p53 Is a transcriptional activator of the muscle-specific phosphoglycerate mutase gene and contributes in vivo to the control of its cardiac expression

Abstract

The role that the p53 tumor suppressor gene product plays in cellular differentiation remains controversial. However, recent evidence indicates that p53 is required for proper embryogenesis. We have studied the effect of p53 on the expression mediated by the promoter of the rat muscle-specific phosphoglycerate mutase gene (M-PGAM), a marker for cardiac and skeletal muscle differentiation. Experiments involving transient transfection, mobility shift assay, and site-directed mutagenesis demonstrated that p53 specifically binds and transactivates the M-PGAM promoter. The p53-related proteins p51A and p73L also transactivated M-PGAM. Moreover, stable expression of a p53 dominant mutant in C2C12 cells blocked the induction of M-PGAM expression during the myoblast to myotube transition and the ability of p53, p51A, and p73L to transactivate the M-PGAM promoter. In addition, impaired expression of M-PGAM was observed in a subset of p53-null animals in heart and muscle tissues of anterior-ventral location. These results demonstrate that p53 is a transcriptional activator of M-PGAM that contributes in vivo to the control of its cardiac expression. These data support previous findings indicating a role for p53 in cellular differentiation.

Full text

p53 Is a Transcriptional Activator of the Muscle-specific
Phosphoglycerate Mutase Gene and Contributes
in Vivo to the Control of Its Cardiac Expression
1
Pilar Ruiz-Lozano, Mary L. Hixon, Mark W. Wagner,
Ana I. Flores, Shuntaro Ikawa, Albert S. Baldwin, Jr.,
Kenneth R. Chien, and Antonio Gualberto
2
Departments of Physiology and Biophysics [P. R-L., M. W. W., A. I. F.,
A. G.] and Genetics [M. L. H.], Case Western Reserve University School
of Medicine, Cleveland, Ohio 44106; Department of Medicine and
Center for Molecular Genetics, University of California at San Diego,
California 92093 [P. R-L., K. R. C.]; Department of Cell Biology, IDAC,
Tohoku University, Sendai, Japan 980 [S. I.]; and Lineberger
Comprehensive Cancer Center and Department of Biology, University
of North Carolina at Chapel Hill, North Carolina 27599 [A. S. B.]
Abstract
The role that the p53 tumor suppressor gene product
plays in cellular differentiation remains controversial.
However, recent evidence indicates that p53 is
required for proper embryogenesis. We have studied
the effect of p53 on the expression mediated by the
promoter of the rat muscle-specific phosphoglycerate
mutase gene (M-PGAM), a marker for cardiac and
skeletal muscle differentiation. Experiments involving
transient transfection, mobility shift assay, and site-
directed mutagenesis demonstrated that p53
specifically binds and transactivates the M-PGAM
promoter. The p53-related proteins p51A and p73L also
transactivated M-PGAM. Moreover, stable expression
of a p53 dominant mutant in C2C12 cells blocked the
induction of M-PGAM expression during the myoblast
to myotube transition and the ability of p53, p51A, and
p73L to transactivate the M-PGAM promoter. In
addition, impaired expression of M-PGAM was
observed in a subset of p53-null animals in heart and
muscle tissues of anterior-ventral location. These
results demonstrate that p53 is a transcriptional
activator of M-PGAM that contributes in vivo to the
control of its cardiac expression. These data support
previous findings indicating a role for p53 in cellular
differentiation.
Introduction
The differentiation of cardiac muscle cells is a process that is
beginning to be understood in detail. Cardiogenesis begins
with a commitment of mesodermally derived progenitor cells
to the myocyte lineage in response to endodermal signals,
followed by the formation of the primordial heart tube (1, 2).
Organogenesis then proceeds through a series of involutions
of the heart tube and the onset of septation, chamber for-
mation, and the acquisition of regional-specific properties of
atrial, ventricular, and conduction system cells (3). This proc-
ess progresses during the embryonic life and is completed
early after birth. Each step in cellular differentiation is char-
acterized by the expression of a specific set of molecular
markers. The transcriptional control of these genes depends
upon the synchronized action of cardiac-specific and ubiq-
uitous transcription factors (3).
We isolated previously the rat M-PGAM
3
subunit (4, 5).
M-PGAM encodes a dimeric metabolic enzyme and resem-
bles the MCK gene in its timing and pattern of developmental
expression (6). It is, therefore, not surprising that both genes
contain similar DNA regulatory elements that control their
specific expression in skeletal and cardiac muscle (4, 5).
Previous studies have shown that MCK also contains p53-
responsive elements (7–10). An MCK p53 site was shown to
mediate p53-responsiveness when subcloned into a heter-
ologous minimal promoter (8). Transactivation of MCK by
p53 can be inhibited by MDM2 (11), a protein frequently
amplified in human sarcomas (12). Importantly, although it
has been shown that p53 binds and transactivates the MCK
promoter, little is presently known about the role of p53 in the
activation of this or other muscle-specific genes during myo-
cyte differentiation.
We have investigated the ability of p53 to regulate tran-
scription from the M-PGAM promoter in rat neonatal car-
diocytes, C2C12 cells, and SAOS cells. We show that p53
and p53-related proteins transactivate the rat M-PGAM pro-
moter. Moreover, we identified a p53-responsive element in
the M-PGAM promoter. This DNA element contains a con-
sensus p53 DNA binding site that is highly homologous (86%
identity) to that located in the MCK enhancer. Mobility shift
assays detected binding of endogenous rat cardiac p53 and
purified human p53 to the M-PGAM p53 site. In addition,
mutagenesis of the M-PGAM p53 site blocked the transac-
tivation of the M-PGAM promoter by p53 in C2C12 cells and
decreased its expression in rat neonatal cardiocytes. Impor-
tantly, reduced M-PGAM expression was observed by in situ
hybridization and Northern analysis in a subset of p53-null
animals. Strikingly, differences were observed specifically in
muscle tissues of anterior and ventral location, such as
tongue or heart. These results demonstrate that p53 directly
Received 10/15/98; revised 2/11/99; accepted 3/8/99.
The costs of publication of this article were defrayed in part by the
payment of page charges. This article must therefore be hereby marked
advertisement in accordance with 18 U.S.C. Section 1734 solely to indi-
cate this fact.
1
This work was supported in part by American Heart Association Grant
9750205N (to A. G.) and NIH Grants AI35098 (to A. S. B.) and HL46345 (to
K. R. C.).
2
To whom requests for reprints should be addressed, at Department of
Physiology and Biophysics, Case Western Reserve University School of
Medicine, 10900 Euclid Avenue, Cleveland, OH 44106-4970. Phone:
(216) 368-3400; Fax: (216) 368-3658; E-mail: axg29@po.cwru.edu.
3
The abbreviations used are: M-PGAM, muscle-specific phosphoglycer-
ate mutase gene; MCK, muscle creatine kinase gene; CAT, chloramphen-
icol acetyltransferase; CMV, cytomegalovirus; ANF, atrial natruiretic factor
gene; MLC2v, myosin light chain 2v gene; EMSA, electrophoretic mobility-
shift assay; p.c., postcoitum; GAPDH, glyceraldehyde 3-phosphate de-
hydrogenase.
295Vol. 10, 295–306, May 1999 Cell Growth & Differentiation

interacts with and transactivates the M-PGAM promoter and
support a role for this protein as a regulator of gene expres-
sion during muscle differentiation.
Results
p53 Transactivates the Rat M-PGAM Gene Promoter. To
test the effect of p53 on the transcription mediated by the
M-PGAM promoter, we transfected primary rat neonatal car-
diocytes, C2C12 cells, and SAOS cells with a reporter plas-
mid containing ⫺400- to ⫹5-bp sequences of the M-PGAM
promoter subcloned upstream of the CAT gene (plasmid
M-PGAM CAT). We have previously shown that this pro-
moter fragment accounts for most of the M-PGAM promoter
strength and mediates its muscle-specific expression (5).
M-PGAM CAT was cotransfected in combination with CMV-
driven expression vectors containing no insert, human wild-
type p53, or a dominant mutant p53 cDNA sequences in
normal rat neonatal cardiocytes, C2C12 cells, or SAOS cells.
C2C12 is a myoblast cell line that carries wild-type p53 (13),
whereas SAOS is a human osteosarcoma cell line that lacks
both p53 alleles (14). Cells were then incubated for 48 h,
harvested, and processed for the assay of CAT enzyme
activity. Fig. 1Ashows that the basal expression mediated by
M-PGAM was higher in neonatal cardiocytes than in C2C12
or SAOS cells. Cotransfection of M-PGAM CAT with the
wild-type p53 expression vector did not alter M-PGAM CAT
expression in neonatal cardiocytes. However, cotransfection
of M-PGAM CAT with the mutant p53 expression vector in
neonatal cardiocytes originated a 60% decrease in CAT
activity. In contrast, cotransfection of M-PGAM CAT with the
wild-type p53 expression vector in C2C12 and SAOS cells
resulted in strong activation of M-PGAM CAT activity. No
transactivation was observed when M-PGAM CAT was co-
transfected with a mutant p53 expression plasmid in C2C12
and SAOS cells (Fig. 1A). Titration experiments indicated that
maximal transactivation by p53 was reached using 3
␮
gof
the CMV-p53 expression plasmid (Fig. 1B). As a whole, these
data indicated that the transcriptional activity mediated by
the M-PGAM promoter is regulated by p53. The lack of
transactivation of M-PGAM by wild-type p53 in neonatal
cardiocytes suggested that the level of endogenous p53
protein in neonatal cardiocytes saturates a putative
M-PGAM p53-responsive promoter element. The inhibition
of M-PGAM CAT activity obtained by the overexpression of
the mutant p53 form supported this hypothesis. It has pre-
viously been shown that structural p53 mutant proteins may
work as dominant negative mutants, inhibiting the transcrip-
tional activity of the wild-type protein (8, 15–17). Intriguingly,
although C2C12 cells contain wild-type p53, M-PGAM was
transactivated by cotransfection with the CMV-p53 vector in
these cells. These results suggested that endogenous p53 is
not transcriptionally active in C2C12 cells at basal condi-
tions. Cotransfection of wild-type p53 with a ⫺2kbto⫹5bp
M-PGAM CAT construct in C2C12 cells did not result in a
higher level of transcriptional activation by p53, indicating
that upstream sequences are not required for full transacti-
vation of the M-PGAM promoter by this protein (data not
shown). Also, the presence of wild-type p53 protein in neo-
natal cardiocytes and C2C12 was confirmed by immunopre-
cipitation with antibody PAb 246 (data not shown).
It has been recently shown that members of a family of
proteins, referred as p51, p63, or p73, which show significant
sequence similarity with p53, are able to transactivate p53
gene targets such as the p21cip, Bax, MDM2, cyclin G,
GADD45, and IGF-BP3 promoters as well as p21 and RGC
p53 site reporter constructs (18–25). We investigated the
ability of two members of this family, p51A (p51A/p63
␥
) and
p73L (p63
␣
/p51B/p73L), to transactivate the M-PGAM pro-
moter in C2C12 cells. Fig. 1Bshows that p51A and, at a
lower intensity, p73L were able to transactivate M-PGAM.
These experiments supported further the hypothesis that
M-PGAM is a p53 gene target. Although the regulation of
M-PGAM expression by multiple members of this family of
proteins deserves further investigation, here we have fo-
cused our attention on the regulation of M-PGAM by p53, the
best-characterized member of this family.
As an experimental control, we tested the ability of p53 to
transactivate two muscle-specific reporter constructs con-
taining a 639-bp ANF promoter (26) or a 250-bp MLC2v
promoter (27). A repression of the transcription mediated by
these promoters was observed (Fig. 1C). Thus, the activation
of M-PGAM by p53 was specific.
The Rat M-PGAM Gene Promoter Contains a Wild-
Type p53-responsive Element. To identify an M-PGAM
promoter element that could mediate the effects of p53, we
assayed a series of M-PGAM CAT deletion mutants by co-
transfection with the wild-type p53 expression vector. Be-
cause the effect of p53 on M-PGAM in primary neonatal
cardiocytes may be masked by the presence of endogenous
p53 protein, these assays were performed in SAOS cells. The
result of these experiments is shown in Fig. 1D. The M-
PGAM CAT deletion mutants defined a promoter fragment
between ⫺172- and ⫺87-bp sequences that mediates re-
sponsiveness to p53. Similar results were obtained with
C2C12 cells (Fig. 1E). Inspection of the ⫺172- to ⫺87-bp
promoter sequences revealed the presence of a consensus
p53 binding site at positions ⫺116- to ⫺90-bp. Interestingly,
this site is strikingly homologous to the MCK and RGC p53
sites (Fig. 2) and contains two TGCCT (pentamers) motifs
(28–30). Also, an additional imperfect pentamer, TGCCA,
was found five nucleotides upstream of this site (data not
shown). This finding strongly suggested that p53 directly
interacts with the M-PGAM promoter.
p53 Directly Interacts with the M-PGAM Gene Pro-
moter. A specific interaction of p53 with the M-PGAM pro-
moter was investigated by EMSA using the oligonucleotide
probe (duplex) tcgacTGCCACTGGTTGCCTGCCTCTGC-
CTG (M-PGAM, pentamer motifs underlined) and nuclear
extracts prepared from neonatal rat hearts. One major nu-
cleoprotein complex band was observed that was effectively
competed by a mass excess of an oligonucleotide containing
the p53 MCK site but not by oligonucleotides containing
Sp1- or nuclear factor
␬
B-binding sites (Fig. 3A,p53, arrow-
head). Thus, the formation of this complex was p53 site
specific. The presence of p53 in this band was then con-
firmed using anti-p53 monoclonal antibodies. A supershift
was observed with the addition to the EMSA reactions of the
anti-p53 antibodies PAb 421 (31) and DO-1 (32), which rec-
ognize wild-type p53 associated with DNA (Ref. 33; Fig. 3B).
However, PAb 240, a monoclonal antibody that recognizes
mutant p53 (34), had no effect (Fig. 3B). In summary, these
experiments demonstrated that endogenous rat heart p53
binds specifically to the M-PGAM p53 consensus site. A
small amount of nucleoprotein complex was not supershifted
by the PAb 421 and DO-1 antibodies. This result suggested
that either some of the p53 in the complex was not recog-
nized by the antibodies, as has been shown by others (33), or
other proteins were present in this band. However, because
296 Regulation of Muscle Gene Expression by p53

most of the complex was supershifted by the anti-p53 anti-
bodies, we can conclude that, at least in neonatal cardiac
cells, p53 is the major factor binding the M-PGAM p53
consensus site.
In addition, the direct interaction of p53 with M-PGAM
promoter sequences was investigated by EMSA using a
purified baculovirus-expressed human p53 protein. Fig. 3C
shows that human p53 binds to the rat M-PGAM probe with
Fig. 1. p53 transactivates the M-PGAM promoter. A, effect of wild-type and mutant p53 on the transcriptional activity mediated by the M-PGAM promoter.
Neonatal rat cardiocytes (NRC), C2C12 cells, and SAOS cells were cotransfected by lipofection with 10
␮
gofa⫺415, ⫹5 M-PGAM reporter vector, 1
␮
g
of CMV-Luc, and 3
␮
g of CMV-driven expression vectors containing wild-type p53 sequences (53), the p53 structural mutant 143A (53m), or no insertion
(v). Cells were incubated for 48 h, and CAT activity measured as indicated in “Materials and Methods.” CAT activity is expressed as a percentage of
acetylated chloramphenicol. Columns, means of three independent experiments; bars, SD. B, effect of p51A and p73L on the transcriptional activity
mediated by the M-PGAM promoter. C2C12 cells were cotransfected with 10
␮
gofthe⫺415, ⫹5 M-PGAM reporter vector, 1
␮
g of CMV-Luc, and 0, 0.1,
0.3, 1, 3, or 10
␮
g of CMV-driven expression vectors containing wild type p53 (p53), p51A (p51A) or p73L (p73L) sequences. Total amount of vectors was
adjusted using a CMV empty vector. Incubations and CAT assays were as above. Columns, means of three independent experiments; bars, SD. C, effect
of wild-type and mutant p53 on the transcriptional activity mediated by the MLC2v and ANF promoters. Neonatal rat cardiocytes (NRC) were cotransfected
with 1
␮
g of RSV2-
␤
GAL, 10
␮
g of luciferase reporter vectors containing a 639-bp ANF or 250-bp MLC2v promoter fragments, and 3
␮
g of CMV control
(v), wild type (53), or 143A mutant (53m) p53 expression plasmids. Cells were incubated for 48 h and processed for luciferase and
␤
GAL assays. Promoter
activity is represented as the ratio between luciferase and
␤
-galactosidase activities. Columns, means of two independent experiments; bars, SD. Dand
E, identification of the wild-type p53-responsive area in the M-PGAM promoter. SAOS (D) and C2C12 (E) cells were cotransfected by lipofection with 10
␮
g of the indicated stepwise deleted fragments of the M-PGAM promoter subcloned upstream of a CAT reporter gene plasmid, 1
␮
g of CMV-Luc and 3
␮
g the control (v), wild-type (53), or 143A mutant (53m) p53 expression plasmids. Cells were incubated for 48 h and processed for CAT activity assay. Other
details were as in A.Columns, means of three independent experiments; bars, SD.
297Cell Growth & Differentiation

a similar affinity than to other oligonucleotide probes con-
taining consensus p53 sites from the RGC or MCK genes.
Moreover, binding of p53 to the M-PGAM probe was com-
peted by a mass excess of an oligonucleotide containing a
consensus p53 site (MCK) but not by an unrelated sequence
(Fig. 3D). In summary, these experiments confirmed that p53
specifically interacts with the M-PGAM promoter.
p53 Is Required for Full Activation of the M-PGAM
Promoter in Rat Cardiocytes. To determine whether the
M-PGAM p53 consensus binding site was responsible for
the transactivation of the M-PGAM promoter by wild-type
p53, we created an M-PGAM reporter construct with point
mutations at the two consensus p53 pentamer motifs,
namely ⌬p53 M-PGAM CAT. The native and mutant
M-PGAM CAT plasmids were transfected in rat neonatal
cardiocytes and cells incubated and processed for the assay
of CAT activity. Mutation of the consensus pentamer motifs
decreased the transcriptional activity mediated by the M-
PGAM promoter in neonatal cardiocytes by ⬃65% (Fig. 4A).
In addition, we cotransfected C2C12 cells with the native or
mutant M-PGAM CAT reporters and wild-type or mutant p53
expression vectors. The results of these experiments, shown
in Fig. 4B, indicated that mutagenesis of the M-PGAM p53
binding site blocks the transactivation of this promoter by
wild-type p53. Thus, these experiments confirmed that the
M-PGAM promoter contains a consensus p53 binding site
that mediates the transactivation of this promoter by p53.
Moreover, these experiments demonstrate that the
M-PGAM-responsive element is constitutively active in pri-
mary rat neonatal cardiocytes but not in C2C12 myoblasts.
p53 Regulates the Expression of the M-PGAM Gene
Promoter in Vivo. The experiments described above sug-
gested that p53 function might be important for the regula-
tion of M-PGAM expression in vivo. To begin to elucidate the
role that p53 may play in the transcriptional control of M-
PGAM in vivo, we investigated the effect of the expression of
a dominant mutant p53 protein on M-PGAM expression in
C2C12 cells. For that purpose, we generated a cell line of
mutant p53-expressing C2C12 cells by the stable transfec-
tion of these cells with a retroviral-based vector containing a
selectable marker and p53 143A cDNA sequences. Control
cells were generated by the stable transfection of an empty
vector. Metabolic labeling and immunoprecipitation using an
anti-mutant p53 specific antibody demonstrated stable ex-
pression of the mutant p53 protein in C2C12 cells (Fig. 5A).
A similar procedure was employed previously by Soddu et al.
(13) to demonstrate the requirement of wild-type p53 func-
tion for the transcriptional activity of a reporter plasmid con-
taining multiple copies of the p53 RGC site. Control and
mutant p53-expressing C2C12 cells were then induced to
differentiate by incubation for 2–4 days in low serum medium
supplemented with insulin and transferrin (13). The results of
these experiments, shown in Fig. 5B, demonstrate that mu-
tant p53 blocks the induction of endogenous M-PGAM ex-
pression during myocyte differentiation. As an experimental
control, the expression of MCK and ANF in these RNA ex-
tracts was also investigated. A modest effect of mutant p53
on MCK expression was observed only at early incubation
times (Fig. 5C), suggesting the existence of some differences
in the control of the expression of M-PGAM and MCK during
muscle differentiation (35). ANF expression was barely de-
tectable in these extracts and was not affected by mutant
p53 (data not shown).
Moreover, when C2C12 myoblasts were transfected with
the native or ⌬53 mutant M-PGAM CAT reporters and then
induced to differentiate as above, the mutagenesis of the p53
site originated a dramatic decrease in the induction of CAT
expression (Fig. 5D). These results demonstrated that inter-
action of p53 or p53-related proteins with M-PGAM is re-
quired for the induction of the activity of this promoter during
the myoblast to myotube transition in C2C12 cells. However,
experiments of gel shift assay showed no changes in protein
binding to the M-PGAM p53 site during this period (data not
shown). Thus, other processes, such as protein-protein in-
teraction, may be implicated in the regulation of M-PGAM
transactivation by p53 and related factors during myocyte
differentiation.
Subsequent experiments investigated the role that p53
plays in the control of M-PGAM expression in vivo using
Northern analysis and in situ hybridization of gene tran-
scripts. Control and p53 null mouse embryos at day 13.5 p.c.
were employed in these studies. This stage was selected
because it represents the period of maximal expression of
p53 in mouse embryonic development (36–38). Crosses be-
tween mice heterozygous for a targeted mutation in exon 5 of
p53 on the inbred 129/sv genetic background (129/Sv-
Trp53
tmlTyj
mice) yielded 17% homozygous mutant offspring
(6 of 34 embryos). A preliminary Northern analysis revealed
no significant differences in the level of whole-animal M-
PGAM expression between a control and a p53-null embryos
(data not shown). M-PGAM expression was then investi-
gated by in situ hybridization. This technique was used be-
cause it provided the advantage to study M-PGAM expres-
sion in an individual and tissue-specific fashion. Fig. 6A
shows a typical muscle-specific distribution of M-PGAM
transcripts found in control embryos. M-PGAM mRNA was
enriched in heart cavities, eluding the valvular system, and
diaphragm, whereas no expression was found in bone or
lung. Similarly, M-PGAM transcripts accumulated at tongue,
limb, and intercostal muscles (data not shown). Control ex-
periments using a sense M-PGAM riboprobe resulted in
background hybridization levels over these tissue sections
(data not shown). The expression of M-PGAM in p53-null
mice was characterized by a similar muscle-specific distri-
bution, indicating that p53 does not affect the tissue speci-
ficity of this transcript (Fig. 6, B–D, and data not shown).
Three of five p53-null embryos studied had no alterations in
M-PGAM expression (60%). However, in two of these em-
bryos (40%), reduced M-PGAM expression was detected.
Strikingly, lower levels of M-PGM expression were evi-
denced in muscle organs of anterior-ventral but not in lateral
locations. Although a small reduction (⬍30%) in M-PGAM
expression was observed in embryonic hindlimb muscles
(Fig. 6, Band E), M-PGAM hybridization was reduced by 40
and 65%, respectively, at heart and tongue muscles related
to their wild type p53 littermates (Fig. 6, C, D, and F). This
defective pattern of M-PGAM expression was not observed
in any of the control embryos studied (six in total; data not
shown). Importantly, the lower M-PGAM expression in these
p53 null animals was not due to organ hypoplasia. Nuclei
Fig. 2. Consensus p53 sites in the M-PGAM,MCK, and RGC genes.
M-PGAM sequences were from the rat M-PGAM gene positions ⫺116 to
⫺90 bp. MCK and RGC sequences were as described previously (8, 15).
298 Regulation of Muscle Gene Expression by p53

counts per optical field were similar in day 13.5 p.c. hearts
and tongues of control and p53 null embryos with low M-
PGAM expression (not shown). In addition, M-PGAM expres-
sion was first detected in control animals at day 11 p.c. in
heart and tail muscles (Fig. 6E). This localized expression
spread to lateral muscles by day 13.5 p.c. (Figure 6B). There-
fore, because all p53-null animals demonstrated relatively
normal M-PGAM expression in hindlimb muscles, it is highly
unlikely that a defective M-PGAM expression in heart was
originated by deferred development.
To confirm these results, new crosses between heterozy-
gous 129/Sv-Trp53
tmlTyj
mice were carried out yielding a
16.6% homozygous mutant offspring (3 of a total of 18
embryos at day 13.5 p.c.). Northern analysis of whole em-
bryo M-PGAM transcripts demonstrated a significant reduc-
tion in M-PGAM expression in one of three p53-null embryos
obtained (Fig. 7). No change in M-PGAM expression was
found in six heterozygous p53 mutant embryos studied (data
not shown). In summary, these experiments showed a re-
duced M-PGAM expression in a subset of p53-null animals.
These data demonstrated that p53 contributes to the regu-
lation of M-PGAM expression in vivo and support previous
observations that indicate a role for p53 in mouse embryo-
genesis (37, 39).
The fact that partial penetrance was observed in p53 null
animals whereas a more dramatic decrease in M-PGAM
expression was observed in C2C12 cells that stably express
a mutant p53 protein, prompted us to investigate the possi-
bility that mutant p53, in addition to inactivate wild-type p53,
may interfere with the ability of other p53-related proteins to
Fig. 3. p53 binds the rat
M-PGAM promoter. A, EMSA
showing the binding of neonatal
rat heart p53 to an M-PGAM pro-
moter probe. Nuclear extracts
were prepared from rat neonatal
cardiocytes as indicated in “Ma-
terials and Methods.” Five
␮
gof
nuclear extracts were assayed by
EMSA using 0.2 ng of a M-PGAM
p53 site oligonucleotide probe
and 10
␮
g of poly (dI 䡠dC):(dI 䡠dC)
in buffer B. Extracts were incu-
bated for 30 min with 40 ng of the
indicated oligonucleotides prior
to the addition of the M-PGAM
probe. B, supershift assay identi-
fying p53 bound to an M-PGAM
probe. EMSA reactions were as
above. One
␮
g of the respective
antibodies was added to the re-
action, and extracts were incu-
bated for1hat37°C. C, EMSA of
purified human baculovirus ex-
pressed human p53 using a se-
ries of DNA probes. Binding reac-
tions were prepared as in A.D,
EMSA of purified human baculo-
virus-expressed human p53 us-
ing 0.2 ng of the M-PGAM probe
and 0, 0.1, 1, or 10 ng of the
indicated oligonucleotide com-
petitor. For a description of these
oligonucleotides probes and
other experimental details, see
“Materials and Methods.” Figures
show experiments that are repre-
sentative of at least two assays.
299Cell Growth & Differentiation

transactivate the M-PGAM promoter. To test this hypothesis,
C2C12 cells were cotransfected with the M-PGAM CAT re-
porter plasmids and CMV-driven expression vectors con-
taining p53, p51A, or p73L sequences, alone or in the pres-
ence of a p53 143A expression vector. Interestingly, mutant
p53 blocked in part the transactivation of M-PGAM by p53,
p51A, and p73L (Fig. 8A). Moreover, these proteins failed to
transactivate the M-PGAM promoter in C2C12 cells stably
expressing p53 143A (Fig. 8B). These results demonstrate
that, at least in transient transfection assays, mutant p53
may interfere with the ability of p51A and p73L to activate
M-PGAM expression. These results are in agreement with
recent data demonstrating that mutant p53 blocks the tran-
scriptional activity of p73 isoforms (24). These data suggest
the possibility that p53-related proteins may compensate for
some p53 functions in p53 null animals and may reconcile
some of the differences observed between C2C12 cells ex-
pressing mutant p53 and p53-null embryos.
Discussion
We have found that the expression mediated by the rat
M-PGAM promoter is regulated by p53. The activation by
p53 of the activity of an M-PGAM CAT reporter construct
was demonstrated in C2C12 and SAOS cells (Fig. 1A). Trans-
fection of wild-type p53 in rat neonatal cardiocytes did not
alter M-PGAM CAT activity (Fig. 1A). However, the expres-
sion of a dominant mutant p53 form in these cells inhibited
M-PGAM-mediated expression. The fact that some mutant
p53 proteins behave in a dominant negative fashion, inhib-
iting the transactivation of coexpressed or endogenous wild-
type p53, is well documented (40–42). In view of these data,
we interpreted that the overexpression of mutant p53 protein
in neonatal cardiocytes inhibited the endogenous wild-type
p53 that constitutively transactives the M-PGAM promoter.
This hypothesis was supported by the reduction of the tran-
scriptional activity mediated by the M-PGAM promoter in
neonatal cardiocytes by the mutagenesis of the M-PGAM
p53 site (Fig. 4, see below). Moreover, current experiments in
our laboratory indicate that overexpression of the p53 tran-
scriptional inhibitor protein MDM2 (11) in neonatal cardio-
cytes represses M-PGAM expression in a p53 site-depen-
dent manner (data not shown). The fact that p53 protein is
expressed in neonatal cardiocytes has been shown previ-
ously (36). Also, gel shift assays demonstrated that p53 is the
major factor in neonatal hearts binding a p53 consensus site
in the M-PGAM promoter (Fig. 3).
Maximal transactivation of M-PGAM in C2C12 was ob-
served with 1–3
␮
g of a p53 expression vector (Fig. 1B).
Similar concentrations of p51A and p73L expression vectors
were required for maximal M-PGAM promoter activity. Lower
amounts of p53 and p53-related proteins have been shown
to transactivate p53 gene targets in other cell types (24).
However, in agreement with our results, relatively large con-
centrations of p53 were used by others to determine the
ability of p53 to transactivate gene targets in muscle cells (7,
8). We have seen also that 1–3
␮
g of a p53 expression vector
were required in C2C12 to obtain maximal transactivation of
reporter plasmids containing the RGC p53 site (PG13) or a
p21 promoter fragment (not shown). These results indicate
that M-PGAM is as responsive to p53 transactivation as
other p53 targets. We hypothesize that the differences ob-
served with the results obtained in other cell types are orig-
inated by the lower transfection efficiency of muscle cells.
A wild-type p53-responsive promoter fragment in the M-
PGAM promoter was defined by cotransfection of a wild-
type p53 expression vector and a series of M-PGAM CAT
deletion mutants in C2C12 and SAOS cells (Fig. 1, Band C).
Inspection of this DNA sequence revealed the presence of
two TGCCT pentamers motifs at positions ⫺116 to ⫺90 bp
with an additional imperfect pentamer TGCCA 5 nucleotides
upstream. This putative p53 binding site was found to be
strikingly homologous to the MCK and RGC p53 sites (Fig. 2).
Importantly, mutagenesis of this site decreased the activity
of M-PGAM in neonatal cardiocytes and blocked the trans-
activation of the M-PGAM promoter by wild-type p53 in
C2C12 cells (Fig. 4). These experiments demonstrated that
the rat M-PGAM promoter contains a wild-type p53 consen-
sus site that mediates the transactivation of M-PGAM by this
protein. A similar sequence, with 13 of 17 identical nucleo-
tides, was found in the human M-PGAM promoter, suggest-
ing that this element is well conserved (data not shown).
Whether the human M-PGAM promoter is also responsive to
p53 should be the object of further investigation. EMSA
detected the binding of endogenous rat cardiac p53 and
purified baculovirus-expressed human p53 to the p53 M-
PGAM site (Fig. 3). Importantly, these experiments demon-
strated that p53 directly interacts with M-PGAM promoter
sequences. The fact that rat and human p53 are both able to
bind with high affinity the rat M-PGAM promoter in a specific
Fig. 4. Mutagenesis of the M-PGAM p53 binding site blocks p53 trans-
activation of the M-PGAM promoter. A, transient transfection assay show-
ing the effect of the mutagenesis of the p53 site on the transcription
mediated by the M-PGAM promoter in rat neonatal cardiocytes. Cells
were transfected with 1
␮
g of CMV-Luc and 10
␮
g of plasmids M-PGAM
CAT (WT) or M-PGAMp53⌬CAT (⌬53), incubated for 48 h and processed
for the assay of CAT activity as indicated in “Materials and Methods.” B,
transient transfection assay showing the effect of the mutagenesis of the
p53 site on the transactivation of M-PGAM by p53. C2C12 cells were
cotransfected with 1
␮
g of CMV-Luc, 10
␮
g of reporter plasmids M-PGAM
CAT (WT), or M-PGAMp53⌬CAT (⌬53) and 3
␮
g of expression plasmids
CMV (CMV), CMV-p53 (CMV-p53), or CMV-p53 143 A (CMV-p53m). Cells
were incubated for 48 h and processed for the assay of CAT activity, as
indicated in “Materials and Methods.” Column, means of three experi-
ments; bars, SD.
300 Regulation of Muscle Gene Expression by p53

manner indicated that the interaction between p53 and M-
PGAM is well conserved.
Finally, a role for p53 in the transcriptional regulation of
M-PGAM was demonstrated in C2C12 cells (Fig. 5) and in
mouse embryos (Figs. 6 and 7). Strikingly, a decrease in
M-PGAM expression was observed in p53-null mouse em-
bryos in heart and tongue but not at limb muscles, indicating
that p53 contributes to the control of M-PGAM expression in
muscle tissues of anterior-ventral location. Studies of p53
expression during mouse embryogenesis indicated high lev-
els of p53 mRNA in all tissues (38). At late stages of devel-
opment, p53 expression becomes more pronounced in cells
undergoing differentiation (38). A similar scenario has been
observed during chicken embryogenesis (43), supporting the
hypothesis that p53 plays a role in tissue-specific differenti-
ation. Multiple studies have implicated the p53 tumor sup-
pressor gene during differentiation in vitro (13, 14, 44–50).
These results were disputed by the absence of developmen-
tal alterations initially reported in p53 null animals (51, 52).
However, recent evidence has indicated the presence of
neural tube and cranio-facial malformations in a subset of
p53-null animals (37, 39, 53). These data underscore the fact
that p53 may be important in normal development as well as
in tumorigenesis. Sah et al. (37) hypothesized that, during
neural tube closure, p53 could have a role in mediating cell
cycle arrest to limit cell proliferation or to prepare cells for a
differentiation event. Our results support the hypothesis that
p53 may have a role as a positive regulator of muscle cell
differentiation in vivo. These results are not in contradiction
to the well-known cell cycle regulatory properties of p53. The
growth suppressor properties of p53 are well substantiated
by the ability of this protein to inhibit the proliferation of
cultured tumor cells (54), prevent neoplastic transformation
in vitro (55–59), and inhibit the formation of tumors in animal
models (24). Importantly, unlike in skeletal muscle, where
cellular proliferation and a differentiated phenotype are mu-
tually exclusive (60), the increase in cardiac mass during
embryonic life arises predominantly from the proliferation of
mononucleated differentiated cardiomyocytes (61). Terminal
differentiation, with irreversible withdrawal from the cell cy-
cle, does not take place in cardiomyocytes until shortly after
birth (62). Our results indicate that p53 may function in the
heart as a regulator of a specific set of genes associated with
phenotypic differentiation rather than as a growth suppres-
sor. This conclusion is supported by recent data of Soddu et
al. (13) indicating that, in the C2C12 model, inactivation of
p53 function affects cell differentiation but not cell cycle
arrest.
Fig. 5. Expression of a mutant p53 form blocks the increase in M-PGAM expression during the terminal differentiation of C2C12 cells. A, immunopre-
cipitation of mutant p53 with antibody PAb 240 in C2C12 cells infected with vector pBabe (no insert, pBabe) or vector pBabe p53 143A (p53143A). Cells
were incubated with radiolabeled methionine, harvested, and lysed; PAb 240-reactive p53 was immunoprecipitated; and immunoprecipitates were resolved
by SDS-PAGE and exposed to a PhosphorImager screen (Molecular Dynamics). B, Northern analysis of M-PGAM expression in C2C12 stable transfected
with plasmids pBabe (pBabe, no insert) or pBabe p53 143A (p53143A). Cells (3 ⫻10
4
cells/cm
2
) were incubated in serum-free DMEM supplemented with
10
␮
g/ml insulin and 5
␮
g/ml transferrin for 2–4 days (13). RNA was isolated and processed for Northern analysis, as indicated in “Materials and Methods.”
RNA integrity was verified by reprobing with a GAPDH sequence (American Type Culture Collection). The figure is representative of two experiments. C,
Northern analysis of MCK expression in the C2C12 RNA extracts used in part B.MCK sequence probe was from American Type Culture Collection. D, effect
of the mutagenesis of the p53 M-PGAM site on the activation of M-PGAM CAT during the terminal differentiation of C2C12 cells. C2C12 cells were
cotransfected with 1
␮
g of CMV-Luc and 10
␮
g of reporter plasmids M-PGAM CAT (WT) or M-PGAMp53⌬CAT (⌬53). Cells were incubated for 72 h in DMEM
with 10% fetal bovine serum (10% Serum) or in serum-free DMEM supplemented with 10 and 5
␮
g/ml transferrin (No Serum), harvested, and processed
for the assay of CAT activity as indicated in “Materials and Methods.” Column, means of three experiments; bars, SD.
301Cell Growth & Differentiation

Fig. 6.In situ hybridization of M-PGAM transcripts in normal and p53-null embryos. Homozygous p53 ⫹/⫹and ⫺/⫺null mouse embryos were generated
from heterozygous, 129-Trp53 p53 (⫹/⫺) intercrosses and identified by PCR genotypic analysis using primers designed against the neo gene, as described
by Jacks et al. (52). Day 13.5 p.c. embryos were sacrificed, fixed in cold 4% paraformaldehyde, dehydrated through graded ethanol series, and embedded
in paraffin wax. Seven-
␮
m-thick paraffin sections were processed, as indicated in “Materials and Methods.” Plasmid Sm2 containing M-PGAM cDNA
sequences was digested with NcoI and an
35
S-UTP-labeled riboprobe was generated using T3 RNA polymerase. In situ hybridizations were carried out for
16 h at 60°C. Slides were washed and exposed to autoradiographic emulsion for 5 weeks, developed in D19 Kodak solution, counterstained with toluidine
302 Regulation of Muscle Gene Expression by p53

Our results represent one of the first observations in vivo of
a gene expression defect gene originated by p53 inactiva-
tion. Previously, Macleod et al. (63) demonstrated that p53 is
required in most tissues for the expression of p21 in re-
sponse to exposure to
␥
radiation. The fact that p53 may
exert a localized developmental role may explain the limited
in vivo data. The reasons for a selective pattern of transcrip-
tional regulation by p53 are unknown. In addition, molecular
redundancy could compensate for the lack of p53 function at
posterior-lateral locations. Molecular redundancy has been
shown to underlie the paucity of developmental alterations
observed in knockout animals lacking the expression of ma-
jor transcriptional regulators of muscle-specific expression
(64, 65). As indicated above, several p53 homologs has been
recently shown to transactivate p53 gene targets (18–25).
We show that p51A and p73L may both transactivate the
M-PGAM promoter (Fig. 1B). The results of our EMSA sug-
gest that p53 is the major factor interacting with the M-
PGAM p53 consensus site in neonatal cardiocytes (Fig. 3B).
However, p53-related proteins may play a more important
role in the regulation of the promoter activity of M-PGAM in
other muscle tissues. Interestingly, it has been shown that
p51 is expressed at high levels in skeletal muscle (19). The
physiological role of p51 is yet unknown. However, its ability
to transactivate M-PGAM and other p53 targets in skeletal
muscle deserves further investigation.
Finally, we have seen that a p53 mutant protein was able
to block the ability of p53, p51A, and p73L to transactivate
M-PGAM (Fig. 8). These results are in agreement with a
recent report by Di Como et al. (24) that mutant p53 proteins
may interfere with the transcriptional activity of p53-related
proteins. This is not surprising, considering the high degree
of sequence homology between the members of this family.
As stated above, these data may reconcile some of the
discrepancies observed between our C2C12 and p53 null
embryo experiments (Figs. 5 and 6). In addition, it is well-
known that mutant p53 proteins may display gain-of-function
properties that cannot be completely explained by the inac-
tivation of wild-type p53 (66). Mutant p53 proteins may work
as transcriptional activators by a mechanism that do not
require the inactivation of wild-type p53 (67, 68). Our results
and those of Di Como et al. (24) suggest a second mecha-
nism of mutant p53 gain of function, the inactivation of
p53-related proteins.
Materials and Methods
Animals. Heterozygous 129/Sv-Trp53
tmlTyj
mice were purchased from
The Jackson Laboratory. Control (⫹/⫹) and homozygous p53 null (⫺/⫺)
mouse embryos were generated from heterozygous intercrosses and
identified by PCR genotypic analysis using primers designed for the neo
gene, as described previously by Jacks et al. (52).
Cell Culture, Cell Extracts, Transfections, and Reporter Assays.
Rat neonatal cardiocyte cultures were prepared as described previously
(13). C2C12 and SAOS cells were from American Type Culture Collection
Fig. 8. Mutant p53 blocks p53, p51A, and p73L transactivation. A, tran-
sient transfection assay showing the effect of the expression of p53 143A
on the ability of p53, p51A, and p73L to transactivate the M-PGAM CAT.
C2C12 cells stable transfected with plasmid pBabe (C2C12 pBabe) were
transfected with 1
␮
g of CMV-Luc; 10
␮
g of plasmid M-PGAM CAT; 1
␮
g
of CMV (CMV), CMV-p53 (p53), CMV-p51A (p51A), or CMV-p73L (p73L);
and 3
␮
g of CMV (C)or3
␮
g of CMV-p53 143A (Mut). Cells were incubated
for 48 h and processed for the assay of CAT activity, as indicated in
“Materials and Methods.” B, transient transfection assay showing the
effect the stable expression of p53 143A on the abilities of p53, p51A, and
p73L to transactivate the M-PGAM CAT. C2C12 cells stable transfected
with plasmid pBabe p53 143A (C2C12 pBabe 143A) were transfected with
1
␮
g of CMV-Luc, 10
␮
g of plasmid M-PGAM CAT, and 1
␮
gofCMV
(CMV), CMV-p53 (p53), CMV-p51A (p51A), or CMV-p73L (p73L). Cells
were incubated for 48 h and processed for the assay of CAT activity as
described in A.
blue solution, and mounted in Permount. A,top, representative microphotograph (⫻40) of a p53 ⫹/⫹saggital embryo section showing in situ hybridization
of cardiac M-PGAM transcripts; bottom, dark-field microphotograph. b, bone; aw, upper airways; l, lung; h, heart. B,in situ hybridization of M-PGAM
transcripts in coronal sections hindlimbs of p53 ⫹/⫹(left) and p53 ⫺/⫺(right) mouse embryos. s, skin. C,in situ hybridization of M-PGAM transcripts in
coronal heart sections of p53 ⫹/⫹(left)orp53⫺/⫺(right) embryos. v, heart valve; w, ventricular wall; x, nonspecific blood staining. D,in situ hybridization
of M-PGAM transcripts in saggital tongue sections of p53 ⫹/⫹(left) and p53 ⫺/⫺(middle and right) embryos. t, tongue; s, skin. E,in situ hybridization of
M-PGAM transcripts in a saggital section of an 11-day p.c. p53 ⫹/⫹embryo. F, counts of hybridization grains per optical field (Nikon Diaphot ocular grid)
in tissue sections of p53 ⫹/⫹and ⫺/⫺mice. Two p53 (⫹/⫹) and two p53 (⫺/⫺) embryos were analyzed. Columns, means of 10 optical fields per sample;
bars, SD.
Fig. 7.M-PGAM expression in mouse embryos. Northern analysis of
M-PGAM expression in day 13.5 p.c. 129Sv-Trp53 control (⫹/⫹) and
homozygous p53 null (⫺/⫺) mouse embryos. RNA was isolated from
whole embryos and processed for Northern analysis as indicated in “Ma-
terials and Methods.” RNA integrity was verified by reprobing with a
GAPDH sequence (American Type Culture Collection). *, p53-null embryo
with low M-PGAM expression and exencephaly. The figure is represent-
ative of two independent experiments.
303Cell Growth & Differentiation

(Manassas, VA). Cells were cultured in DMEM plus 10% dialyzed fetal
bovine serum (Life Technologies, Inc., Grand Island, NY) with penicillin (10
units/ml) and streptomycin (10 units/ml). C2C12-pBabe and -pBabe 143A
cells were generated by transfection of C2C12 cells with plasmids pBabe
or pBabe p53 143A, followed by selection in medium supplemented with
3
␮
g/ml puromycin. Polyclonal populations at passages 1–3 were used.
Nuclear extracts were prepared as described previously (68). Extracts
were aliquoted, quickly frozen in liquid N
2
, and stored at ⫺80°C. For
transfection, C2C12 cells were incubated as above until 80% confluency
and transfected by the lipofectamine method following the recommenda-
tions of the manufacturer (Life Technologies, Inc.). Neonatal cardiocytes
were transfected by the calcium phosphate method as described (5). As
a control for transfection efficiency, cells were cotransfected with 1
␮
gof
CMV promoter-driven luciferase vector (69). Transfection efficiency was
also independently monitored using a CMV-CAT plasmid (85% CAT con-
version). 48 h after transfection, cells were lysed by 5⬙ultrasonic vibrations
at 4°C using a Branson sonifier at a setting of 3. Equal amounts of
luciferase activity units, as determined by a luminescence assay (Pro-
mega, Madison, WI), were then analyzed for CAT activity using TLC
(Baker, Phillipsburg, NJ). Chromatography plates were scanned using a
PhosphorImager screen and quantified using ImageQuant software (Mo-
lecular Dynamics). Alternatively, chloramphenicol acetyltransferase activ-
ity was measured using the Fluor diffusion assay (70). CAT activity was
expressed as a percentage of acetylated chloramphenicol. Luciferase and
␤
-galactosidase activities were measured as described previously (71).
Plasmids. The CAT reporter plasmids containing stepwise deleted
fragments of the rat M-PGAM gene were as described previously (4).
Plasmid M-PGAM CAT contains ⫺415 to ⫹5M-PGAM sequences. Site-
directed mutagenesis was performed by PCR, as described previously
(72). The M-PGAMp53⌬CAT plasmid contains ⫺415 to ⫹5bpM-PGAM
sequences with the substitution (double strand, p53 sites underlined)
CTGCAGCCTCGGTAC for TGCCTGCCTCTGCCT at positions ⫺105 to
⫺90 bp. The ANF and MLC2v reporter vectors were as described previ-
ously (26, 27, 73). The CMV enhance-promoter-driven expression vectors
containing wild-type p53 or the structural mutant p53 143A form; the
reporter plasmid PG13, containing 13 copies of a wild type p53 consensus
binding site; and the p21 promoter luciferase reporter plasmid were all
gifts from Dr. B. Vogelstein (Johns Hopkins University, Baltimore, MD;
Refs. 74 and 75). The pBabe p53 143A plasmid containing p53 mutant
143A sequences and a puromycin selectable marker was generated by
the subcloning of a p53 mutant 143A cDNA fragment originated by BamHI
digestion of plasmid CMV-p53 143A into the retroviral-based vector
pBabe (76). The p51A and p73L expression vectors were generated by
subcloning p51A and p73L cDNA sequences into pCMV (19).
EMSAs. The oligonucleotide probe sequences used were as follows
(double-stranded): RGC, tcgacCTTGCCTGGACTTGCCTGG, with the p53
consensus site at the ribosomal gene cluster gene (75); MCK, TGGC-
CGGGGCCTGCCTCTCTCTGCCTCTGA, with the p53 binding site at the
MCK enhancer (8); C/EBP, tcgacAAGTTGAGAAATTTG, with the C/EBP
consensus site at the 422 (aP2) promoter (77); Sp1
I
, CGGGACTGGG-
GAGTGGCGAGCCCTC, Sp1
II
, CAGGGAGGCGTGGCCTGGGCGG-
GACTGGGG, and
␬
B, tcgacGCTGGGGACTTTCCAGGG, with the Sp1
I
,
Sp1
II
and 3⬘
␬
B sites, respectively, at the HIV1 long terminal repeat (78).
DNA oligonucleotides were prepared with an Applied Biosystems 391EP
DNA synthesizer using the phosphoramidite method and purified using
Sep-Pak C18 cartridges (Waters Associates, Milford, MA). Gel shift mo-
bility assays were prepared as follows: in a 10-
␮
l reaction volume con-
taining buffer B [20 mMHEPES (pH 7.5), 100 mMKCl, 0.2
␮
MZnCl
2
,1
␮
M
DTT, 1
␮
Mphenylmethylsulfonyl fluoride, and 5% glycerol], 10
␮
gof
poly(dI 䡠dC):(dI 䡠dC), and 5
␮
g of nuclear extract protein per reaction.
Incubation time was 30 min at 20°C, unless otherwise indicated. Equal
amounts of cardiac protein extracts were assayed in each condition as
determined by the Bradford assay (Bio-Rad). When antibodies were
added to the reaction mix, the total incubation time was1hat20°C.
Mouse monoclonal antibodies anti-p53 PAb 240, 246, 421, and 1801 were
purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Purified
baculovirus-expressed human p53 protein was as described previously
(14). Oligonucleotide probes used in the binding assays were labeled with
T4 polynucleotide kinase (NEB) and [
␥
-
32
P] ATP (⬎4500 Ci/mmol; Amer-
sham, Piscataway, NJ). Labeled probes were purified using Pharmacia
spun columns according to the directions of the manufacturer. Oligonu-
cleotide competition experiments were carried out with a fixed concen-
tration of probe and 200-fold excess of nonlabeled competitor. Reactions
were loaded into a 5% nondenaturating polyacrylamide gels previously
prerun for 15 min at 200 V. Electrophoresis was performed at 20 V/cm in
22 mMTris-borate buffer with 0.5 mMEDTA. Gels were dried and exposed
to film overnight at ⫺70°C with an intensifying screen. Alternatively, dried
gels were scanned using a PhosphorImager screen and analyzed using
ImageQuant software (Molecular Dynamics, Sunnyvale, CA).
Immunoprecipitations. Antibodies were purchased from Santa Cruz
Biotechnology, except anti-
␤
-actin, which was from Sigma Chemical Co.
(St. Louis, MO). In immunoprecipitation studies, 2 ⫻10
7
cells were
washed twice for 10 min in 10 ml of methionine-free DMEM and incubated
for 4 h at 37°C in 5 ml of new medium with 2.5 mCi of [
35
S]methionine
(1175 Ci/mmol; NEN). Cells were collected by centrifugation and lysed in
1 ml of immunoprecipitation buffer: PBS containing 1% Triton X-100,
0.1% SDS, 1 mMsodium orthovanadate, 1 mMDTT, and 1 mMphenyl-
methylsulfonyl fluoride, followed by centrifugation at 1500 ⫻gfor 10 min.
Cell lysates were incubated in the presence of 1
␮
g of the corresponding
antibody at 4°C for 4 h followed by incubation for 1 h with protein
A/G-agarose (Santa Cruz Biotechnology). Immunoprecipitates were col-
lected by centrifugation at 5000 ⫻gfor 10 min, washed five times with 1
ml of immunoprecipitation buffer, resuspended in SDS-PAGE sample
buffer, boiled for 5 min, and electrophoresed by 15% PAGE. Dried gels
were exposed to a PhosphorImager screen and analyzed using Image-
Quant software (Molecular Dynamics).
Northern Blot Analysis. RNA was isolated from 13.5 p.c. mouse
embryos or C2C12 cells using Trizol reagent (Life Technologies, Inc.). For
Northern analysis, 30
␮
g of total RNA were electrophoresed in a 1.3%
agarose/formaldehyde gel, visualized using ethidium bromide, transferred
to nitrocellulose filters (Amersham), fixed by UV cross-linking, and baked
at 80°C for 1 h. For hybridizations, 3 ⫻10
6
cpm/ml of a random primed
32
P-labeled NcoI/SmaIM-PGAM cDNA fragment was used as a probe (5).
The MCK and GAPDH sequences used for the generation of probes were
from American Type Culture Collection. The ANF probe was as described
previously (73). Filters were hybridized at 42°C in 40% formamide with 6⫻
SSC, 2⫻Denhardt’s solution, 0.1% SDS, and 0.1 mg/ml denaturated
salmon sperm DNA for 4 h, washed in 0.2⫻SSC at 60°C, and exposed to
autoradiography film. Radioactive bands were also quantified using a
PhosphorImager screen and ImageQuant software (Molecular Dynamics).
In Situ Hybridizations. On day 13.5 p.c., embryos were sacrificed,
fixed in cold 4% paraformaldehyde, dehydrated through graded ethanol
series, and embedded in paraffin wax. Seven-
␮
m-thick paraffin sections
were mounted in polylysine-pretreated slides. Tissue sections were then
dewaxed, rehydrated, and treated with acetic anhydride. Specimens were
then dehydrated and dried. In situ hybridizations were performed accord-
ing to the method described in Lyons et al. (79). A Sm2 genomic fragment
of M-PGAM (5) was digested with NcoI and a
35
S-UTP-labeled riboprobe
was generated using T3 RNA polymerase. Hybridizations were carried out
for 16 h at 60°C. Slides were then washed and exposed to Ilford autora-
diographic emulsion for 5 weeks, developed in D19 Kodak solution,
counterstained with 0.2% toluidine blue solution, and mounted in Per-
mount. Alternatively, slides were exposed for 3 days to Kodak Biomax
film.
Acknowledgments
We thank J. Jacobberger, J. Nagy, G. Pons, M. Rico, and B. Vogelstein for
reagents and suggestions.
References
1. Schultheiss, T. M., Xydas, S., and Lassar, A. B. Induction of avian
cardiac myogenesis by anterior endoderm. Development (Camb.), 121:
4203–4214, 1995.
2. Sugi, Y., and Lough, J. Anterior endoderm is a specific effector of
terminal cardiac myocyte differentiation of cells from the embryonic heart
forming region. Dev. Dyn., 200: 155–162, 1994.
3. Olson, E. N., and Srivastava, D. Molecular pathways controlling heart
development. Science (Washington DC), 272: 671–676, 1996.
4. Nakatsuji, Y., Hidaka, K., Tsujino, S., Yamamoto, Y., Mukai, T., Yanagi-
hara, T., Kishimoto, T., and Sakoda, S. A single MEF-2 site is a major
positive regulatory element required for transcription of the muscle-spe-
cific subunit of the human phosphoglycerate mutase gene in skeletal and
cardiac muscle cells. Mol. Cell. Biol., 12: 4384–4390, 1992.
5. Ruiz-Lozano, P., de Lecea, L., Buesa, C., Perez de la Osa, P., LePage,
D., Gualberto, A., Walsh, K., and Pons, G. The gene encoding rat phos-
phoglycerate mutase subunit M: cloning and promoter analysis in skeletal
muscle cells. Gene, 147: 243–248, 1994.
304 Regulation of Muscle Gene Expression by p53

6. Adamson, E. D. Isoenzyme transitions of creatine phosphokinase, al-
dolase and phosphoglycerate mutase in differentiating mouse cells. J.
Embryol. Exp. Morphol., 35: 355–367, 1976.
7. Weintraub, H., Hauschka, S., and Tapscott, S. J. The MCK enhancer
contains a p53 responsive element. Proc. Natl. Acad. Sci. USA, 88:
4570–4571, 1991.
8. Zambetti, G. P., Bargonetti, J., Walker, K., Prives, C., and Levine, A. J.
Wild-type p53 mediates positive regulation of gene expression through a
specific DNA sequence element. Genes Dev., 6: 1143–1152, 1992.
9. Tamir, Y., and Bengal, E. p53 protein is activated during muscle dif-
ferentiation and participates with MyoD in the transcription of muscle
creatine kinase gene. Oncogene, 17: 347–356, 1998.
10. Zhao, J., Schmieg, F. I., Logsdon, N., Freedman, D., Simmons, D. T.,
and Molloy, G. R. p53 binds to a novel recognition sequence in the
proximal promoter of the rat muscle creatine kinase gene and activates its
transcription. Oncogene, 13: 293–302, 1996.
11. Momand, J., Zambetti, G. P., Olson, D. C., George, D., and Levine,
A. J. The mdm-2 oncogene product forms a complex with the p53 protein
and inhibits p53-mediated transactivation. Cell, 69: 1237–1245, 1992.
12. Oliner, J. D., Kinzler, K. W., Meltzer, P. S., George, D. L., and
Vogelstein, B. Amplification of a gene encoding a p53-associated protein
in human sarcomas. Nature (Lond.), 358: 80–83, 1992.
13. Soddu, S., Blandino, G., Scardigli, R., Coen, S., Marchetti, A., Rizzo,
M. G., Bossi, G., Cimino, L., Crescenzi, M., and Sacchi, A. Interference
with p53 protein inhibits hematopoietic and muscle differentiation. J. Cell
Biol., 134: 193–204, 1996.
14. Chen, P. L., Chen, Y. M., Bookstein, R., and Lee, W. H. Genetic
mechanisms of tumor suppression by the human p53 gene. Science
(Washington DC), 250: 1576–1580, 1990.
15. Kern, S. E., Pietenpol, J. A., Thiagalingam, S., Seymour, A., Kinzler,
K. W., and Vogelstein, B. Oncogenic forms of p53 inhibit p53-regulated
gene expression. Science (Washington DC), 256: 827–830, 1992.
16. Harvey, M., Vogel, H., Morris, D., Bradley, A., Bernstein, A., and
Donehower, L. A. A mutant p53 transgene accelerates tumour develop-
ment in heterozygous but not nullizygous p53-deficient mice. Nat. Genet.,
9: 305–311, 1995.
17. Farmer, G., Bargonetti, J., Zhu, H., Friedman, P., Prywes, R., and
Prives, C. Wild-type p53 activates transcription in vitro. Nature (Lond.),
358: 83–86, 1992.
18. Schmale, H., and Bamberger, C. A novel protein with strong homol-
ogy to the tumor suppressor p53. Oncogene, 15: 1363–1367, 1997.
19. Osada, M., Ohba, M., Kawahara, C., Ishioka, C., Kanamaru, R., Katoh,
I., Ikawa, Y., Nimura, Y., Nakagawara, A., Obinata, M., and Ikawa, S.
Cloning and functional analysis of human p51, which structurally and
functionally resembles p53. Nat. Med., 4: 839–843, 1998.
20. Trink, B., Okami, K., Wu, L., Sriuranpong, V., Jen, J., and Sidransky,
D. A new human p53 homologue. Nat. Med., 4: 747–748, 1998.
21. Bian, J., and Sun, Y. p53CP, a putative p53 competing protein that
specifically binds to the consensus p53 DNA binding sites: a third member
of the p53 family? Proc. Natl. Acad. Sci. USA, 94: 14753–14758, 1997.
22. Jost, C. A., Marin, M. C., and Kaelin, W. G., Jr. p73 is a human
p53-related protein that can induce apoptosis. Nature (Lond.), 389: 191–
194, 1997.
23. Kaghad, M., Bonnet, H., Yang, A., Creancier, L., Biscan, J. C., Valent,
A., Minty, A., Chalon, P., Lelias, J. M., Dumont, X., Ferrara, P., McKeon, F.,
and Caput, D. Monoallelically expressed gene related to p53 at 1p36, a
region frequently deleted in neuroblastoma and other human cancers.
Cell, 90: 809–819, 1997.
24. Di Como, C. J., Gaiddon, C., and Prives, C. p73 function is inhibited
by tumor-derived p53 mutants in mammalian cells. Mol. Cell. Biol., 19:
1438–1449, 1999.
25. Senoo, M., Seki, N., Ohira, M., Sugano, S., Watanabe, M., Inuzuka, S.,
Okamoto, T., Tachibana, M., Tanaka, T., Shinkai, Y., and Kato, H. A
second p53-related protein, p73L, with high homology to p73. Biochem.
Biophys. Res. Commun., 248: 603–607, 1998.
26. Harris, A. N., Ruiz-Lozano, P., Chen, Y. F., Sionit, P., Yu, Y. T., Lilly,
B., Olson, E. N., and Chien, K. R. A novel A/T-rich element mediates ANF
gene expression during cardiac myocyte hypertrophy. J. Mol. Cell. Car-
diol., 29: 515–525, 1997.
27. Zhu, H., Garcia, A. V., Ross, R. S., Evans, S. M., and Chien, K. R. A
conserved 28-base-pair element (HF-1) in the rat cardiac myosin light-
chain-2 gene confers cardiac-specific and
␣
-adrenergic-inducible expres-
sion in cultured neonatal rat myocardial cells. Mol. Cell. Biol., 11: 2273–
2281, 1991.
28. Wang, Y., Reed, M., Wang, P., Stenger, J. E., Mayr, G., Anderson,
M. E., Schwedes, J. F., and Tegtmeyer, P. p53 domains: identification and
characterization of two autonomous DNA-binding regions. Genes Dev., 7:
2575–2586, 1993.
29. Pavletich, N. P., Chambers, K. A., and Pabo, C. O. The DNA-binding
domain of p53 contains the four conserved regions and the major muta-
tion hot spots. Genes Dev., 7: 2556–2564, 1993.
30. Bargonetti, J., Manfredi, J. J., Chen, X., Marshak, D. R., and Prives, C.
A proteolytic fragment from the central region of p53 has marked se-
quence-specific DNA-binding activity when generated from wild-type but
not from oncogenic mutant p53 protein. Genes Dev., 7: 2565–2574, 1993.
31. Banks, L., Matlashewski, G., and Crawford, L. Isolation of human-
p53-specific monoclonal antibodies and their use in the studies of human
p53 expression. Eur. J. Biochem., 159: 529–534, 1986.
32. Vojtesek, B., Bartek, J., Midgley, C. A., and Lane, D. P. An immuno-
chemical analysis of the human nuclear phosphoprotein p53. New mono-
clonal antibodies and epitope mapping using recombinant p53. J. Immu-
nol. Methods, 151: 237–244, 1992.
33. Hupp, T. R., Meek, D. W., Midgley, C. A., and Lane, D. P. Regulation
of the specific DNA binding function of p53. Cell, 71: 875–886, 1992.
34. Gannon, J. V., Greaves, R., Iggo, R., and Lane, D. P. Activating
mutations in p53 produce a common conformational effect. A monoclonal
antibody specific for the mutant form. EMBO J., 9: 1595–1602, 1990.
35. Andres, V., Cusso, R., and Carreras, J. Distribution and developmen-
tal transition of phosphoglycerate mutase and creatine phosphokinase
isozymes in rat muscles of different fiber-type composition. Differentia-
tion, 41: 72–77, 1989.
36. Kim, K. K., Soonpaa, M. H., Daud, A. I., Koh, G. Y., Kim, J. S., and
Field, L. J. Tumor suppressor gene expression during normal and patho-
logic myocardial growth. J. Biol. Chem., 269: 22607–22613, 1994.
37. Sah, V. P., Attardi, L. D., Mulligan, G. J., Williams, B. O., Bronson,
R. T., and Jacks, T. A subset of p53-deficient embryos exhibit exen-
cephaly. Nat. Genet., 10: 175–180, 1995.
38. Schmid, P., Lorenz, A., Hameister, H., and Montenarh, M. Expression
of p53 during mouse embryogenesis. Development (Camb.), 113: 857–
865, 1991.
39. Armstrong, J. F., Kaufman, M. H., Harrison, D. J., and Clarke, A. R.
High-frequency developmental abnormalities in p53-deficient mice. Curr.
Biol., 5: 931–936, 1995.
40. Unger, T., Mietz, J. A., Scheffner, M., Yee, C. L., and Howley, P. M.
Functional domains of wild-type and mutant p53 proteins involved in
transcriptional regulation, transdominant inhibition, and transformation
suppression. Mol. Cell. Biol., 13: 5186–5194, 1993.
41. Hachiya, M., Chumakov, A., Miller, C. W., Akashi, M., Said, J., and
Koeffler, H. P. Mutant p53 proteins behave in a dominant, negative fashion
in vivo. Anticancer Res., 14: 1853–1859, 1994.
42. Chen, J. Y., Funk, W. D., Wright, W. E., Shay, J. W., and Minna, J. D.
Heterogeneity of transcriptional activity of mutant p53 proteins and p53
DNA target sequences. Oncogene, 8: 2159–2166, 1993.
43. Louis, J. M., McFarland, V. W., May, P., and Mora, P. T. The phos-
phoprotein p53 is down-regulated post-transcriptionally during embryo-
genesis in vertebrates. Biochim. Biophys. Acta, 950: 395–402, 1988.
44. Feinstein, E., Gale, R. P., Reed, J., and Canaani, E. Expression of the
normal p53 gene induces differentiation of K562 cells. Oncogene, 7:
1853–1857, 1992.
45. Gerwin, B. I., Spillare, E., Forrester, K., Lehman, T. A., Kispert, J.,
Welsh, J. A., Pfeifer, A. M., Lechner, J. F., Baker, S. J., Vogelstein, B., et
al. Mutant p53 can induce tumorigenic conversion of human bronchial
epithelial cells and reduce their responsiveness to a negative growth
factor, transforming growth factor
␤
-1. Proc. Natl. Acad. Sci. USA, 89:
2759–2763, 1992.
46. Kastan, M. B., Radin, A. I., Kuerbitz, S. J., Onyekwere, O., Wolkow,
C. A., Civin, C. I., Stone, K. D., Woo, T., Ravindranath, Y., and Craig, R. W.
Levels of p53 protein increase with maturation in human hematopoietic
cells. Cancer Res., 51: 4279–4286, 1991.
47. Shaulsky, G., Goldfinger, N., and Rotter, V. Alterations in tumor de-
velopment in vivo mediated by expression of wild-type or mutant p53
proteins. Cancer Res., 51: 5232–5237, 1991.
305Cell Growth & Differentiation

48. Shaulsky, G., Goldfinger, N., Peled, A., and Rotter, V. Involvement of
wild-type p53 in pre-B-cell differentiation in vitro. Proc. Natl. Acad. Sci.
USA, 88: 8982–8986, 1991.
49. Radinsky, R., Fidler, I. J., Price, J. E., Esumi, N., Tsan, R., Petty, C. M.,
Bucana, C. D., and Bar-Eli, M. Terminal differentiation and apoptosis in
experimental lung metastases of human osteogenic sarcoma cells by
wild-type p53. Oncogene, 9: 1877–1883, 1994.
50. Woodworth, C. D., Wang, H., Simpson, S., Alvarez-Salas, L. M., and
Notario, V. Overexpression of wild-type p53 alters growth and differenti-
ation of normal human keratinocytes but not human papillomavirus-
expressing cell lines. Cell Growth Differ., 4: 367–376, 1993.
51. Donehower, L. A., Harvey, M., Slagle, B. L., McArthur, M. J., Mont-
gomery, C. A., Jr., Butel, J. S., and Bradley, A. Mice deficient for p53 are
developmentally normal but susceptible to spontaneous tumours. Nature
(Lond.), 356: 215–221, 1992.
52. Jacks, T., Remington, L., Williams, B. O., Schmitt, E. M., Halachmi, S.,
Bronson, R. T., and Weinberg, R. A. Tumor spectrum analysis in p53-
mutant mice. Curr. Biol., 4: 1–7, 1994.
53. Kaufman, M. H., Kaufman, D. B., Brune, R. M., Stark, M., Armstrong,
J. F., and Clarke, A. R. Analysis of fused maxillary incisor dentition in
p53-deficient exencephalic mice. J. Anat., 191: 57–64, 1997.
54. Baker, S. J., Markowitz, S., Fearon, E. R., Willson, J. K., and
Vogelstein, B. Suppression of human colorectal carcinoma cell growth
by wild-type p53. Science (Washington DC), 249: 912–915, 1990.
55. Vogelstein, B., and Kinzler, K. W. p53 function and dysfunction. Cell,
70: 523–526, 1992.
56. Finlay, C. A., Hinds, P. W., and Levine, A. J. The p53 proto-oncogene
can act as a suppressor of transformation. Cell, 57: 1083–1093, 1989.
57. Eliyahu, D., Michalovitz, D., Eliyahu, S., Pinhasi-Kimhi, O., and Oren,
M. Wild-type p53 can inhibit oncogene-mediated focus formation. Proc.
Natl. Acad. Sci. USA, 86: 8763–8767, 1989.
58. Michalovitz, D., Halevy, O., and Oren, M. Conditional inhibition of
transformation and of cell proliferation by a temperature-sensitive mutant
of p53. Cell, 62: 671–680, 1990.
59. Levine, A. J., Momand, J., and Finlay, C. A. The p53 tumour suppres-
sor gene. Nature (Lond.), 351: 453–456, 1991.
60. Holtzer, H., Schultheiss, T., Dilullo, C., Choi, J., Costa, M., Lu, M., and
Holtzer, S. Autonomous expression of the differentiation programs of cells
in the cardiac and skeletal myogenic lineages. Ann. N.Y. Acad. Sci., 599:
158–169, 1990.
61. Rumyantsev, P. P., and Borisov, A. DNA synthesis in myocytes from
different myocardial compartments of young rats in norm, after experi-
mental infarction and in vitro. Biomed. Biochim. Acta, 46: S610–S615,
1987.
62. Clubb, F. J., Jr., and Bishop, S. P. Formation of binucleated myocar-
dial cells in the neonatal rat. An index for growth hypertrophy. Lab. Invest.,
50: 571–577, 1984.
63. Macleod, K. F., Sherry, N., Hannon, G., Beach, D., Tokino, T., Kinzler,
K., Vogelstein, B., and Jacks, T. p53-dependent and independent expres-
sion of p21 during cell growth, differentiation, and DNA damage. Genes
Dev., 9: 935–944, 1995.
64. Zhang, W., Behringer, R. R., and Olson, E. N. Inactivation of the
myogenic bHLH gene MRF4 results in up-regulation of myogenin and rib
anomalies. Genes Dev., 9: 1388–1399, 1995.
65. Lassar, A., and Munsterberg, A. Wiring diagrams: regulatory circuits
and the control of skeletal myogenesis. Curr. Opin. Cell Biol., 6: 432–442,
1994.
66. Levine, A. J., Wu, M. C., Chang, A., Silver, A., Attiyeh, E. F., Lin, J., and
Epstein, C. B. The spectrum of mutations at the p53 locus. Evidence for
tissue-specific mutagenesis, selection of mutant alleles, and a “gain of
function” phenotype. Ann. N.Y. Acad. Sci., 768: 111–128, 1995.
67. Frazier, M. W., He, X., Wang, J., Gu, Z., Cleveland, J. L., and Zambetti,
G. P. Activation of c-myc gene expression by tumor-derived p53 mutants
requires a discrete C-terminal domain. Mol. Cell. Biol., 18: 3735–3743,
1998.
68. Gualberto, A., Hixon, M. L., Finco, T. S., Perkins, N. D., Nabel, G. J.,
and Baldwin, A. S., Jr. A proliferative p53-responsive element mediates
tumor necrosis factor
␣
induction of the human immunodeficiency virus
type 1 long terminal repeat. Mol. Cell. Biol., 15: 3450–3459, 1995.
69. Gualberto, A., LePage, D., Pons, G., Mader, S. L., Park, K., Atchison,
M. L., and Walsh, K. Functional antagonism between YY1 and the serum
response factor. Mol. Cell. Biol., 12: 4209–4214, 1992.
70. Newman, J. R., Morency, C. A., and Russian, K. O. A novel rapid
assay for chloramphenicol acetyltransferase gene expression. Biotech-
niques, 5: 444–448, 1987.
71. Vincent, C. K., Gualberto, A., Patel, C. V., and Walsh, K. Different
regulatory sequences control creatine kinase-M gene expression in di-
rectly injected skeletal and cardiac muscle. Mol. Cell. Biol., 13: 1264–
1272, 1993.
72. Hemsley, A., Arnheim, N., Toney, M. D., Cortopassi, G., and Galas,
D. J. A simple method for site-directed mutagenesis using the polymerase
chain reaction. Nucleic Acids Res., 17: 6545–6551, 1989.
73. Knowlton, K. U., Baracchini, E., Ross, R. S., Harris, A. N., Henderson,
S. A., Evans, S. M., Glembotski, C. C., and Chien, K. R. Co-regulation of
the atrial natriuretic factor and cardiac myosin light chain-2 genes during
␣
-adrenergic stimulation of neonatal rat ventricular cells. Identification of
cis sequences within an embryonic and a constitutive contractile protein
gene which mediate inducible expression. J. Biol. Chem., 266: 7759–
7768, 1991.
74. el-Deiry, W. S., Tokino, T., Velculescu, V. E., Levy, D. B., Parsons, R.,
Trent, J. M., Lin, D., Mercer, W. E., Kinzler, K. W., and Vogelstein, B.
WAF1, a potential mediator of p53 tumor suppression. Cell, 75: 817–825,
1993.
75. Kern, S. E., Kinzler, K. W., Bruskin, A., Jarosz, D., Friedman, P.,
Prives, C., and Vogelstein, B. Identification of p53 as a sequence-specific
DNA-binding protein. Science (Washington DC), 252: 1708–1711, 1991.
76. Morgenstern, J. P., and Land, H. Advanced mammalian gene transfer:
high titre retroviral vectors with multiple drug selection markers and a
complementary helper-free packaging cell line. Nucleic Acids Res., 18:
3587–3596, 1990.
77. Christy, R. J., Yang, V. W., Ntambi, J. M., Geiman, D. E., Landschulz,
W. H., Friedman, A. D., Nakabeppu, Y., Kelly, T. J., and Lane, M. D.
Differentiation-induced gene expression in 3T3–L1 preadipocytes:
CCAAT/enhancer binding protein interacts with and activates the promot-
ers of two adipocyte-specific genes. Genes Dev., 3: 1323–1335, 1989.
78. Nabel, G., and Baltimore, D. An inducible transcription factor acti-
vates expression of human immunodeficiency virus in T cells. Nature
(Lond.), 326: 711–713, 1987.
79. Lyons, G. E., Micales, B. K., Schwarz, J., Martin, J. F., and Olson,
E. N. Expression of mef2 genes in the mouse central nervous system
suggests a role in neuronal maturation. J. Neurosci., 15: 5727–5738,
1995.
306 Regulation of Muscle Gene Expression by p53