned, large numbers of full-length cDNA clones of rare transcripts can be rapidly produced. Moreover, separation of amplified cDNAs by gel electrophoresis allows precise selection by size prior to cloning and thus facilitates the isolation of cDNAs representing variant mRNAs, such as those produced by alternative splicing or by the use of alternative promoters. The efficacy of this method was demonstrated by isolating cDNA clones of mRNA from int-2, a mouse gene that expresses four different transcripts at low abundance, the longest of which is approximately 2.9 kilobases. After less than 0.05% of the cDNAs produced had been screened, 29 independent int-2 clones were isolated. Sequence analysis demonstrated that the 3' and 5' ends of all four int-2 mRNAs were accurately represented by these clones.
The mouse homeodomain protein insulin promoter factor-1 (IPF-1) and the rat homologue somatostatin transactivating factor-1 (STF-1) are involved in early pancreatic development and have been implicated in the cell-specific regulation of insulin- and somatostatin-gene expression in mature islet beta- and delta-cells. The cell specificity of IPF-1/STF-1 expression in mature islets is, however, still unclear. Using antisera against recombinant IPF-1 and STF-1 in combination with antisera against islet hormones we find that all beta-cells in monolayers of newborn rat islet cells express STF-1, as do a fraction of the delta-cells. In adult rat and mouse pancreas we find a similar distribution. IPF-1/STF-1 expression was not detected in glucagon-producing alpha-cells. In islet cell tumour models we found that a glucagon/islet amyloid polypeptide (IAPP)-producing pluripotent rat islet cell line (NHI-6F-GLU) expresses STF-1 in all cells prior to insulin gene activation induced by in vivo culture. In contrast, a mouse alpha-cell line (alpha TC1) exclusively expressed IPF-1 in a small subset of insulin-producing cells while an insulin-negative subclone (alpha TC1.9) was negative for IPF-1. In transfection experiments using alpha TC1.9 cells STF-1 activated a rat insulin 1 reporter gene dependent not only on both STF-1-binding sites, but also on the E1-binding site for the helix-loop-helix factor IEF-1. However, the endogenous mouse insulin genes remained inactive in these cells. These results suggest that the insulin promoter acquires its very high, yet cell-specific, activity at least partly through the action of IPF-1/STF-1. This action is dependent on helix-loop-helix factors bound to the E1 element.
The XlHbox 8 homeodomain protein of Xenopus and STF-1, its mammalian homolog, are selectively expressed by beta cells of adult mouse pancreatic islets, where they are likely to regulate insulin expression. We sought to determine whether the expression of the homeobox protein/s during mouse embryonic development was specific to beta cells or, alternatively, whether XlHbox 8/STF-1 protein/s were initially expressed by multipotential precursors and only later became restricted to the insulin-containing cells. With two antibodies, we studied the localization of STF-1 during murine pancreatic development. In embryos, as in adults, STF-1 was expressed by most beta cells, by subsets of the other islet cell types and by mucosal epithelial cells of the duodenum. In addition, most epithelial cells of the pancreatic duct and exocrine cells of the pancreas transiently contained STF-1. We conclude that in mouse, STF-1 not only labels a domain of intestinal epithelial cells but also provides a spatial and temporal marker of endodermal commitment to a pancreatic and subsequently, to an endocrine beta cell fate. We propose a model of pancreatic cell development that suggests that exocrine and endocrine (alpha, beta, delta and PP) cells arise from a common precursor pool of STF-1+ cells and that progression towards a defined monospecific non-beta cell type is correlated with loss of STF-1 expression.
We describe the cloning from a rat islet somatostatin-producing cell line of a 1.4 kb cDNA encoding a new homeoprotein, IDX-1 (islet/duodenum homeobox-1), with close sequence similarity to the Drosophila melanogaster homeobox protein Antennapedia (Antp) and the Xenopus laevis endoderm-specific homeoprotein XlHbox8. Analyses of IDX-1 mRNA and protein in rat tissues show that IDX-1 is expressed in pancreatic islets and ducts and in the duodenum. In electrophoretic mobility shift assays IDX-1 binds to three sites in the 5' flanking region of the rat somatostatin gene. In co-transfection experiments IDX-1 transactivates reporter constructs containing somatostatin promoter sequences, and mutation of the IDX-1 binding sites attenuates transactivation. Reverse transcription-polymerase chain reaction of islet RNA using degenerate amplimers for mRNAs encoding homeoproteins indicates that IDX-1 is the most abundant of 12 different Antp-like homeodomain mRNAs expressed in adult rat islets. The pattern of expression, relative abundance and transcriptional regulatory activity suggests that IDX-1 may be involved in the regulation of islet hormone genes and in cellular differentiation in the endocrine pancreas and the duodenum.
We have previously shown that mice carrying a null mutation in the homeobox gene ipf1, now renamed to pdx1, selectively lack a pancreas. To elucidate the level at which PDX1 is required during the development of the pancreas, we have in this study analyzed the early stages of pancreas ontogeny in PDX-/- mice. These analyses have revealed that the early inductive events leading to the formation of the pancreatic buds and the appearance of the early insulin and glucagon cells occur in the PDX1-deficient embryos. However, the subsequent morphogenesis of the pancreatic epithelium and the progression of differentiation of the endocrine cells are arrested in the pdx1-/- embryos. In contrast, the pancreatic mesenchyme grows and develops, both morphologically and functionally, independently of the epithelium. We also show that the pancreatic epithelium in the pdx1 mutants is unable to respond to the mesenchymal-derived signal(s) which normally promote pancreatic morphogenesis. Together these data provide evidence that PDX-1 acts cell autonomously and that the lack of a pancreas in the pdx1-/- mice is due to a defect in the pancreatic epithelium.
It has been proposed that the Xenopus homeobox gene, XlHbox8, is involved in endodermal differentiation during pancreatic and duodenal development (Wright, C.V.E., Schnegelsberg, P. and De Robertis, E.M. (1988). Development 105, 787-794). To test this hypothesis directly, gene targeting was used to make two different null mutations in the mouse XlHbox8 homolog, pdx-1. In the first, the second pdx-1 exon, including the homeobox, was replaced by a neomycin resistance cassette. In the second, a lacZ reporter was fused in-frame with the N terminus of PDX-1, replacing most of the homeodomain. Neonatal pdx-1 -/- mice are apancreatic, in confirmation of previous reports (Jonsson, J., Carlsson, L., Edlund, T. and Edlund, H. (1994). Nature 371, 606-609). However, the pancreatic buds do form in homozygous mutants, and the dorsal bud undergoes limited proliferation and outgrowth to form a small, irregularly branched, ductular tree. This outgrowth does not contain insulin or amylase-positive cells, but glucagon-expressing cells are found. The rostral duodenum shows a local absence of the normal columnar epithelial lining, villi, and Brunner's glands, which are replaced by a GLUT2-positive cuboidal epithelium resembling the bile duct lining. Just distal of the abnormal epithelium, the numbers of enteroendocrine cells in the villi are greatly reduced. The PDX-1/beta-galactosidase fusion allele is expressed in pancreatic and duodenal cells in the absence of functional PDX-1, with expression continuing into perinatal stages with similar boundaries and expression levels. These results offer additional insight into the role of pdx-1 in the determination and differentiation of the posterior foregut, particularly regarding the proliferation and differentiation of the pancreatic progenitors.
The zebrafish gastrointestinal system matures in a manner akin to higher vertebrates. We describe nine mutations that perturb development of these organs. Normally, by the fourth day postfertilization the digestive organs are formed, the epithelial cells of the intestine are polarized and express digestive enzymes, the hepatocytes secrete bile, and the pancreatic islets and acini generate immunoreactive insulin and carboxypeptidase A, respectively. Seven mutations cause arrest of intestinal epithelial development after formation of the tube but before cell polarization is completed. These perturb different regions of the intestine. Six preferentially affect foregut, and one the hindgut. In one of the foregut mutations the esophagus does not form. Two mutations cause hepatic degeneration. The pancreas is affected in four mutants, all of which also perturb anterior intestine. The pancreatic exocrine cells are selectively affected in these four mutations. Exocrine precursor cells appear, as identified by GATA-5 expression, but do not differentiate and acini do not form. The pancreatic islets are spared, and endocrine cells mature and synthesize insulin. These gastrointestinal mutations may be informative with regard to patterning and crucial lineage decisions during organogenesis, and may be relevant to diabetes, congenital dysmorphogenesis and disorders of cell proliferation.
The zebrafish gastrointestinal system matures in a manner akin to higher vertebrates. We describe nine mutations that perturb development of these organs. Normally, by the fourth day postfertilization the digestive organs are formed, the epithelial cells of the intestine are polarized and express digestive enzymes, the hepatocytes secrete bile, and the pancreatic islets and acini generate immunoreactive insulin and carboxypeptidase A, respectively. Seven mutations cause arrest of intestinal epithelial development after formation of the tube but before cell polarization is completed. These perturb different regions of the intestine. Six preferentially affect foregut, and one the hindgut. In one of the foregut mutations the esophagus does not form. Two mutations cause hepatic degeneration. The pancreas is affected in four mutants, all of which also perturb anterior intestine. The pancreatic exocrine cells are selectively affected in these four mutations. Exocrine precursor cells appear, as identified by GATA-5 expression, but do not differentiate and acini do not form. The pancreatic islets are spared, and endocrine cells mature and synthesize insulin. These gastrointestinal mutations may be informative with regard to patterning and crucial lineage decisions during organogenesis, and may be relevant to diabetes, congenital dysmorphogenesis and disorders of cell proliferation.
The first stage in the formation of the liver is two ventrolateral evaginations of the mid‐gut at the time of hatching. From the undifferentiated cells branching from the liver duct the pancreas cells arise, but do not assume adult character until the carp is about 41 mm. long.
The islet makes its first appearance in the region of the pancreatic duct at the 8‐mm. stage and shows no transitional stages. In the mesenchyme itissue dorsal to the intestine the spleen arises, and is finally completely surrounded by the liver‐pancreas.
The pancreatic β cell is the major source of circulating insulin in adult mammals. In the multistep process of insulin synthesis
it is initiation of transcription that restricts insulin synthesis to the β cell since all subsequent steps can be performed
by other cell types. Many of the transcription factors that bind to the insulin promoter and activate insulin gene transcription
have been isolated. Some of these factors are restricted in their expression pattern, but so far no truly β cell-specific
transcriptional activator has been found. Since different transcription factors synergize to activate insulin gene transcription,
cell-specific transcription of insulin is probably realized through the interactions of a unique set of regulatory proteins
in the β cell. The same transcription factors that regulate insulin gene transcription in the adult β cell are involved in
determining cell differentiation during pancreatic development. The endocrine and exocrine pancreas form from the gut endoderm
as a dorsal and a ventral bud which later fuse to build a single organ. The homeodomain protein PDX-1, an insulin gene transcription
factor, is uniformly expressed in the early pancreatic bud, and null mutation of PDX-1 in mice results in a failure of the
pancreatic bud to grow and differentiate. Other transcription factors, such as the helix-loop-helix protein Beta-2 and the
homeodomain protein Nkx 6.1, show a restricted pattern of expression during embryogenesis and in the mature islet. Those proteins
may serve a dual role for the organism: during embryogenesis they may determine islet cell differentiation and in the adult
they may ensure tissue-specific expression of the islet cell hormones. A better understanding of the factors involved in insulin
gene transcription and islet cell differentiation will ultimately provide the basis for novel therapy of diabetes.
The pancreatic endocrine cells of Barbus conchonius are concentrated in a large (principal) islet, located near the gall bladder, and in a number of smaller islets. Five types of endocrine cells can be distinguished in there pancreatic islets: B cells, A1 (or D cells), 2 types of A2 cells (A2r cells with round granules; and A2fl cells with flocculent granules) and a scarce 5th cell type. The hormones produced by B and A2fl cells are probably insulin and glucagon respectively. The A2r cell contains granules with the same diameter as the granules of the enteroendocrine type III cell of the gut. Both cell types may resemble the enteroglucagon-producing EG cell of mammals. The function of the A1 cells, which are frequently found without secretory granules, and of the 5th cell type, will be discussed. The pancreastic islets of B. conchonius are strongly innervated, which suggests thatpresence of a direct nervous control system. Some intermediate or mixed cells containing exocrine and endocrine A2r granules are found continguous with the principal islet. The origin of pancreatic endocrine cells is also the subject of discussion.
The endocrine cells of rainbow trout pyloric ceca and intestine have been investigated immunocytochemically using the avidin-biotin method. Twenty-six antisera were tested and 13 endocrine cell types immunoreacted with antisera to serotonin, somatostatin-25, bombesin, C-flanking bombesin, substance P, salmon PP, NPY, PYY, PP, glucagon, GLP1, Met-enkephalin, and CCK/G. Glucagon and GLP1 immunoreactivities appear in the same cells. Nerves positive to serotonin, substance P, PHI, and VIP were also found. The presence of cells positive to somatostatin-25, C-flanking bombesin, and salmon PP are described for the first time in fish intestine.
In the mouse insulin is first detected on embryonic day 12 (e12) in a subpopulation of the cells that on e10 start to produce glucagon. During the continued embryonic development, the number of cells that coexpress the two hormones is gradually decreased, and in adults the expression of these two hormone genes is segregated to the beta- and alpha-cells. To begin to understand the process of terminal differentiation that restricts insulin gene expression to beta-cells, we have assayed for the presence of nuclear proteins that interact with transcriptional regulatory sequences of the rat insulin I gene in pancreatic alpha- and beta-cell lines. All except one of the previously identified insulin enhancer-binding proteins were found to be present in both cell types. A new insulin promoter-binding protein, IPF1, which was present in beta-cells but absent in alpha-cells, was identified. The beta-cell specificity of IPF1 implies that the insulin promoter is involved in the restriction of insulin gene expression to the beta-cells. The binding sites for IPF1 and the beta-cell-specific enhancer-binding protein IEF2 are both recognized by the previously isolated homeodomain-containing LIM protein isl-1, but these three proteins were all shown to be different entities.
A genomic library of zebrafish was constructed and screened with homeobox-containing probes. One of the positive clones contains a transcribed region which shares extensive sequence homology with the murine Hox-1.4 and Hox-2.6 genes and the human HHO.c13 gene. Characterization of this zebrafish homologue (ZF-13) with respect to expression demonstrated that it is transcribed during embryogenesis where a major RNA species of 2.5 kb and a minor transcript of 4.6 kb are detected. The highest concentration of both transcripts was found in embryos at the stage of somite formation. By in situ hybridization the spatial localization of expression was analysed in hatching embryos. Hybridization signals were mainly detected throughout the neural tube and in the brain. A small amount of RNA derived from ZF-13 was localized in differentiated muscle cells. Our results suggest that homeobox genes of distantly related vertebrate species are very similar with respect to structure and function.
We report the isolation of a new homeobox gene from Xenopus laevis genomic DNA. The homeodomain sequence is highly diverged from the prototype Antennapedia sequence, and contains a unique histidine residue in the helix that binds to DNA. The homeodomain is followed by a 65 amino acid carboxyterminal domain, the longest found to date in any vertebrate homeobox gene. We have raised specific antibodies against an XlHbox 8-beta-gal fusion protein to determine the spatial and temporal expression of this gene. The nuclear protein first appears in a narrow band of the endoderm at stage 33 and develops into expression within the epithelial cells of the pancreatic anlagen and duodenum. Expression within the pancreatic epithelium persists into the adult frog. This unprecedented restriction to an anteroposterior band of the endoderm suggests that vertebrate homeobox genes might be involved in specifying positional information not only in the neuroectoderm and mesoderm, but also in the endoderm. Our data suggest that XlHbox 8 may therefore represent the first member of a new class of position-dependent transcription factors affecting endodermal differentiation.
The function of the pyloric caeca of fish has been uncertain since their detailed description in 345 B.C. by Aristotle. He suggested three hypotheses about their function: "to store up the food," "putrify it up," and "concoct it" (i.e., storage, fermentation, and digestion). Our results for trout, cod, largemouth bass, and striped bass support the third but not the first or second of Aristotle's theories. In all four species, the caeca prove to be a major site of sugar, amino acid, and dipeptide uptake, contributing more uptake than the entire remaining alimentary tract in trout and cod. Caecal brush-border membranes contain hydrolytic enzymes. X-ray plates taken at various times after trout had ingested radioopaque marker, and observations of trout fed blue dye plus glass beads of graded sizes, show that caeca fill and empty of food with the same time course as proximal intestine. Thus, whereas the caeca of mammals and birds serve as fermentation chambers, fish caeca are an adaptation to increase gut surface area.
The nucleic acid sequence of the preproinsulln cDNA of carp (Cyprinus carpio), cloned in the PstI-site of pBR322 (i), has
been determined. The sequenced insert of 439 bp includes the complete coding Information for carp preproinsulin (108 amino
acids), 10 nucleotides of the 5′-and 105 nucleotides of the 3′-nontranslated regions. The nucleotlde sequence confirms the
previously established amino acid sequence of carp insulin (2) and determines those of the signal (21 aa 1) and C-peptide
(35 aa 1). The observed shortness of the signal peptide of carp preproinsulin and the N-terminal addition of 2 amino acids
to the carp insulin B-chain suggest that the cleavage site of the signal peptidase has moved.
Calculations based on the comparison of known preproinsulin cDNA sequences showed that the evolutionary distance between fresh
water and salt water teleostians is not smaller than between man and chicken.
The endocrine pancreas consists of several differentiated cell types that are distinguished by their selective expression of peptide hormones such as insulin, glucagon, and somatostatin. Although a number of homeobox-type factors have been proposed as key regulators of individual peptide genes in the pancreas, their cellular distribution and relative abundance remain uncharacterized. Also, their overlapping DNA binding specificities have further obscured the regulatory functions these factors perform during development. In this report we characterize a novel homeobox-type somatostatin transactivating factor termed STF-1, which is uniformly expressed in cells of the endocrine pancreas and small intestine. The 283-amino acid STF-1 protein binds to tissue-specific elements within the somatostatin promoter and stimulates somatostatin gene expression both in vivo and in vitro. Remarkably, STF-1 comprises the predominant tissue-specific element-binding activity in nuclear extracts from somatostatin-producing pancreatic islet cells, suggesting that this protein may have a primary role in regulating peptide hormone expression and specifying endocrine cell lineage in the developing gut.
In neural plate stage Xenopus embryos, XlHbox 8 expression marks anterior endodermal cells fated to develop into pancreas/duodenum, and expression continues in adult pancreas in exocrine duct, acinar, and islet cells. Here, XlHbox 8 is used as a marker in experiments addressing the mechanisms of early endodermal patterning, particularly with respect to the role of specific polypeptide growth factors. When mesoderm-free vegetal explants (VEs) from early blastula stage embryos are cultured in isolation, XlHbox 8 expression develops autonomously in the dorsal region, strongly suggesting that endodermal region-specific determination occurs before MBT. Data from microinjection experiments using RNA encoding the activin and FGF dominant negative receptors and growth factor treatments of isolated VEs suggest that activin positively regulates XlHbox 8 expression, whereas bFGF is a potent negative regulator. Moreover, bFGF induces mesodermal marker expression in VEs. This suggests that the early endodermal determination state is plastic and that elevated levels of bFGF may convert vegetal (endodermal) cells into mesoderm. We propose a model for XlHbox 8 regulation in which an early signal from the Nieuwkoop center (whose eventual fate is endoderm) predisposes dorsovegetal cells for autonomous XlHbox 8 expression, in an area of high local activin (or activin-like) ligand concentration, and low relative concentrations of bFGF.
Augmentation of vertebrate growth by growth hormone (GH) is primarily due to its regulation of insulin-like growth factor I (IGF I) and IGF II levels. To characterize the effect of GH on the levels of IGF I and IGF II mRNA in a teleost, 10 micrograms of bovine GH (bGH) per g of body weight was administered to juvenile rainbow trout (Oncorhynchus mykiss) through i.p. injection. The levels of IGF I and IGF II mRNA were determined simultaneously, by using RNase protection assays, in the liver, pyloric ceca, kidney, and gill at 0, 1, 3, 6, 12, 24, 48, and 72 hr after injection. In the liver, IGF I mRNA levels were significantly elevated at 6 and 12 hr (approximately 2- to 3-fold, P < or = 0.01), while IGF II mRNA levels were significantly elevated at 3 and 6 hr (approximately 3-fold, P < or = 0.01). In the pyloric ceca, IGF II mRNA levels were significantly elevated at 12, 24, and 48 hr (approximately 3-fold, P < or = 0.01), while IGF I mRNA was below the limits of assay accuracy. GH-dependent IGF mRNA appearance was not detected in the gill and kidney. Serum bGH levels, determined by using a radioimmunoassay, were significantly elevated at 3 and 6 hr (P < 0.005). In primary hepatocyte culture, IGF I and IGF II mRNA levels increased in a bGH dose-dependent fashion, with ED50 values of approximately 45 and approximately 6 ng of bGH per ml, respectively. The GH-dependent appearance of IGF II mRNA in the liver and pyloric ceca suggests important roles for this peptide hormone exclusive of IGF I.
The development of endocrine cell types within the pancreas is thought to involve the progressive restriction of pluripotential stem cells, which gives rise to the four major cell types: insulin-, glucagon-, somatostatin-, and pancreatic polypeptide-expressing cells. The mechanism by which these peptide hormone genes are induced and then either maintained or repressed during development is unknown, but their coexpression in early precursor cells suggests the involvement of common regulatory factors. Here we show that the somatostatin transcription factor STF-1 is also a principal regulator of insulin expression in beta-cells of the pancreas. STF-1 stimulates the insulin gene by recognizing two well defined islet-specifying elements on the insulin promoter and by subsequently synergizing in trans with the juxtaposed helix-loop-helix protein E47. Within the STF-1 protein, an N-terminal trans-activation domain functions cooperatively with E47 to stimulate insulin transcription. As truncated STF-1 polypeptides lacking the N-terminal activation domain strongly inhibit insulin promoter activity in beta-islet cells, our results suggest that the specification of islet cell types during development may be in part determined by the expression of STF-1 relative to other islet cell factors.
We describe the cloning of insulin promoter factor 1 (IPF1), a homeodomain protein which in the adult mouse pancreas is selectively expressed in the beta-cells and which binds to and transactivates the insulin promoter. In embryos, IPF1 expression is initiated prior to hormone gene expression and is restricted to the dorsal and ventral walls of the primitive foregut at the positions where pancreas will later form. The pattern of IPF1 expression and its ability to stimulate insulin gene transcription suggest that IPF1 functions both in the regionalization of the primitive gut endoderm and in the maturation of the pancreatic beta-cell.
The mammalian pancreas is a mixed exocrine and endocrine gland that, in most species, arises from ventral and dorsal buds which subsequently merge to form the pancreas. In both mouse and rat the first histological sign of morphogenesis of the dorsal pancreas is a dorsal evagination of the duodenum at the level of the liver at around the 22-25-somite stage, and shortly thereafter a ventral evagination appears as a derivative of the liver diverticulum. Low levels of insulin gene transcripts are already present and restricted to the dorsal foregut endoderm at 20 somites, suggesting that pancreas- or insulin gene-specific transcriptional factors are present in this region before the onset of morphogenesis. Insulin-promoter-factor 1 (IPF1) is a homeodomain protein which, in the adult mouse pancreas, is selectively expressed in the beta-cells and binds to and transactivates the insulin promoter. In mouse embryos, IPF1 expression is restricted to the developing pancreatic anlagen and is initiated when the foregut endoderm is committed to a pancreatic fate. We now show that mice homozygous for a targeted mutation in the Ipf1 gene selectively lack a pancreas. The mutant pups survive fetal development but die within a few days after birth. The gastrointestinal part and all other internal organs were normal in appearance. No pancreatic tissue and no ectopic expression of insulin or pancreatic amylase could be detected in mutant embryos and neonates. These findings show that IPF1 is needed for the formation of the pancreas and suggest that it acts to determine the fate of common pancreatic precursor cells and/or to regulate their propagation.
The cis-acting sequences that mediate insulin gene expression exclusively in pancreatic islet beta-cells are localized within the 5'-flanking region between nucleotides -340 and -91. We have identified an evolutionarily conserved, A+T-rich element at -201/-196 basepairs in the rat insulin II gene that is essential for efficient expression in beta-cells. Affinity-purified antibody to the XIHbox 8 protein super-shifted the major beta-cell-activator factor complex binding to the -201/-196 element. XIHbox 8 is a Xenopus endoderm-specific homeodomain protein whose expression is restricted to the nucleus of endodermal cells of the duodenum and developing pancreas. Antibody to XIHbox 8 specifically interacts with a 47-kilodalton protein present in this DNA complex. Immunohistochemical studies revealed XIHbox 8-like proteins within the nucleus of almost all mouse islet beta-cells and a subset of islet alpha- and beta-cells. These results are consistent with the proposal that an XIHbox 8-related homeoprotein of 47 kilodalton is required for expression of the mammalian insulin gene in beta-cells. Experiments conducted with antiserum raised to somatostatin transcription factor-1 (STF-1), a recently isolated mammalian XIHbox 8-related homeoprotein, indicate that the STF-1 protein is the mammalian homolog of Xenopus XIHbox 8.
Insulin gene transcription is a unique feature of the pancreatic beta cells and is increased in response to glucose. The recent cloning of insulin promoter factor 1 (IPF1) and somatostatin transcription factor 1 (STF1) unexpectedly revealed that these are mouse and rat homologues of the same protein mediating transactivation through binding of CT box-like elements in rat insulin 1 and somatostatin promoter/enhancer regions, respectively. By using oligonucleotides representing each of the three CT boxes of the human insulin (HI) gene enhancer and nuclear extracts from the mouse islet tumor cell lines beta TC3 and alpha TC1, we have identified a beta-cell-specific binding activity as reported for IPF1, which has maximal affinity toward the CT2 box. However, in pluripotent, HI-transfected rat islet tumor cells, NHI-6F, this binding activity is present prior to induction of (human) insulin gene transcription. Its migration is identical to that of in vitro translated STF1 in electrophoretic mobility-shift assays; it is specifically recognized by anti-STF1 antibodies and has an apparent molecular mass of 46 kDa. Mutation of the CT2 box decreases transcriptional activity of a HI reporter plasmid by approximately 65% in beta TC3 cells and blocks the glucose response in isolated newborn rat islet cells. Furthermore, cotransfection with STF1 cDNA into the glucagon-producing alpha TC1 cells increases the activity of the HI enhancer 4- to 5-fold, suggesting that STF1/IPF1 can confer on alpha TC1 cells the ability to transcribe the HI gene. We conclude that STF1/IPF1 is a necessary but not sufficient key regulator of insulin gene activity, possibly also involved in glucose-regulated transcription.
The sensitivity of the commonly used progressive multiple sequence alignment method has been greatly improved for the alignment
of divergent protein sequences. Firstly, individual weights are assigned to each sequence in a partial alignment in order
to downweight near-duplicate sequences and up-weight the most divergent ones. Secondly, amino acid substitution matrices are
varied at different alignment stages according to the divergence of the sequences to be aligned. Thirdly, residue-specific
gap penalties and locally reduced gap penalties in hydrophilic regions encourage new gaps in potential loop regions rather
than regular secondary structure. Fourthly, positions in early alignments where gaps have been opened receive locally reduced
gap penalties to encourage the opening up of new gaps at these positions. These modifications are incorporated into a new
program, CLUSTAL W which is freely available.
Zebrafish have entered the arena of vertebrate biology as a mainstream model system, and the use of genetic tools in this tropical fish should enhance our understanding of vertebrate development. The zebrafish system allows genetic experiments that are not possible in other vertebrates, and the mutations isolated thus far attest to its usefulness, complementing knowledge obtained from other model organisms.
Insulin promoter factor 1 (IPF-1) is a homeodomain-containing protein that is thought to be a key regulator of pancreatic islet development and insulin gene transcription in beta-cells. This report describes the isolation and characterization of the human IPF-1 gene. The coding region, which showed 83% nucleotide identity with the mouse IPF-1 gene, was encoded by two exons that extended over a 5-kb region of human genome. The deduced human IPF-1 protein contained 283 amino acids, 1 amino acid less than the mouse IPF-1 protein. The homeodomain region of IPF-1 was encoded by the second exon, and it was highly conserved among species. The human IPF-1 gene was mapped to chromosome 13q12(12.1) by fluorescent in situ hybridization (FISH) analysis. A simple sequence repeat polymorphism (ipf1CA2) was identified in the genomic clone. Polymerase chain reaction (PCR) amplification of this repeat region revealed two alleles (heterozygosity = 0.32). This simple sequence repeat polymorphism, and thus the IPF-1 gene, was incorporated into the human linkage map by genotyping reference Human Polymorphism Study Center (CEPH) pedigrees. Multipoint analysis with the CEPH genotype database placed the gene with equal likelihood between two marker intervals: D13S292-cdx3GA1 and cdx3GA1-D13S289 on chromosome 13, consistent with the results of FISH analysis. Two-point linkage analysis inferred that the most likely location for ipf1CA2 was at theta = 0 from cdx3GA1 locus. The exon-intron boundaries of the IPF-1 gene were sequenced, and primers were synthesized to search the homeodomain region for potential variants in patients with NIDDM. By single-strand conformational polymorphism analysis, no variants were found within this region in 61 Japanese patients, which could contribute to the pathogenesis of NIDDM. The isolation of the human IPF-1 gene, along with characterization of its genomic structure and chromosomal mapping, will now permit the assessment of the role of this gene in the pathogenesis of NIDDM in various populations.
The insulin-, glucagon- and somatostatin-producing cells (beta, alpha, and delta, respectively) in the pancreatic islets derive from a common precursor stem cell and differentiate sequentially during embryonic development. The homeodomain protein islet duodenum HOX (IDX)-1 [insulin promoter factor (IPF)-1/somatostatin transactivating factor (STF)-1)] is a transcription factor critically required for both the development of the pancreas and the transcriptional expression of the insulin gene. IDX-1 may also act to determine the differentiation of the common pancreatic precursor to beta, alpha, and delta cells. Although IDX-1 is detected in most adult mouse islet beta-cells and regulates insulin gene transcription, it is also found in 15% of the delta-cells and transactivates the rat somatostatin gene. The roles of different domains of IDX-1 involved in the transactivation of the somatostatin gene are unclear. In this study, we have created a series of amino- and carboxy-terminal deletions, as well as point substitution mutations to delineate functional domains within the IDX-1 protein. We find that deletions amino-proximal to the homeodomain enhance DNA-binding to the TAAT-1 transcriptional control element within the somatostatin gene promoter. However, these amino-terminal deletions result in substantial decreases in transactivation of a transcriptional reporter containing the TAAT-1 element. Paradoxically, coexpression of the transcriptionally inactive, amino-terminally deleted IDX-1 mutant proteins, either with the wild-type IDX-1 or with themselves, results in a marked enhancement of transactivation of the transcriptional TAAT-1 element reporter. We provide evidence that this synergistic enhancement of transactivation is mediated by protein-protein interactions among the regions of IDX-1 located carboxyl-proximal to the homeodomain. Although successive deletions into the carboxy-terminal region do not alter DNA-binding, these deletions result in a biphasic enhancement and diminution of transactivation. The IDX-1 homeodomain mediates sequence- specific DNA-binding because substitution mutations within this region abolish DNA-binding. All of the amino- and carboxy-terminal deletion proteins were present in nuclear extracts of transfected cells, suggesting that nuclear localization signals reside within the IDX-1 homeodomain. The mapping of the functional domains of IDX-1 may facilitate understanding of IDX-1-mediated gene regulation and islet cell development.
The complex anatomy of the mammalian pancreas, in which the endocrine cells are grouped in islets dispersed among the predominant exocrine component, has hampered study of the molecular events governing the development of pancreatic cell lineages. To investigate whether fish may provide relevant, complementary models of pancreas development, we characterized the trout insulin (tINS) promoter and its molecular interactions with PDX1, a key transcriptional and developmental factor of the mammalian pancreas. Transfection of a luciferase reporter plasmid containing the 280 bp 5'-flanking region of the tINS gene resulted in strong activity in mammalian pancreatic beta cells but not in CHO or pituitary cells. Footprinting assays and cotransfection experiments indicated that mammalian PDX1 binds to and activates the tINS promoter. By microinjecting plasmids to fertilized zebrafish eggs, we showed that the expression of mouse PDX1 is capable of activating the co-injected tINS promoter plasmid in most cell types of the 24-h zebrafish embryo. The conserved role of PDX1 in vertebrate insulin gene regulation opens the possibility to exploit fish models in the study of pancreas development.
Pancreas formation is prevented in mice carrying a null mutation in the PDX-1 homeoprotein, demonstrating a key role for this factor in development. PDX-1 can also bind to and activate transcription from cis-acting regulatory sequences in the insulin and somatostatin genes, which are expressed in pancreatic islet beta and delta cells, respectively. In this study, we compared the functional properties of PDX-1 with those of the closely related Xenopus homeoprotein XIHbox8. Analysis of chimeras between PDX-1, XIHbox8, and the DNA-binding domain of the Saccharomyces cerevisiae transcription factor GAL4 revealed that their transactivation domain was contained within the N-terminal region (amino acids 1 to 79). Detailed mutagenesis of this region indicated that transactivation is mediated by three highly conserved sequences, spanning amino acids 13 to 22 (subdomain A), 32 to 38 (subdomain B), and 60 to 73 (subdomain C). These sequences were also required by PDX-1 to synergistically activate insulin enhancer-mediated transcription with another key insulin gene activator, the E2A-encoded basic helix-loop-helix E2-5 and E47 proteins. These results indicated that N-terminal sequences conserved between the mammalian PDX-1 and Xenopus XIHbox8 proteins are important in transcriptional activation. Stable expression of the PDX-1 deltaABC mutant in the insulin- and PDX-1-expressing betaTC3 cell line resulted in a threefold reduction in the rate of endogenous insulin gene transcription. Strikingly, the level of the endogenous PDX-1 protein was reduced to very low levels in these cells. These results suggest that PDX-1 is not absolutely essential for insulin gene expression in betaTC3 cells. We discuss the possible significance of these findings for insulin gene transcription in islet beta cells.
Swanson LW 1989 A complete protocol for in situ hybridizationofmessengerRNAsinbrainandothertissueswithradio-labeled single-stranded RNA probes
- Dm Simmons
- Arriza
Simmons DM, Arriza JL, Swanson LW 1989 A complete protocol for in situ hybridizationofmessengerRNAsinbrainandothertissueswithradio-labeled single-stranded RNA probes. J Histotechnol 12:169–18
- M Pack
- L Solnica-Krezel
- J Malicki
- Scf Neuhauss
- Af Schier
- Dl Stemple
- W Driever
- Mc Fishman
Pack M, Solnica-Krezel L, Malicki J, Neuhauss SCF, Schier AF, Stemple DL,
Driever W, Fishman MC 1996 Mutations affecting development of zebrafish
digestive organs. Development 123:321–328
Isolation, characterization, and chromosomal mapping of the human insulin promoter factor 1 (IPF-1) gene.
- Inoue
The Zebrafish Book, ed. 2.1
- Westerfield