ArticlePDF Available

Cloning and Mapping of theUNC5CGene to Human Chromosome 4q21–q23

Authors:
Susan Ackerman at The Jackson Laboratory
Susan Ackerman
Barbara B. Knowles at The Jackson Laboratory
Barbara B. Knowles
Download full-text PDF
Read full-text
Download citation

Abstract and Figures

The vertebrate Unc5 genes, like their Caenorhabditis elegans counterpart, define a family of putative netrin receptors. One member of this family, Unc5h3, has been shown to have an important role during cell migration in the developing murine cerebellum. Mice homozygous for mutations in Unc5h3 are ataxic and have cerebellar hypoplasia and laminar structure defects. In addition, these mice have ectopic granule and Purkinje cells in the midbrain and brainstem. We have identified the human homologue of this gene, UNC5C, and shown it to have a restricted expression pattern in adult human tissues. By radiation hybrid analysis, we have determined that UNC5C localizes to chromosome 4q21-q23 between markers D4S1557 and D4S836 and is closely linked to the Parkinson disease gene.
Figures - uploaded by Barbara B. Knowles
Author content
All figure content in this area was uploaded by Barbara B. Knowles
Content may be subject to copyright.
Content uploaded by Barbara B. Knowles
Author content
All content in this area was uploaded by Barbara B. Knowles on Jan 24, 2019
Content may be subject to copyright.
SHORT COMMUNICATION
Cloning and Mapping of the UNC5C Gene
to Human Chromosome 4q21–q23
Susan L. Ackerman
1
and Barbara B. Knowles
The Jackson Laboratory, Bar Harbor, Maine 04609
Received April 13, 1998; accepted June 3, 1998
The vertebrate Unc5 genes, like their Caenorhabdi-
tis elegans counterpart, define a family of putative
netrin receptors. One member of this family, Unc5h3,
has been shown to have an important role during cell
migration in the developing murine cerebellum. Mice
homozygous for mutations in Unc5h3 are ataxic and
have cerebellar hypoplasia and laminar structure de-
fects. In addition, these mice have ectopic granule and
Purkinje cells in the midbrain and brainstem. We have
identified the human homologue of this gene, UNC5C,
and shown it to have a restricted expression pattern in
adult human tissues. By radiation hybrid analysis, we
have determined that UNC5C localizes to chromosome
4q21–q23 between markers D4S1557 and D4S836 and
is closely linked to the Parkinson disease gene. © 1998
Academic Press
Nearly all neurons migrate from their birthplace in a
proliferative zone to their final place of function in the
mature central nervous system. Many of these migra-
tions occur radially from the ventricular zone to the
pial surface, while others occur tangentially along the
brain surface (3, 12). All migrations presumably re-
quire interactions of neuronal cell-surface receptors
with molecules expressed by cells in the appropriate
target zones. Such ligands may serve as either an
attractant or a repellent in guiding migrations.
Recently, we cloned the gene encoding the mouse
cell-surface receptor, UNC5H3 (1). UNC5H3 is a trans-
membrane member of the immunoglobulin superfam-
ily with high homology to unc-5, aCaenorhabditis el-
egans gene product that mediates dorsal migrations of
pioneer axons and mesodermal cells away from sources
of netrin (4, 5, 8). As predicted from C. elegans studies,
UNC5H3 has been shown to bind to netrin1, a secreted
protein shown to serve as both a chemoattractant and
a chemorepellent for migrating axons (2, 7, 13, 14).
Disruption of the mouse Unc5h3 gene results in failure
of tangentially migrating granule cells to recognize the
rostral boundary of the cerebellum (11). As a result,
both granule and Purkinje cells infiltrate the lateral
regions of the pons and the inferior colliculus of the
midbrain (1, 11).
To investigate a potential role for the Unc5h3 gene in
human cerebellar development, we have cloned, se-
quenced, and genetically mapped the cDNA encoded by
the human homologue UNC5C. In a search of the hu-
man EST database, we identified a clone isolated from
human fetal brain (GenBank Accession No. 532187)
with homology to a region of the mouse Unc5h3 39-
untranslated region. Sequence analysis of this clone
indicated that this homology extended 507 bp into the
open reading frame.
Additional cDNA sequence was obtained by 59RACE
using human brain cDNA (Marathon-Ready cDNA,
Clontech, Palo Alto, CA) and a primer corresponding to
sequences in the putative coding region (59GACAG-
CACCTGAGGTGTTGTACACT39). A total of 3646 bp of
sequence encompassing a 2792-bp open reading frame
was obtained (GenBank Accession No. AF055634).
Like the mouse homologue, the human UNC5C gene
product is predicted to be a 931-amino-acid transmem-
brane protein with the overall domain structure of the
UNC-5 family. Within the coding region, homology to
mouse Unc5h3 is 90% at the DNA level and there is
97% identity at the amino acid level (Fig. 1). Mouse/
human homology in the 154-bp 59UTR was 75% and
within the 696-bp partial 39UTR was 84%.
Northern blot analysis of mRNA from adult tissues
(Clontech) revealed expression of a single 9.5-kb tran-
script in brain (Fig. 2). As in mouse, this transcript was
also detected at low levels in kidney (1). Mouse Unc5h3
is also expressed in embryonic and adult lung in an
amount comparable to that seen in developing and
adult brain (1, 11). In contrast, UNC5C message levels
are very low in human lung. In addition, UNC5C is
expressed in human heart, an organ where Unc5h3
was not detected either in the adult or in developing
embryos. The identification of an UNC5C expressed
sequence tag (GenBank Accession No. AA348167) from
a human fetal heart cDNA library demonstrates that
the expression of this gene also occurs in the develop-
ing heart. These results illustrate differential tran-
Sequence data for this article have been deposited with the EMBL/
GenBank Data Libraries under Accession No. AF055634.
1
To whom correspondence should be addressed. Telephone: (207)
288-6494. Fax: (207) 288-6071. E-mail: sla@jax.org.
GENOMICS 52, 205–208 (1998)
ARTICLE NO. GE985425
205
0888-7543/98 $25.00
Copyright © 1998 by Academic Press
All rights of reproduction in any form reserved.
FIG. 1. Homology between human UNC5C and mouse UNC5H3 proteins. Protein sequences were aligned using Clustal-W. Identical
amino acids are darkly shaded, and similar amino acids are lightly shaded. Homology was observed across all conserved domains:
immunoglobulin (Ig)-like domains (residues 76–151 and 181–246) and thrombospondin (TSP) type 1 domains (residues 259–315 and
316–369).
206 SHORT COMMUNICATION
scriptional regulatory mechanisms between human
and mouse for the Unc5h3/C genes and indicate that
the human and mouse genes may have nonoverlapping
roles in the development and maintenance of some
tissues.
Previous studies have localized the Unc5h3 gene to
the distal region of mouse Chromosome 3 (6). Here we
report the localization of the human UNC5C gene to
chromosome 4q21–q23 by radiation hybrid panel map-
ping. Primers at unique positions in the 39UTR
(59CACCATGCTGGAAGGGGAAA39, bp 2952–2971)
and (59GTATCTGTTTTCCTTCTGGC39, bp 3078–3097)
that amplify a 145-bp band were used to type the
Stanford Human Genome Center G3 radiation hybrid
panel (Research Genetics). PCR was used to determine
the presence or absence of this gene segment of UNC5C
within the 83 radiation hybrid clones. UNC5C was
found to map to chromosome 4q21 with very high prob-
ability (LOD .14 and is 15.9 cR distal to D4S1557 and
65.8 cR proximal to D4S836 (Fig. 3). Both markers
D4S1045 (previously mapped) and D4S2380 (mapped
in this study) have band retention patterns identical to
that of UNC5C, indicating tight linkage of UNC5C to
these markers. Although several genes have been pre-
viously mapped to this region of chromosome 4 includ-
ing the Parkinson disease gene,
a
-synuclein, the asso-
ciation of this linkage region with any human
cerebellar disorders remains to be demonstrated (9, 10).
ACKNOWLEDGMENTS
We are very grateful to Gayle Collin for assistance with the anal-
ysis of the radiation hybrid data, Drs. Patsy Nishina and Luanne
Peters for comments on the manuscript, and Amy Lambert and
Douglas McMinimy for sequence analysis. This work was supported
by NIH Grant NS35900 to S.L.A. and by CORE Grant P30CA34196.
REFERENCES
1. Ackerman, S. L., Kozak, L. P., Przyborski, S. A., Rund, L. A.,
Boyer, B. B., and Knowles, B. B. (1997). The mouse rostral
cerebellar malformation gene encodes an UNC-5-like protein.
Nature 386: 838–842.
2. Colamarino, S. A., and Tessier Lavigne, M. (1995). The axonal
chemoattractant netrin-1 is also a chemorepellent for trochlear
motor axons. Cell 81: 621–629.
3. Cowan, W. M. (1981). The development of the vertebrate central
nervous system: An overview. In “Development in the Nervous
System” (D. R. Garrod and J. D. Feldman, Eds.), pp. 3–33,
Cambridge Univ. Press, Cambridge.
4. Hamelin, M., Zhou, Y., Su, M. W., Scott, I. M., and Culotti, J. G.
(1993). Expression of the UNC-5 guidance receptor in the touch
FIG. 2. UNC5C expression in adult tissues. A Northern blot
containing mRNA from adult human tissues was hybridized with a
probe corresponding to UNC5C or, as a control,
b
-actin. A single
band of 9.5 kb was detected in lanes with brain, heart, and kidney
mRNA.
FIG. 3. Chromosomal localization of UNC5C to human chromo-
some 4q21–q23. The location of UNC5C relative to other markers
mapped on the Stanford Radiation Hybrid map is shown. The radi-
ation hybrid map was constructed using the RHMAP computer pro-
gram. Centiray distances (cR) and LOD scores were determined by
two-point analyses using the RH2PT program, and the branch and
bound approach (RHMAXLIK) was used to determine the most likely
order of the markers.
207SHORT COMMUNICATION
neurons of C. elegans steers their axons dorsally. Nature 364:
327–330.
5. Hedgecock, E. M., Culotti, J. G., and Hall, D. H. (1990). The
unc-5, unc-6, and unc-40 genes guide circumferential migra-
tions of pioneer axons and mesodermal cells on the epidermis in
C. elegans. Neuron 2: 61–85.
6. Lane, P. W., Bronson, R. T., and Spencer, C. A. (1992). Rostral
cerebellar malformation (rcm): A new recessive mutation on
chromosome 3 of the mouse. J. Hered. 83: 315–318.
7. Leonardo, E. D., Hinck, L., Masu, M., Keino Masu, K., Acker-
man, S. L., and Tessier Lavigne, M. (1997). Vertebrate homo-
logues of C. elegans UNC-5 are candidate netrin receptors.
Nature 386: 833–838.
8. Leung Hagesteijn, C., Spence, A. M., Stern, B. D., Zhou, Y., Su,
M. W., Hedgecock, E. M., and Culotti, J. G. (1992). UNC-5, a
transmembrane protein with immunoglobulin and throm-
bospondin type 1 domains, guides cell and pioneer axon migra-
tions in C. elegans. Cell 71: 289–299.
9. Polymeropoulos, J. J., Higgins, J. J., Golbe, L. I., Johnson,
W. G., Ide, S. E., Di Iorio, G., Sanges, G., Stenroos, E. S., Pho,
L. T., Schaffer, A. A., Lazzarini, A. M., Nussbaum, R. L., and
Duvoisin, R. C. (1996). Mapping of a gene for Parkinson’s dis-
ease to chromosome 4q21–23. Science 274: 1197–1199.
10. Polymeropoulos, M., Lavedan, C., Leroy, E., Ide, S., Dehejia, A.,
Dutra, A., Pike, B., Root, H., Rubenstein, J., Boyer, R., Sten-
roos, E., Chandrasekharappa, S., Athanassiadou, A., Papa-
petropoulos, T., Johnson, W., Lazzarini, A., Duvoisin, R., Di
Iorio, G., Golbe, L., and Nussbaum, R. (1997). Mutation in the
a
-synuclein gene identified in families with Parkinson’s dis-
ease. Science 276: 2045–2047.
11. Przyborski, S., Knowles, B., and Ackerman, S. (1998). Embry-
onic phenotype of Unc5h3 mutant mice suggests chemorepul-
sion during the formation of the rostral cerebellar boundary.
Development 125: 41–50.
12. Rakic, P. (1990). Principles of neural cell migration. Experientia
46: 882–891.
13. Serafini, T., Colamarino, S. A., Leonardo, E. D., Wang, H.,
Beddington, R., Skarnes, W. C., and Tessier-Lavigne, M.
(1996). Netrin-1 is required for commissural axon guidance
in the developing vertebrate nervous system. Cell 87: 1001–
1014.
14. Serafini, T., Kennedy, T. E., Galko, M. J., Mirzayan, C., Jessell,
T. M., and Tessier-Lavigne, M. (1994). The netrins define a
family of axon outgrowth-promoting proteins homologous to C.
elegans UNC-6. Cell 78: 409–424.
208 SHORT COMMUNICATION

Supplementary resource (1)

Homo sapiens transmembrane receptor UNC5C (UNC5C) mRNA, complete cds
Nucleotide Sequence
March 1998
Susan Ackerman
... UNC5C gene localizes on chromosome 4q22.3 and encodes 16 exons, which can translate into 950 amino acid polypeptides (16). The UNC5C protein is a typical transmembrane protein that contains two Ig domains (Ig), two thrombospondin domains (TS), a transmembrane domain (TM), a zona occludens-5 domain (ZU-5), a UPA domain, and a death domain (DD) (16) (Figure 1). ...
... Dysfunctional UNC5C will cause relative cells to be misrouted and to fail to receive survival signals, ultimately triggering cell death (23). Previous studies revealed that mice homozygous for mutations in UNC5C are ataxic and have cerebellar hypoplasia and laminar structure defects (16,17), which indicated that UNC5C plays an indispensable role in the development of nervous system. Additionally, the altered UNC5C expression is associated with many types of cancers including colorectal, breast, stomach, lung, ovary, uterus, or kidney cancers (22). ...
The role of UNC5C in Alzheimer’s disease
Article
  • May 2018
Alzheimer's disease (AD) is a chronic progressive neurodegenerative disease in adults characterized by the deposition of extracellular plaques of β-amyloid protein (Aβ), intracellular neurofibrillary tangles (NFTs), synaptic loss and neuronal apoptosis. AD has a strong and complex genetic component that involving into multiple genes. With recent advances in whole-exome sequencing (WES) and whole-genome sequencing (WGS) technology, UNC5C was identified to have association with AD. Emerging studies on cell and animal models identified that aberrant UNC5C may contribute to AD by activating death-associated protein kinase 1 (DAPK1) which is a new component involved in AD pathogenesis with an extensive involvement in aberrant tau, Aβ and neuronal apoptosis/autophagy. In this review, we briefly summarize the biochemical properties, genetics, epigenetics, and the speculative role of UNC5C in AD. We hope our review would bring comprehensive understandings of AD pathogenesis and provide new therapeutic targets for AD.
View
... UNC5C has been proposed as a candidate gene for Alzheimer's disease (AD) in previous studies [45]. Additionally, several studies have reported that UNC5C is predominantly expressed in brain tissues [46][47][48][49]. ...
UNC5C: Novel Gene Associated with Psychiatric Disorders Impacts Dysregulation of Axon Guidance Pathways
Article
Full-text available
  • Feb 2024
The UNC-5 family of netrin receptor genes, predominantly expressed in brain tissues, plays a pivotal role in various neuronal processes. Mutations in genes involved in axon development contribute to a wide spectrum of human diseases, including developmental, neuropsychiatric, and neurodegenerative disorders. The NTN1/DCC signaling pathway, interacting with UNC5C, plays a crucial role in central nervous system axon guidance and has been associated with psychiatric disorders during adolescence in humans. Whole-exome sequencing analysis unveiled two compound heterozygous causative mutations within the UNC5C gene in a patient diagnosed with psychiatric disorders. In silico analysis demonstrated that neither of the observed variants affected the allosteric linkage between UNC5C and NTN1. In fact, these mutations are located within crucial cytoplasmic domains, specifically ZU5 and the region required for the netrin-mediated axon repulsion of neuronal growth cones. These domains play a critical role in forming the supramodular protein structure and directly interact with microtubules, thereby ensuring the functionality of the axon repulsion process. We emphasize that these mutations disrupt the aforementioned processes, thereby associating the UNC5C gene with psychiatric disorders for the first time and expanding the number of genes related to psychiatric disorders. Further research is required to validate the correlation of the UNC5C gene with psychiatric disorders, but we suggest including it in the genetic analysis of patients with psychiatric disorders.
View
... [12] The UNC5C is a canonical transmembrane receptor that contains a death domain (DD) in the C-terminus. [13] After binding to its ligand netrin-1, the complex plays a crucial role in mediating axon repulsion of neuronal growth cones and cell migration in the developing nervous system. [14] UNC5C is also widely expressed in adult CNS neurons. ...
UNC5C Receptor Proteolytic Cleavage by Active AEP Promotes Dopaminergic Neuronal Degeneration in Parkinson's Disease
Article
Full-text available
  • Jan 2022
Netrin-1 is a chemotropic cue mediating axon growth and neural migration in neuronal development, and its receptors deletion in colorectal cancer and UNC5s act as dependence receptors regulating neuronal apoptosis. Asparagine endopeptidase (AEP) is an age-dependent protease that cuts human alpha-synuclein (α-Syn) at N103 and triggers its aggregation and neurotoxicity. In the current study, it is reported that UNC5C receptor is cleaved by AEP in Parkinson's disease (PD) and facilitates dopaminergic neuronal loss. UNC5C is truncated by active AEP in human α-SNCA transgenic mice in an age-dependent manner or induced by neurotoxin rotenone. Moreover, UNC5C is fragmented by AEP in PD brains, inversely correlated with reduced netrin-1 levels. Netrin-1 deprivation in primary cultures induces AEP and caspase-3 activation, triggering UNC5C proteolytic fragmentation and enhancing neuronal loss. Noticeably, blocking UNC5C cleavage by AEP attenuates netrin-1 deprivation-elicited neuronal death and motor disorders in netrin flox/flox mice. Overexpression of AEP-truncated UNC5C intracellular fragment strongly elicits α-Syn aggregation and dopaminergic loss, locomotor deficits in α-SNCA transgenic mice. Hence, the findings demonstrate that netrin-1 reduction and UNC5C truncation by AEP contribute to PD pathogenesis.
View
... Chez l'homme, ils sont codés par les gènes localisés au niveau des chromosomes 5q35.2, 10q22.1, 4q21-23 et 8p12 respectivement[327].Ce sont également des récepteurs de guidage neuronal dotés de fonctions supplémentaires en dehors du système nerveux. Les récepteurs UNC5 sont des récepteurs transmembranaires de type I et d'un poids moléculaire d'environ 110kDa. ...
Exploration des récepteurs à dépendance dans les hémopathies malignes
Thesis
  • Sep 2020
Les récepteurs cellulaires membranaires se divisent normalement en deux grandes familles selon leur capacité d’induction des voies de signalisation. La première famille sont les récepteurs classiques qui induisent une signalisation positive qui active une voie de signalisation sous-jacente en présence de leur ligand et qui sont inactifs en absence du ligand. La deuxième famille de récepteurs sont les récepteurs à dépendance qui se comportent différemment : en présence de leur ligand, ces récepteurs induisent une voie de signalisation « positive » induisant souvent la survie et la prolifération cellulaire et en absence de leur ligand, ils induisent une voie de signalisation « négative » menant à l’activation de l’apoptose par activation extrinsèque des caspases. L’objectif principal des travaux de cette thèse est d’explorer le rôle des récepteurs à dépendance et d’évaluer l’effet de leur ciblage dans les hémopathies malignes par une nouvelle immunothérapie. Dans un premier lieu, nous avons criblé différents types d’hémopathies malignes pour l’expression de la nétrine-1 et de ses récepteurs à dépendance, DCC et UNC5B, afin de déterminer les lignées cellulaires potentielles pour le ciblage de la nétrine-1 par un anticorps anti-nétrine-1 humanisé. Selon les résultats de ce criblage, les lymphomes non-hodgkiniens (LNH) à cellules du manteau et les myélomes multiples (MM) paraissent être les principales hémopathies cibles pour des traitements ciblant la nétrine-1. L’anticorps anti-nétrine-1 NP137 semble être efficace contre les LNH en ciblant la nétrine-1 à la fois secrétée d’une façon paracrine et/ou autocrine dans un modèle de co-culture. Quant aux myélomes multiples, des données de criblage de la nétrine-1 et de ses récepteurs obtenus sur des échantillons de patients semblent montrer une surexpression de ces protéines chez les patients atteints de cette maladie. Le ciblage de la nétrine-1 dans ce type d’hémopathies semble réduire la viabilité cellulaire d’un modèle cellulaire de myélome multiple en le combinant avec un inhibiteur de protéasome, le bortézomib. In vivo le traitement par NP137 des souris porteuses de xénogreffes de lignées de myélomes multiples humains ne réduit la croissance tumorale significativement par rapport aux souris non-traitées que lorsqu’il est combiné à la dexaméthasone. Par ailleurs le traitement ex vivo par NP137 des échantillons frais de MM provenant des patients, semble réduire le pourcentage des plasmocytes dans les échantillons frais de moelle osseuse chez certains patients. Dans la deuxième partie de la thèse nous nous sommes intéressés à l’évaluation de l’ectodysplasine A1 (EdaA1) et son récepteur à dépendance EDAR dans les leucémies aiguës myéloïdes (LAM), suite à des données non publiées du TCGA qui suggèrent une surexpression de ce couple dans ce type d’hémopathies. Nos résultats de criblage montrent à la fois une surexpression de ces molécules dans 3 modèles cellulaires de LAM et suggèrent une surexpression de EdaA1 et d’EDAR dans une cohorte de 220 patients de LAM. In vitro, le traitement par un anticorps anti-EdaA1 (NP604) des modèles cellulaires n’impacte pas leur viabilité sauf quand on le combine avec un inhibiteur potentiel de cFLIP, le lupéol, suggérant un rôle de cette protéine dans la résistance de ce type d’hémopathies au traitement. L’analyse de l’expression et du clivage de cFLIP et de la caspase-8 dans les lignées de LAM traitées par le lupéol montrant un clivage de ces deux protéines après traitement suggère que le lupéol impacte l’interaction du domaine de mort d’EDAR avec cFLIP et caspase-8 d’une manière similaire à ce qui se passe dans le cas des récepteurs de mort. Ces résultats exigent une confirmation à travers l’étude des interactions de ces protéines entre elles. Si ces données sont confirmées, le ciblage de la signalisation des récepteurs à dépendance pourrait être envisagé dans ces deux types de cancer
View
... It plays a critical role in the development of spinal accessory motor neurons [83]. Moreover, UNC5C functions as a chemotropic molecule in mediating axon growth and neuronal transplantation in neuronal development [84][85][86][87]. So far, six single nucleotide polymorphisms in UNC5C have been show to increase the risk of late-onset AD [88]. ...
Netrin-1/receptors regulate the pathogenesis in Parkinson’s diseases
Article
Full-text available
  • Jun 2021
The netrins and their receptors (deleted in colorectal cancer [DCC] and unc-5 netrin receptors A–D [UNC5A–D]) play essential roles for central nervous system (CNS) development, mediating axonal and neuronal navigation. Emerging evidence indicates that they are implicated in maintaining the adult brain structure and mediating the pathogenesis of Parkinson’s disease (PD). Recently, we reported the reduction of netrin-1 and brain-derived neurotrophic factor (BDNF) was inversely correlated with inflammatory cytokines-activated transcription factor CCAAT/enhancer binding protein β (C/EBPβ) in PD patient brains and colons. C/EBPβ binds to the promoters, repressing both netrin-1 and BDNF mRNA expression. Remarkably, netrin-1 deprivation triggered mammalian Ste20-like kinases 1 (MST1; Hippo) activation, which subsequently phosphorylated UNC5B and induced its apoptotic fragmentation via active caspase-3 in dopaminergic neurons in the substantia nigra (SN). Moreover, deficiency of netrin-1 stimulated activation of delta-secretase (asparagine endopeptidase [AEP]) that cleaves α-Syn at N103 and UNC5C receptor, facilitating PD pathologies. This review summarizes our current understanding of the crucial role of netrin-1 and its receptors in CNS and enteric nervous system contributing to PD pathologies by orchestrating multiple molecular players, including MST1, AEP, and C/EBPβ. These findings support that blockade of AEP or stimulation of netrin-1 signaling may provide an innovative disease-modifying therapeutic strategy for treating PD.
View
... The UNC5C gene is found on chromosome 4q22.3 [55], but it was Wetzel-Smith et al. [56 ] who, by combining WES and WGS and linkage analyses in a large late-onset AD (LOAD) pedigree with European ancestry were able to identify a rare variant in codon 835 (rs137875858, T835M), which predisposed patients to LOAD. To validate this finding, a case-control study was performed with 8050 participants with LOAD and 98,194 controls from 4 different cohorts. ...
Alzheimer's disease: Rare variants with large effect sizes
Article
  • Aug 2015
Recent advances in sequencing technology and novel genotyping arrays (focused on low-frequency and coding variants) have made it possible to identify novel coding variants with large effect sizes and also novel genes (TREM2, PLD3, UNC5C, and AKAP9) associated with Alzheimer's disease (AD) risk. The major advantages of these studies over the classic genome-wide association studies (GWAS) include the identification of the functional variant and the gene-driven association. In addition to the large effect size, these studies make it possible to model these variants and genes using cell and animal systems. On the other hand, the underlying population-variability of these very low allele frequency variants poses a great challenge to replicating results. Studies that include very large datasets (>10,000 cases and controls) and combine sequencing and genotyping approaches will lead to the identification of novel genes for Alzheimer's disease. Copyright © 2015 Elsevier Ltd. All rights reserved.
View
... Sequence analysis revealed UNC-5 as a transmembrane protein, expressed on cell surface of pioneer axons and motile cells, repelled by UNC-6 gradient (Hedgecock et al. 1990;Wadsworth et al. 1996). Three vertebrate homologues of unc-5, namely UNC5h1, UNC5h2, and UNC5h3 have been identified in mouse and human , acting as repulsive receptor for Netrin-1, regulating migration of cerebellar neurons and corticospinal tract (CST) axon (Ackerman and Knowles 1998;Finger et al. 2002). A mouse homologue of UNC-5, rostral cerebellar malformation (rcm) gene, was identified, and rcm mutants exhibited cerebellar and midbrain defects, apparently as a result of abnormal neuronal migration . ...
The UNC-53 mediated interactome
Book
Full-text available
  • Jul 2014
View
Guidance Molecules Required for Growth Cone Migration of Cells and Axons
Chapter
  • Jul 2014
In metazoans, neuronal cell bodies and their axons migrate long distances along both the dorsal–ventral and the anterior–posterior axis during different phases of development; additionally, they may also cross the midline in bilaterally symmetric organisms. The leading edge of a migrating cell or an axon is a highly specialized structure, the growth cone (GC). The GC steers through an increasingly complex environment by perceiving attractive and repulsive cues via their cognate receptors expressed on the GC surface. Interestingly, studies in the past two decades revealed that the axon guidance molecules are highly conserved across eukaryotes including UNC-6/Netrins, acting as a bifunctional cue, attracting and repelling GCs via UNC-40/DCC and UNC-5/UNC-5 receptors, respectively, SLT-1/Slit repelling GCs via its receptor SAX-3/Robo, and Wnts acting through their Frizzled (Fz) and Ryk receptors. Besides these universally conserved guidance molecules, there are molecules specific to nematodes steering the GCs during nervous system development.
View
Signaling Switch of the Axon Guidance Receptor Robo3 during Vertebrate Evolution
Article
  • Nov 2014
Development of neuronal circuits is controlled by evolutionarily conserved axon guidance molecules, including Slits, the repulsive ligands for roundabout (Robo) receptors, and Netrin-1, which mediates attraction through the DCC receptor. We discovered that the Robo3 receptor fundamentally changed its mechanism of action during mammalian evolution. Unlike other Robo receptors, mammalian Robo3 is not a high-affinity receptor for Slits because of specific substitutions in the first immunoglobulin domain. Instead, Netrin-1 selectively triggers phosphorylation of mammalian Robo3 via Src kinases. Robo3 does not bind Netrin-1 directly but interacts with DCC. Netrin-1 fails to attract pontine neurons lacking Robo3, and attraction can be restored in Robo3(-/-) mice by expression of mammalian, but not nonmammalian, Robo3. We propose that Robo3 evolution was key to sculpting the mammalian brain by converting a receptor for Slit repulsion into one that both silences Slit repulsion and potentiates Netrin attraction. Copyright © 2014 Elsevier Inc. All rights reserved.
View
The dual role of the ligand UNC-6/Netrin in both axon guidance and synaptogenesis in C. elegans
Article
Full-text available
The extracellular cue UNC-6/Netrin is a well-known axon guidance molecule and recently it has also been shown to be involved with localization of pre-synaptic complexes. Working through the UNC-40/DCC/Fra receptor, UNC-6/Netrin promotes the formation of pre-synaptic terminals between the pre-synaptic AIY interneuron and its post-synaptic partner, the RIA interneuron. In the DA9 motor neuron, UNC-6/Netrin has an alternate role promoting the exclusion of pre-synaptic components from the dendrite via its UNC-5-receptor. Surprisingly, the requirement for UNC-5 persists even after DA9 axon migration is complete, because synapses become mis-localized after it is depleted. This observation provides at least a partial explanation for the persistence of UNC-6/Netrin and UNC-5 in the adult nervous system. These activities parallel the previously known bi-functional axon guidance effects of UNC-6/Netrin, since it can attract cells and axons expressing UNC-40/DCC/Fra and repel those expressing UNC-5 alone or in combination with UNC-40. UNC-6/Netrin cooperates with the Wnt family members to exclude synapses from compartments within the DA9 axon, so that they only occur in regions free of the influence of both UNC-6/Netrin and the Wnts. Regulation of both axon guidance and synapse formation by axon guidance cues permits coordination in circuit assembly between pre- and post-synaptic cells.
View
The Netrins Define a Family of Axon Outgrowth-Promoting Proteins Homologous to C. elegans UNC-6
Article
Full-text available
  • Sep 1994
  • CELL
In vertebrates, commissural axons pioneer a circumferential pathway to the floor plate at the ventral midline of the embryonic spinal cord. Floor plate cells secrete a diffusible factor that promotes the outgrowth of commissural axons in vitro. We have purified from embryonic chick brain two proteins, netrin-1 and netrin-2, that each possess commissural axon outgrowth-promoting activity, and we have also identified a distinct activity that potentiates their effects. Cloning of cDNAs encoding the two netrins shows that they are homologous to UNC-6, a laminin-related protein required for the circumferential migration of cells and axons in C. elegans. This homology suggests that growth cones in the vertebrate spinal cord and the nematode are responsive to similar molecular cues.
View
Mapping of a Gene for Parkinson's Disease to Chromosome 4q21-q23
Article
Full-text available
  • Dec 1996
Parkinson's disease (PD) is the second most common neurodegenerative disorder after Alzheimer's disease, affecting approximately 1 percent of the population over age 50. Recent studies have confirmed significant familial aggregation of PD and a large number of large multicase families have been documented. Genetic markers on chromosome 4q21-q23 were found to be linked to the PD phenotype in a large kindred with autosomal dominant PD, with a Zmax = 6.00 for marker D4S2380. This finding will facilitate identification of the gene and research on the pathogenesis of PD.
View
View
A Synoptic View of the Development of the Vertebrate Central Nervous System
Chapter
  • Jan 1982
The rationale for a position paper on neural development at a conference devoted to “Repair and Regeneration of the Nervous System” is presumably to be found in the widely held, but as yet largely unsubstantiated, view that neural regeneration must recapitulate some, if not all, of the events in neurogenesis. But, in fact, if one excludes regeneration of portions of the neural plate or neural tube, which may lead to essentially complete restoration of the damaged tissue (6), what is usually implied by the terms “regeneration” and “repair” in the central nervous system relates to only two of the many events in neural development, namely, the formation and remodeling of neural connections (and to a lesser extent, to the proliferation, growth, and redeployment of glial cells). However, despite its possibly limited relevance, there is some merit in presenting a synoptic view of the entire sequence of vertebrate neurogenesis, if only to highlight the rather painful fact that the ultimate goal of promoting regeneration and reconstitution of damaged neural tissue remains a very distant prospect.
View
UNC-5, a transmembrane protein with immunoglobulin and thrombospondin type 1 domains, guides cell and pioneer axon migrations in C. elegans
Article
  • Nov 1992
  • CELL
The unc-5 gene is required for guiding pioneering axons and migrating cells along the body wall in C. elegans. In mutants, dorsal migrations are disrupted, but ventral and longitudinal movements are largely unaffected. The gene was tagged for molecular cloning by transposon insertions. Based on genomic and cDNA sequencing, the gene encodes UNC-5, a transmembrane protein of 919 aa. The predicted extracellular N-terminus comprises two immunoglobulin and two thrombospondin type 1 domains. Except for an SH3-like motif, the large intracellular C-terminus is novel. Mosaic analysis shows that unc-5 acts in migrating cells and pioneering neurons. We propose that UNC-5 is a transmembrane receptor expressed on the surface of motile cells and growth cones to guide dorsal movements.
View
Rostral Cerebellar Malformation, (rcm): A New Recessive Mutation on Chromosome 3 of the Mouse
Article
  • Jul 1992
  • J HERED
A new recessive mutation in the mouse that causes a disorderly arrangement of Purkinje and granule cells in the rostral portion of the cerebellum is described. The mutation, called rostral cerebellar malformation, rcm, has been located on chromosome (Chr) 3 between the alcohol dehydrogenase-3 (Adh-3) complex and varitint waddler-J (VaJ).
View
Rakic, P. Principles of neural cell migration. Experientia 46, 882-891
Article
  • Oct 1990
  • Experientia
A basic property of immature neurons is their ability to change position from the place of their final mitotic division in proliferative centers of the developing brain to the specific positions they will occupy in a given structure of the adult nervous system. Proper acquisition of neuron position, attained through the process of active migration, ultimately affects a cell's morphology, synaptic connectivity and function. Although various classes of neurons may use different molecular cues to guide their migration to distant structures, a surface-mediated interaction between neighboring cells is considered essential for all types of migration. Disturbance of this cell-cell interaction may be important in several congenital and/or acquired brain abnormalities. The present article considers the basic mechanisms and principles of neuronal cell migration in the mammalian central nervous system.
View
The unc-5, unc-6, and unc-40 genes guide circumferential migrations of pioneer axons and mesodermal cells on the epidermis in C. elegans
Article
  • Feb 1990
  • NEURON
Three known genes guide circumferential migrations of pioneer axons and mesodermal cells on the nematode body wall. unc-5 affects dorsal migrations, unc-40 primarily affects ventral migrations, and unc-6 affects migrations in both directions. Circumferential movements still occur, but are misdirected whereas longitudinal movements are normal in these mutants. Pioneer growth cones migrating directly on the epidermis are affected; growth cones migrating along established axon fascicles are normal. Thus these genes affect cell guidance and not cell motility per se. We propose that two opposite, adhesive gradients guide circumferential migrations on the epidermis. unc-5, unc-6, and unc-40 may encode these adhesion molecules or their cellular receptors. Neurons have access to the basal lamina and the basolateral surfaces of the epidermis, but mesodermal cells contact only the basal lamina. These genes probably identify molecular cues on the basal lamina that guide mesodermal migrations. The same basal lamina cues, or perhaps related molecules on the epidermal cell surfaces, guide pioneer neurons.
View
Colormarino, S.A. & Tessier-Lavigne, M. The axonal chemoattractant is also chemorepellent for trochlear motor axons. Cell 81, 621−629
Article
  • Jun 1995
  • CELL
Extending axons are guided in part by diffusible chemoattractants that lure them to their targets and by diffusible chemorepellents that keep them away from nontarget regions. Floor plate cells at the ventral midline of the neural tube express a diffusible chemoattractant, netrin-1, that attracts a group of ventrally directed axons. Here we report that floor plate cells also have a long-range repulsive effect on a set of axons, trochlear motor axons, that grow dorsally away from the floor plate in vivo. COS cells secreting recombinant netrin-1 mimic this effect, suggesting that netrin-1 is a bifunctional guidance cue that simultaneously attracts some axons to the floor plate while steering others away. This bifunctionality of netrin-1 in vertebrates mirrors the dual actions of UNC-6, a C. elegans homolog of netrin-1, which is involved in guiding both dorsal and ventral migrations in the nematode.
View
Expression of the UNC-5 guidance receptor in the touch neurons of
Article
  • Aug 1993
Growth cones in developing nervous systems encounter a sequence of extracellular cues during migration. In theory, a growth cone can navigate by selectively expressing or activating surface receptor(s) that recognize extracellular cues appropriate to each migratory phase. Using the simple Caenorhabditis elegans nervous system, we attempted to demonstrate that path selection by migrating growth cones can be predictably altered by ectopic expression of a single receptor. The unc-5 gene of C. elegans encodes a unique receptor of the immunoglobulin superfamily (UNC-5), required cell-autonomously to guide growth cone and mesodermal cell migrations in a dorsal direction on the epidermis. We report here that the UNC-5 receptor induces dorsally oriented axon trajectories when ectopically expressed in the touch receptor neurons which normally extend pioneer axons longitudinally or ventrally on the epidermis. These errant trajectories depend on unc-6, which encodes a putative epidermal path cue, just as normal dorsally oriented axon trajectories do (such as those of certain motor neurons), suggesting that UNC-5 acts to reorient the touch cell growth cones by using its normal guidance mechanisms. These results support previous evidence that UNC-5 and UNC-6 play instructive rules in guiding growth cone migrations on the epidermis in C. elegans, and indicate that pioneering growth cones, which normally migrate in different directions, may use equivalent intracellular signalling mechanisms for guidance.
View