Content uploaded by Kathleen D Danenberg
Author content
All content in this area was uploaded by Kathleen D Danenberg on Mar 21, 2015
Content may be subject to copyright.
1999;59:2302-2306. Cancer Res
Cindy A. Eads, Kathleen D. Danenberg, Kazuyuki Kawakami, et al.
Not Associated with DNA Methyltransferase Overexpression
CpG Island Hypermethylation in Human Colorectal Tumors Is
Updated version
http://cancerres.aacrjournals.org/content/59/10/2302
Access the most recent version of this article at:
Cited Articles
http://cancerres.aacrjournals.org/content/59/10/2302.full.html#ref-list-1
This article cites by 29 articles, 16 of which you can access for free at:
Citing articles
http://cancerres.aacrjournals.org/content/59/10/2302.full.html#related-urls
This article has been cited by 66 HighWire-hosted articles. Access the articles at:
E-mail alerts
related to this article or journal.Sign up to receive free email-alerts
Subscriptions
Reprints and
.pubs@aacr.orgDepartment at
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Permissions
.permissions@aacr.orgDepartment at
To request permission to re-use all or part of this article, contact the AACR Publications
on May 30, 2013. © 1999 American Association for Cancer Research.cancerres.aacrjournals.org Downloaded from
[CANCER RESEARCH 59, 2302–2306, May 15, 1999]
Advances in Brief
CpG Island Hypermethylation in Human Colorectal Tumors Is Not Associated with
DNA Methyltransferase Overexpression
1
Cindy A. Eads, Kathleen D. Danenberg, Kazuyuki Kawakami, Leonard B. Saltz, Peter V. Danenberg, and
Peter W. Laird
2
Departments of Surgery [C. A. E., P. W. L.] and Biochemistry and Molecular Biology [C. A. E., K. D. D., K. K., P. V. D., P. W. L.], University of Southern California, School of
Medicine, Norris Comprehensive Cancer Center, Los Angeles, California 90033, and Memorial Sloan Kettering Cancer Center, New York, New York 10021-6094 [L. B. S.]
Abstract
The molecular basis of aberrant hypermethylation of CpG islands
observed in a subset of human colorectal tumors is unknown. One poten-
tial mechanism is the up-regulation of DNA (cytosine-5)-methyltrans-
ferases. Recently, two new mammalian DNA methyltransferase genes
have been identified, which are referred to as DNMT3A and DNMT3B.
The encoded proteins differ from the predominant mammalian DNA
methyltransferase DNMT1 in that they have a substantially higher ratio of
de novo to maintenance methyltransferase activity. We have used a highly
quantitative 5* nuclease fluorogenic reverse transcription-PCR method
(TaqMan) to analyze the expression of all three DNA methyltransferase
genes in 25 individual colorectal adenocarcinoma specimens and matched
normal mucosa samples. In addition, we examined the methylation pat-
terns offour CpG islands [APC, ESR1 (estrogen receptor), CDKN2A (p16),
and MLH1] to determine whether individual tumors show a positive
correlation between the level of DNA methyltransferase expression and
the frequency of CpG island hypermethylation. All three methyltrans-
ferases appear to be up-regulated in tumors when RNA levels are nor-
malized using either ACTB (
b
-actin) or POLR2A (RNA pol II large
subunit), but not when RNA levels are normalized with proliferation-
associated genes, such as H4F2 (histone H4) or PCNA. The frequency or
extent of CpG island hypermethylation in individual tumors did not
correlate with the expression of any of the three DNA methyltransferases.
Our results suggest that deregulation of DNA methyltransferase gene
expression does not play a role in establishing tumor-specific abnormal
DNA methylation patterns in human colorectal cancer.
Introduction
Vertebrate cytosine-5 DNA methylation occurs in the context of
CpG dinucleotides and is associated with transcriptional inactivity.
CpG islands are areas of high CpG density that are normally unmeth-
ylated. Aberrant de novo methylation of CpG islands is found in a
subset of human colorectal tumors. The abnormal methylation of CpG
islands associated with tumor suppressor genes can lead to transcrip-
tional silencing, inactivating the gene through epigenetic rather than
genetic means (1). When aberrant CpG island hypermethylation oc-
curs in colorectal tumors, it is frequently not restricted to a single CpG
island but affects multiple independent loci (2, 3), reflective of a
widespread deregulation of DNA methylation patterns (1). Although
the molecular basis of such a methylator phenotype is not known, its
global nature suggests a change in trans-acting factors that control the
pattern of distribution of methylated residues. It has recently been
suggested that the nuclear phosphoprotein FOS transforms cells in
part by up-regulating DNMT1 gene expression (4).
DNA methylation results from a methyl transfer reaction performed
by trans-acting enzymes known as DNA methyltransferases. Two
distinct methyl transfer activities can be distinguished, based on the
methylation status of the substrate. Maintenance DNA methyltrans-
ferase activity refers to the conversion of hemimethylated substrates
to a fully methylated state, whereas de novo methyltransferase activity
refers to the new addition of methyl groups at sites that were previ-
ously unmethylated. All known DNA (cytosine-5)-methyltransferases
are able to perform both reactions. The predominant mammalian DNA
(cytosine-5)-methyltransferase, DNMT1, is unusual in that its relative
de novo activity is 1–2 orders of magnitude lower than its mainte-
nance activity (5, 6) Recently, two additional mammalian DNA (cy-
tosine-5)-methyltransferase genes have been identified, which are
referred to as DNMT3A and DNMT3B. These genes differ from
DNMT1 in that the encoded polypeptides DNMT3
a
and DNMT3
b
have approximately equal ratios of de novo DNA methyltransferase
activity:maintenance DNA methyltransferase activity (7). An addi-
tional candidate DNA methyltransferase gene, DNMT2, has been
identified, but the encoded protein has not yet been shown to possess
methyltransferase activity (8–10). DNMT3
a
and DNMT3
b
are
thought to be responsible for the wave of de novo methylation that
occurs during embryogenesis (7). Because the abnormal hypermethy-
lation of CpG islands in colorectal tumors involves the new acquisi-
tion of DNA methylation (de novo methylation), we have investigated
whether transcriptional activation or up-regulation of either DNMT3A
or DNMT3B could be responsible for the methylator phenotype ob-
served in colorectal tumors.
Previous studies have analyzed the expression levels of the DNMT1
gene in human tumors and cell lines, with somewhat conflicting
results (11–15). Some reports documented a substantial increase in the
expression of DNMT1 or of total DNA methyltransferase enzyme
activity in tumor cells, compared to normal counterparts. However,
Lee et al. (14) made the important observation that relative determi-
nations of expression levels can be affected by the gene used for the
normalization of RNA amounts. Normalization with a gene associated
with cell proliferation, such as histone H4 (H4F2) abolished any
statistically significantly higher mean expression of DNMT1 in colo-
rectal tumors compared to matched normal mucosa. One additional
caveat to these studies is that in all cases, mean expression levels were
determined for tumor tissues compared to normal specimens. How-
ever, substantial interindividual variability in DNA methyltransferase
expression exists. None of these studies analyzed CpG island hyper-
methylation frequencies in the same samples to correlate these with
DNA methyltransferase expression or activity.
In this study, we extend the analysis of DNA methyltransferase
expression levels in colorectal tumors in the following ways: (a)we
have analyzed the largest data set used thus far for such an analysis
(25 pairs of tumor and matched normal mucosa); (b) we have used a
Received 1/29/99; accepted 3/30/99.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance with
18 U.S.C. Section 1734 solely to indicate this fact.
1
Supported by NIH/National Cancer Institute Grants R01 CA 71716 (to P. V. D.) and
R01 CA 75090 (to P. W. L.).
2
To whom requests for reprints should be addressed, at University of Southern
California/Norris Comprehensive Cancer Center, Mail Stop # 73,, Room 6418, 1441
Eastlake Avenue, Los Angeles, CA 90033. Phone: (323) 865-0650; Fax: (323) 865-0158;
E-mail: plaird@hsc.usc.edu.
2302
on May 30, 2013. © 1999 American Association for Cancer Research.cancerres.aacrjournals.org Downloaded from
highly quantitative RT-PCR
3
method (Fig. 1) that is linearly accurate
in serial dilutions over 6 orders of magnitude; (c) we have used four
different genes [ACTB (
b
-actin), H4F2 (histone H4), PCNA, or
POLR2A (RNA pol II large subunit)] for normalization of RNA
levels; (d) we have analyzed the expression levels of two new DNA
methyltransferase genes, DNMT3A and DNMT3B, that have not been
investigated previously; (e) we investigated whether the individual
expression levels of any of the three DNA methyltransferases corre-
late with the de novo methylation of four commonly hypermethylated
CpG islands [APC, ESR1 (estrogen receptor), CDKN2A (p16), and
MLH1].
Materials and Methods
Sample Collection. A total of 25 paired tumor and normal mucosal tissue
samples were obtained from 25 patients with primary colorectal adenocarci-
noma. The patients comprised 16 males and 9 females, ranging in age from
39–88 years, with a mean age of 68.8 years. The surgical procedures were
performed in Japan, and a preoperative diagnosis was obtained from a biopsy
and a histological examination. The mucosal distance from the tumor to the
normal specimens was between 10 and 20 cm. Approximately2gofthe
surgically removed tissue were frozen immediately in liquid nitrogen and
stored at 280°C until RNA and DNA isolation. The remaining section of the
sample was fixed with formalin and used for further histological examination
to confirm the diagnosis postoperatively. All histological examinations were
performed after staining with H&E.
Nucleic Acid Isolation. Genomic DNA was isolated by the standard
method of proteinase K digestion and phenol-chloroform extraction (16). Total
RNA was isolated by the single-step guanidinium isothiocyanate method (17).
Quantitative RT-PCR Analysis. The quantitation of mRNA levels was
carried out using a real-time fluorescence detection method as described
previously (18, 19). In brief, after RNA isolation, cDNA was prepared from
each sample as described previously (20). The specific cDNA of interest and
reference cDNA (ACTB, H4F2, PCNA, or POLR2A) were PCR-amplified
separately using an oligonucleotide probe with a 59 fluorescent reporter dye
(6FAM) and a 39 quencher dye (TAMRA; Ref. 21). The 59 to 39 nuclease
activity of Taq DNA polymerase cleaved the probe and released the reporter,
whose fluorescence could be detected by the laser detector of the ABI Prism
7700 Sequence Detection System (Perkin-Elmer Corp., Foster City, CA). After
crossing a fluorescence detection threshold, the PCR amplification results in a
fluorescent signal proportional to the amount of PCR product generated. Initial
template concentration was derived from the cycle number at which the
fluorescent signal crossed a threshold in the exponential phase of the PCR
reaction. Relative gene expression was determined based on the threshold
cycles of the gene of interest and of the internal reference gene. Use of a
reference gene avoids the need to directly quantitate the RNA, which could be
a major source of error for analysis. Several reference samples were included
on each assay plate to verify plate-to-plate consistency. Plates were normalized
to each other using these reference samples, if necessary. Contamination of the
RNA samples by genomic DNA was excluded by an analysis of all RNA
samples without prior cDNA conversion. The PCR amplification was per-
formed using a 96-well optical tray and caps with a 25-
m
l final reaction
mixture consisting of 600 nM each primer; 200 nM probe; 5 units of Ampli-Taq
Gold; 200
m
M each of dATP, dCTP, and dGTP; 400
m
M dUTP; 5.5 mM MgCl
2
;
1 unit of AmpErase uracil N-glycosylase; and 13 TaqMan buffer A containing
a reference dye at 50°C for 2 min and at 95°C for 10 min, followed by 40
cycles at 95°C for 15 s and at 60°C for 1 min. The primer and probe sequences
are listed below. In all cases, the first primer is the forward PCR primer, the
second primer is the TaqMan probe, and the third primer is the reverse PCR
primer.
The primer and probe sequences are as follows: (a) ACTB, TGAGCGCG-
GCTACAGCTT, 6FAM59-ACCACCACGGCCGAGCGG-39 TAMRA, and
CCTTAATGTCACACACGATT; (b) H4F2, CTTAGCCTCAGTGCGAAT-
GCT, 6FAM59-CAGAACCAGAGCACAGCCAAAGCCACTAC-39 TAMRA,
and ACGGTCCCCGGGAGAAT; (c) PCNA, GTGCAAAAGACGGAGT-
GAAATTT, 6FAM59-TGTTTCCATTTCCAAGTTCTCCACTTGCAG-39
3
The abbreviation used is: RT-PCR, reverse transcription-PCR.
Fig. 1. Schematic of quantitative RT-PCR (TaqMan) technology. A, in the PCR
reaction, an oligonucleotide probe tagged with a 59 fluorescent reporter and a 39 quencher
is added in addition to the standard PCR components. The probe is complementary to the
target sequence of interest and anneals during extension. The close proximity of the
quencher to the fluorescent reporter represses fluorescence in the intact probe. As the Taq
polymerase synthesizes the new strand, its 59 to 39 nuclease activity cleaves the probe,
separating the quencher and fluorescent reporter. The fluorescence emitted is proportional
to the amount of product accumulated with each cycle. B, the plot represents a sample
analysis from the experiments shown in Fig. 3. The plot shows the expression values
obtained for three genes (as indicated) in a matched tumor and normal tissue sample. The
horizontal bold line indicates the fluorescence level used for the threshold cycle deter-
mination in this particular example. DRn is defined as the cycle-to-cycle change in the
reporter fluorescence signal normalized to a passive reference fluorescence signal.
2303
DNA METHYLTRANSFERASE EXPRESSION AND HYPERMETHYLATION
on May 30, 2013. © 1999 American Association for Cancer Research.cancerres.aacrjournals.org Downloaded from
TAMRA, and ATCGACATTACTTGTCTGTGACAATTTA; (d) POLR2A,
GCCACCCAGATGACCTTGAA, 6FAM59-CCTTCCACTATGCTGGTGT-
GTCTGCCA-39 TAMRA, and GCACACCCAGCGTCACATT; (e) DNMT1,
GGTTCTTCCTCCTGGAGAATGTC, 6FAM59-CCTTCAAGCGCTCCATG-
GTCCTGAA-39 TAMRA, and GGGCCACGCCGTACTG; (f) DNMT3A,
CAATGACCTCTCCATCGTCAAC, 6FAM59-AGCCGGCCAGTGCCCTC-
GTAG-39 TAMRA, and CATGCAGGAGGCGGTAGAA; and (g) DNMT3B,
CCATGAAGGTTGGCGACAA, 6FAM59-CACTCCAGGAACCGTGAGA-
TGTCCCT-39 TAMRA, and TGGCATCAATCATCACTGGATT.
DNA Methylation Analysis. Genomic DNA extracted from tumor and
normal samples was treated with sodium bisulfite as described previously (22).
After conversion, the DNA was amplified by fluorescence-based, real-time
quantitative PCR (as described above, but without the addition of AmpErase).
Two sets of primers and probes designed specifically for bisulfite-converted
DNA were used: (a) a methylated set for the gene of interest [APC, ESR1,
CDKN2A (p16), or MLH1]; and (b) an internal reference set (MYOD1)to
control for input DNA. The methylated primers and the probe were designed
to contain 1–5 CpG dinucleotides, which amplify only fully methylated mol-
ecules. Specificity of the reactions for methylated DNA was confirmed sepa-
rately using DNAs of known methylation status. The internal reference primers
and the probe were designed in a region of the MYOD1 gene that lacks any
CpG dinucleotides to allow for unbiased amplification. Parallel TaqMan PCR
reactions were performed with primers specific for the bisulfite-converted
methylated sequence for a particular locus and with the MYOD1 reference
primers. The ratio between the values obtained in these two TaqMan analyses
was used as a measure of the degree of methylation at that locus. A ratio
greater than or equal to four times the mean ratio for all normal mucosal
samples was classified as methylated (Figs. 2 and 3, F), and a ratio less than
four was regarded as unmethylated (Figs. 2 and 3, E). The primer and probe
sequences are listed below. In all cases, the first primer listed is the forward
PCR primer, the second primer is the TaqMan probe, and the third primer is the
reverse PCR primer.
The primer and probe sequences were as follows: (a) APC, TTATAT-
GTCGGTTACGTGCGTTTATAT, 6FAM59-CCCGTCGAAAACCCGC-
CGATTA-39 TAMRA, and GAACCAAAACGCTCCCCAT; (b) CDKN2A,
AACAACGTCCGCACCTCCT, 6FAM59-ACCCGACCCCGAACCGCG-39
TAMRA, and TGGAATTTTCGGTTGATTGGTT; (c) ESR1, GGCGT-
TCGTTTTGGGATTG, 6FAM59-CGATAAAACCGAACGACCCGACGA-39
TAMRA, and GCCGACACGCGAACTCTAA; (d) MLH1, CTATCGCCGCCT-
CATCGT, 6FAM59-CGCGACGTCAAACGCCACTACG-39 TAMRA, and
CGTTATATATCGTTCGTAGTATTCGTGTTT; and (e) MYOD1, CCAACTC-
CAAATCCCCTCTCTAT, 6FAM59-TCCCTTCCTATTCCTAAATCCAACCT-
AAATACCTCC-39 TAMRA, and TGATTAATTTAGATTGGGTTTAGAGA-
AGGA.
Statistics. TaqMan analyses performed as described above for either RT-
PCR or DNA methylation studies yield values that are expressed as ratios
between two absolute measurements (DNMT:normalization gene for RT-PCR
and CpG island:MYOD1 for DNA methylation analysis). The ratios for each
type of analysis were subsequently normalized such that the mean ratio of the
25 normal samples would equal a value of 1. Consequently, the values for the
tumor samples represent a fold increase or decrease relative to a mean normal
value of 1. Additional statistical manipulations are described in Tables 1 and 2.
Results and Discussion
DNMT1 Expression in Colorectal Tumors. Fig. 2 shows the
relative expression levels of DNMT1 in 25 individual colorectal
adenocarcinoma samples (f) and 25 matched normal mucosal sam-
ples (hatched bars). The expression levels are displayed as ratios
between DNMT1 and four reference genes (ACTB, Fig. 2A; POLR2A,
Fig. 2B; H4F2, Fig. 2C; and PCNA, Fig. 2D) to correct for variations
in the amounts of RNA. The mean expression levels of DNMT1 in
tumors versus normal mucosal samples were calculated using the four
normalization genes (Table 1; Fig. 2). DNMT1 appeared to be up-
regulated approximately 3.9-fold when ACTB or POLR2A were used
for normalization (Table 1; Fig. 2, A and B). However, this apparent
up-regulation was absent when the proliferation-associated genes
H4F2 or PCNA were used for normalization (Table 1; Fig. 2, C and
D). Similar results have been documented previously (14, 23). These
results indicate that either DNMT1 is truly up-regulated in tumors and
is otherwise normally expressed in a proliferation-independent fash-
ion or that DNMT1 gene expression is proliferation dependent, which
accounts for all of its apparent up-regulation in tumors. The latter
scenario seems more likely in view of the requirement for mainte-
nance DNA methylation during S-phase and in light of the reported
proliferation-dependent gene expression of DNMT1 (23–25).
DNMT3A and DNMT3B Expression in Colorectal Tumors.
Fig. 3 shows the relative expression levels of DNMT3A and DNMT3B
in the same samples as described above. The high values seen in some
of the samples have been reproduced multiple times and are therefore
thought to represent valid ratios. The advantage of the use of multiple
normalization genes is apparent from the variable ratios obtained
within individual samples. For instance, the apparent high value for
DNMT3/PCNA seen in sample 23N is due to an abnormally low
expression of PCNA compared to other reference genes in this
Fig. 2. DNMT1 expression in 25 colorectal tumors and matched normal mucosal
controls. RNA levels were measured by quantitative, real-time RT-PCR in 25 matched
normal (z) and tumor (f) colorectal samples. The expression levels are displayed as
ratios between DNMT1 and four reference genes (A, ACTB; B, POLR2A: C, H4F2, and D,
PCNA) to correct for variations in the amounts of RNA. The ratios for each type of
analysis have been normalized such that the mean ratio of the 25 normal samples equals
a value of 1. CpG island hypermethylation status for four different genes (APC, ESR1,
CDKN2A, and MLH1) is shown below each chart. F, the measured level of DNA
methylation at that CpG island was at least 4-fold higher than the mean level in the 25
normal samples; E, the measured level was below four times the mean level of the normal
samples.
2304
DNA METHYLTRANSFERASE EXPRESSION AND HYPERMETHYLATION
on May 30, 2013. © 1999 American Association for Cancer Research.cancerres.aacrjournals.org Downloaded from
particular sample and is not due to a high level of DNMT3 gene
expression.
The analysis of DNMT3A and DNMT3B expression yielded similar
results to the analysis of DNMT1 expression. DNMT3A expression in
colorectal tumors appears to be elevated by an average of 2.9- and
2.8-fold when RNA levels are normalized using ACTB and POLR2A,
respectively (Table 1; Fig. 3, A and B). Likewise, DNMT3B levels
appear to be up-regulated by an average of 3.6- and 4.0-fold in a
similar analysis (Table 1; Fig. 3, E and F). However, this up-regula-
tion is absent for both genes when RNA levels are normalized using
Table 2 Analysis of the relationship between CpG island hypermethylation and DNA
methyltransferase expression in individual tumors (ANOVA)
ANOVA was used to compare mean DNMT gene expression between categories of
CpG island hypermethylation frequency. Twelve separate ANOVA calculations were
performed to investigate all combinations of the three DNMT genes and the four normal-
ization genes. The P value indicates the probability that the null hypothesis (no difference
in the mean DNMT gene expression levels in the different categories of CpG island
hypermethylation frequency) is correct.
Normalization gene DNMT1 DNMT3A DNMT3B
Nonproliferation-associated gene
ACTB P 5 0.0659 P 5 0.5288 P 5 0.2216
POLR2A P 5 0.2233 P 5 0.6959 P 5 0.3947
Proliferation-associated gene
H4F2 P 5 0.3603 P 5 0.4338 P 5 0.4500
PCNA P 5 0.7098 P 5 0.7209 P 5 0.8879
Fig. 3. DNMT3A and DNMT3B expression in 25 colorectal tumors and matched normal mucosal controls. The expression levels are displayed as ratios between DNMT3A (A–D)
or DNMT3B (E–H) and four reference genes (A and E, ACTB; B and F, POLR2A: C and G, H4F2; D and H, PCNA) to correct for variations in the amounts of RNA. The ratios for
each type of analysis have been normalized such that the mean ratio of the 25 normal samples equals a value of 1. The CpG island hypermethylation status for four different genes
(APC, ESR1, CDKN2A, and MLH1) is shown below each chart. F, the measured level of DNA methylation at that CpG island was at least 4-fold higher than the mean level in the
25 normal samples; E, the measured level was below four times the mean level of the normal samples.
Table 1 Relative mean expression of DNA methyltransferases in tumor versus normal tissue
The mean expression levels are shown of each of the DNMT genes in tumors versus
normal mucosal samples. The expression levels were first calculated as ratios between the
DNMT gene and one of four reference genes (ACTB, POLR2A, H4F2, and PCNA)as
indicated to correct for variations in the amounts of RNA. The ratios were then normal-
ized, such that the mean ratio of the 25 normal samples would equal a value of 1.
Subsequently, the ratios for the tumor samples were averaged to give the mean values
indicated in the table. Consequently, these values represent an average fold increase or
decrease of DNMT gene expression in tumors relative to a mean value of 1 in normal
mucosal samples. The P value for each average indicates the probability that the null
hypothesis (no difference between tumor and normal) is correct.
Normalization gene DNMT1 DNMT3A DNMT3B
Nonproliferation-associated gene
ACTB 3.9 (P , 0.0001) 2.9 (P 5 0.0006) 3.6 (P 5 0.0004)
POLR2A 3.9 (P , 0.0001) 2.8 (P 5 0.0015) 4.0 (P 5 0.0030)
Proliferation-associated gene
H4F2 0.9 (P 5 0.5517) 0.6 (P 5 0.0502) 0.8 (P 5 0.3823)
PCNA 0.8 (P 5 0.1920) 1.0 (P 5 0.9392) 0.8 (P 5 0.7210)
2305
DNA METHYLTRANSFERASE EXPRESSION AND HYPERMETHYLATION
on May 30, 2013. © 1999 American Association for Cancer Research.cancerres.aacrjournals.org Downloaded from
either H4F2 or PCNA for normalization (Table 1; Fig. 3, C, D, G, and
H). The proliferation dependence of DNMT3A and DNMT3B gene
expression is not known. These results could indicate true up-regula-
tion of DNMT3A or DNMT3B in tumors, or the situation could be
analogous to that for DNMT1. Regardless of which of these two
scenarios is correct, if the apparent up-regulation of DNMT3A or
DNMT3B is responsible for the methylator phenotype in some human
colorectal tumors, then the extent of up-regulation should be greater in
tumors with frequent CpG island hypermethylation. We have inves-
tigated whether there is a direct link between expression of any of the
three DNA methyltransferases and the frequency of CpG island hy-
permethylation.
CpG Island Hypermethylation and DNA Methyltransferase Ex-
pression. We analyzed the methylation status of four CpG islands
known to undergo de novo methylation in human colorectal tumors in
all normal and tumor samples. These CpG islands are associated with
the genes APC (26), ESR1 (estrogen receptor; Ref. 27), CDKN2A
(p16) (2), and MLH1 (28, 29). We found that DNMT3A and DNMT3B
do not appear to be up-regulated in the two tumors (samples 10 and
17) with the most frequent (three of four) CpG island hypermethyla-
tion (Fig. 3). Tumors with relatively high DNMT3A or DNMT3B
expression levels tend to have at most one hypermethylated CpG
island. There is just one sample (26T) with high DNMT3A and/or
DNMT3B expression and two hypermethylated CpG islands. A similar
lack of concordance is apparent when CpG island hypermethylation
frequencies are compared to DNMT1 expression levels (Fig. 2).
ANOVA was used to compare the mean DNMT gene expression
between categories of CpG island hypermethylation frequency (Table
2). We performed 12 separate ANOVA calculations to investigate all
combinations of the three DNMT genes and the four normalization
genes. None of these combinations yielded a statistically significant P
value (Table 2), which would have indicated a correlation between the
frequency of CpG island hypermethylation and the level of DNMT
gene expression. Therefore, regardless of whether or not DNMT3A or
DNMT3B gene expression is proliferation dependent, as is DNMT1,
the RNA levels of neither of these two genes in individual tumors
correlate with CpG island hypermethylation frequency.
We conclude that most cases of frequent hypermethylation of CpG
islands in human colorectal tumors do not result from a simple
transcriptional up-regulation of any of the three known DNA meth-
yltransferase genes. This leaves open the possibility that one or more
of these genes are up-regulated posttranscriptionally. It is also con-
ceivable that other factors regulate the activity of the DNA methyl-
transferases, either by interacting with the enzymes themselves or by
regulating access to the DNA substrate. The molecular basis for the
methylator phenotype in human colorectal tumors could be found in
the disruption of the control mechanisms preventing access of the
DNA methyltransferases to CpG islands rather than in the mere
up-regulation of DNA methyltransferase levels in the cell.
Acknowledgments
We thank Dennis Salonga and Ji Min Park for help in generating cDNAs
and in designing TaqMan oligonucleotides.
References
1. Jones, P. A., and Laird, P. W. Cancer epigenetics comes of age. Nat. Genet., 21:
163–167, 1999.
2. Ahuja, N., Mohan, A. L., Li, Q., Stolker, J. M., Herman, J. G., Hamilton, S. R.,
Baylin, S. B., and Issa, J. P. Association between CpG island methylation and
microsatellite instability in colorectal cancer. Cancer Res., 57: 3370–3374, 1997.
3. Liang, G., Salem, C. E., Yu, M. C., Nguyen, H. D., Gonzales, F. A., Nguyen, T. T.,
Nichols, P. W., and Jones, P. A. DNA methylation differences associated with tumor
tissues identified by genome scanning analysis. Genomics, 53: 260–268, 1998.
4. Bakin, A. V., and Curran, T. Role of DNA 5-methylcytosine transferase in cell
transformation by fos. Science (Washington DC), 283: 387–390, 1999.
5. Bestor, T. H. Activation of mammalian DNA methyltransferase by cleavage of a Zn
binding regulatory domain. EMBO J., 11: 2611–2617, 1992.
6. Smith, S. S. Biological implications of the mechanism of action of human DNA
(cytosine-5)methyltransferase. Prog. Nucleic Acid Res. Mol. Biol., 49: 65–111, 1994.
7. Okano, M., Xie, S., and Li, E. Cloning and characterization of a family of novel
mammalian DNA (cytosine-5)methyltransferases. Nat. Genet., 19: 219–220, 1998.
8. Okano, M., Xie, S., and Li, E. Dnmt2 is not required for de novo and maintenance
methylation of viral DNA in embryonic stem cells. Nucleic Acids Res., 26: 2536–
2540, 1998.
9. Van den Wyngaert, I., Sprengel, J., Kass, S. U., and Luyten, W. H. Cloning and
analysis of a novel human putative DNA methyltransferase. FEBS Lett., 426: 283–
289, 1998.
10. Yoder, J. A., and Bestor, T. H. A candidate mammalian DNA methyltransferase
related to pmt1p of fission yeast. Hum. Mol. Genet., 7: 279–284, 1998.
11. El-Deiry, W. S., Nelkin, B. D., Celano, P., Yen, R. W., Falco, J. P., Hamilton, S. R.,
and Baylin, S. B. High expression of the DNA methyltransferase gene characterizes
human neoplastic cells and progression stages of colon cancer. Proc. Natl. Acad. Sci.
USA, 88: 3470–3474, 1991.
12. Issa, J. P., Vertino, P. M., Wu, J., Sazawal, S., Celano, P., Nelkin, B. D., Hamilton,
S. R., and Baylin, S. B. Increased cytosine DNA-methyltransferase activity during
colon cancer progression. J. Natl. Cancer Inst., 85: 1235–1240, 1993.
13. Schmutte, C., Yang, A. S., Nguyen, T. T., Beart, R. W., and Jones, P. A. Mechanisms
for the involvement of DNA methylation in colon carcinogenesis. Cancer Res., 56:
2375–2381, 1996.
14. Lee, P. J., Washer, L. L., Law, D. J., Boland, C. R., Horon, I. L., and Feinberg, A. P.
Limited up-regulation of DNA methyltransferase in human colon cancer reflecting
increased cell proliferation. Proc. Natl. Acad. Sci. USA, 93: 10366–10370, 1996.
15. Kautiainen, T. L., and Jones, P. A. DNA methyltransferase levels in tumorigenic and
nontumorigenic cells in culture. J. Biol. Chem., 261: 1594–1598, 1986.
16. Wolff, R. K., Frazer, K. A., Jackler, R. K., Lanser, M. J., Pitts, L. H., and Cox, D. R.
Analysis of chromosome 22 deletions in neurofibromatosis type 2-related tumors.
Am. J. Hum. Genet., 51: 478–485, 1992.
17. Chomczynski, P., and Sacchi, N. Single-step method of RNA isolation by acid
guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162: 156–
159, 1987.
18. Gibson, U. E., Heid, C. A., and Williams, P. M. A novel method for real time
quantitative RT-PCR. Genome Res., 6: 995–1001, 1996.
19. Heid, C. A., Stevens, J., Livak, K. J., and Williams, P. M. Real time quantitative PCR.
Genome Res., 6: 986–994, 1996.
20. Bender, C. M., Pao, M. M., and Jones, P. A. Inhibition of DNA methylation by
5-aza-29-deoxycytidine suppresses the growth of human tumor cell lines. Cancer Res.,
58: 95–101, 1998.
21. Livak, K. J., Flood, S. J., Marmaro, J., Giusti, W., and Deetz, K. Oligonucleotides
with fluorescent dyes at opposite ends provide a quenched probe system useful for
detecting PCR product and nucleic acid hybridization. PCR Methods Applications, 4:
357–362, 1995.
22. Xiong, Z., and Laird, P. W. COBRA: a sensitive and quantitative DNA methylation
assay. Nucleic Acids Res., 25: 2532–2534, 1997.
23. Teubner, B., and Schulz, W. A. Regulation of DNA methyltransferase during differ-
entiation of F9 mouse embryonal carcinoma cells. J. Cell. Physiol., 165: 284–290,
1995.
24. Papadopoulos, T., Pfeifer, G. P., Hoppe, F., Drahovsky, D., and Muller-Hermelink,
H. K. Proliferation-associated expression of DNA methyltransferase in human em-
bryonic lung cells. Virchows Archiv. B Cell. Pathol. Incl. Mol. Pathol., 56: 371–375,
1989.
25. Szyf, M., Bozovic, V., and Tanigawa, G. Growth regulation of mouse DNA meth-
yltransferase gene expression. J. Biol. Chem., 266: 10027–10030, 1991.
26. Hiltunen, M. O., Alhonen, L., Koistinaho, J., Myohanen, S., Paakkonen, M., Marin,
S., Kosma, V. M., and Janne, J. Hypermethylation of the APC (adenomatous poly-
posis coli) gene promoter region in human colorectal carcinoma. Int. J. Cancer, 70:
644–648, 1997.
27. Issa, J. P., Ottaviano, Y. L., Celano, P., Hamilton, S. R., Davidson, N. E., and Baylin,
S. B. Methylation of the oestrogen receptor CpG island links ageing and neoplasia in
human colon. Nat Genet., 7: 536–540, 1994.
28. Herman, J. G., Umar, A., Polyak, K., Graff, J. R., Ahuja, N., Issa, J. P., Markowitz,
S., Willson, J. K., Hamilton, S. R., Kinzler, K. W., Kane, M. F., Kolodner, R. D.,
Vogelstein, B., Kunkel, T. A., and Baylin, S. B. Incidence and functional conse-
quences of hMLH1 promoter hypermethylation in colorectal carcinoma. Proc. Natl.
Acad. Sci. USA, 95: 6870–6875, 1998.
29. Veigl, M. L., Kasturi, L., Olechnowicz, J., Ma, A. H., Lutterbaugh, J. D., Periyasamy,
S., Li, G. M., Drummond, J., Modrich, P. L., Sedwick, W. D., and Markowitz, S. D.
Biallelic inactivation of hMLH1 by epigenetic gene silencing, a novel mechanism
causing human MSI cancers. Proc. Natl. Acad. Sci. USA, 95: 8698–8702, 1998.
2306
DNA METHYLTRANSFERASE EXPRESSION AND HYPERMETHYLATION
on May 30, 2013. © 1999 American Association for Cancer Research.cancerres.aacrjournals.org Downloaded from
