Molecular Cloning and Characterization of a Novel CXC Chemokine Macrophage Inflammatory Protein-2 Chemoattractant for Human Neutrophils and Dendritic Cells

Abstract

Chemokines play important roles in leukocyte trafficking as well as function regulation. In this study, we described the identification and characterization of a novel CXC chemokine from a human dendritic cell (DC) cDNA library, the full-length cDNA of which contains an open reading frame encoding 111 aa with a putative signal peptide of 34 aa. This CXC chemokine shares greatest homology with macrophage inflammatory protein (MIP)-2alphabeta, hence is designated as MIP-2gamma. Mouse MIP-2gamma was identified by electrocloning and is highly homologous to human MIP-2gamma. Northern blotting revealed that MIP-2gamma was constitutively and widely expressed in most normal tissues with the greatest expression in kidney, but undetectable in most tumor cell lines except THP-1 cells. In situ hybridization analysis demonstrated that MIP-2gamma was mainly expressed by the epithelium of tubules in the kidney and hepatocytes in the liver. Although no detectable expression was observed in freshly isolated or PMA-treated monocytes, RT-PCR analysis revealed MIP-2gamma expression by monocyte-derived DC. Recombinant MIP-2gamma from 293 cells is about 9.5 kDa in size and specifically detectable by its polyclonal Ab developed by the immunization with its 6His-tagged fusion protein. The eukaryotically expressed MIP-2gamma is a potent chemoattractant for neutrophils, and weaker for DC, but inactive to monocytes, NK cells, and T and B lymphocytes. Receptor binding assays showed that MIP-2gamma does not bind to CXCR2. This implies that DC might contribute to the innate immunity through the production of neutrophil-attracting chemokines and extends the knowledge about the regulation of DC migration.

Full text

of May 11, 2019.
This information is current as for Human Neutrophils and Dendritic Cells
ChemoattractantγInflammatory Protein-2
Novel CXC Chemokine Macrophage
Molecular Cloning and Characterization of a
Chen
Chen, Zhenglong Yuan, Shihua Ma, Yizhi Yu and Guoyou
Xuetao Cao, Weiping Zhang, Tao Wan, Long He, Taoyong
http://www.jimmunol.org/content/165/5/2588
doi: 10.4049/jimmunol.165.5.2588
2000; 165:2588-2595; ;J Immunol
References http://www.jimmunol.org/content/165/5/2588.full#ref-list-1
, 21 of which you can access for free at: cites 35 articlesThis article
average*
4 weeks from acceptance to publicationFast Publication! •
Every submission reviewed by practicing scientistsNo Triage! •
from submission to initial decisionRapid Reviews! 30 days* •
Submit online. ?The JIWhy
Subscription http://jimmunol.org/subscription is online at: The Journal of ImmunologyInformation about subscribing to
Permissions http://www.aai.org/About/Publications/JI/copyright.html
Submit copyright permission requests at:
Email Alerts http://jimmunol.org/alerts
Receive free email-alerts when new articles cite this article. Sign up at:
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Immunologists All rights reserved.
Copyright © 2000 by The American Association of
1451 Rockville Pike, Suite 650, Rockville, MD 20852
The American Association of Immunologists, Inc.,
is published twice each month byThe Journal of Immunology
by guest on May 11, 2019http://www.jimmunol.org/Downloaded from by guest on May 11, 2019http://www.jimmunol.org/Downloaded from

Molecular Cloning and Characterization of a Novel CXC
Chemokine Macrophage Inflammatory Protein-2
␥
Chemoattractant for Human Neutrophils and Dendritic Cells
1
Xuetao Cao,
2,3
Weiping Zhang,
3
Tao Wan, Long He, Taoyong Chen, Zhenglong Yuan,
Shihua Ma, Yizhi Yu, and Guoyou Chen
Chemokines play important roles in leukocyte trafficking as well as function regulation. In this study, we described the identifi-
cation and characterization of a novel CXC chemokine from a human dendritic cell (DC) cDNA library, the full-length cDNA of
which contains an open reading frame encoding 111 aa with a putative signal peptide of 34 aa. This CXC chemokine shares
greatest homology with macrophage inflammatory protein (MIP)-2
␣␤
, hence is designated as MIP-2
␥
. Mouse MIP-2
␥
was iden-
tified by electrocloning and is highly homologous to human MIP-2
␥
. Northern blotting revealed that MIP-2
␥
was constitutively
and widely expressed in most normal tissues with the greatest expression in kidney, but undetectable in most tumor cell lines
except THP-1 cells. In situ hybridization analysis demonstrated that MIP-2
␥
was mainly expressed by the epithelium of tubules
in the kidney and hepatocytes in the liver. Although no detectable expression was observed in freshly isolated or PMA-treated
monocytes, RT-PCR analysis revealed MIP-2
␥
expression by monocyte-derived DC. Recombinant MIP-2
␥
from 293 cells is about
9.5 kDa in size and specifically detectable by its polyclonal Ab developed by the immunization with its 6His-tagged fusion protein.
The eukaryotically expressed MIP-2
␥
is a potent chemoattractant for neutrophils, and weaker for DC, but inactive to monocytes,
NK cells, and T and B lymphocytes. Receptor binding assays showed that MIP-2
␥
does not bind to CXCR2. This implies that DC
might contribute to the innate immunity through the production of neutrophil-attracting chemokines and extends the knowledge
about the regulation of DC migration. The Journal of Immunology, 2000, 165: 2588–2595.
Chemokines are a family of proinflammatory cytokines of
low molecular mass (8–11 kDa) characterized by a struc-
turally conserved motif and their ability to mediate leu-
kocyte chemotaxis. Some chemokines are also involved in hema-
topoieses, angiogenesis, and oncogenesis (1–3). In addition,
several CC chemokines, including RANTES, macrophage inflam-
matory protein (MIP)
4
-1
␣
, and MIP-1
␤
, have been found to be
capable of inhibiting HIV infection (4). The chemokine family can
be divided into four major subfamilies based on the positions of
amino-terminal cysteine residues. In the CXC chemokines, the first
two cysteines are separated by a nonconserved amino acid, while
in the CC chemokine subfamily, these two cysteines are adjacent
to each other. The C chemokine subfamily with the only member
of lymphotactin lacks the second and fourth cysteines, which are
conserved in the CXC and CC chemokines. The CX
3
C membrane-
bound chemokines have 3 aa between the first two cysteines, a
long mucin-like stalk, and a short transmembrane domain (5, 6). In
general, the CXC chemokines primarily recruit neutrophils, while
the CC chemokines primarily attract monocytes and also lympho-
cytes, basophils, and/or eosinophils with variable selectivity. The
C chemokine of lymphotactin seems to act specifically on T lym-
phocytes and NK cells (7, 8).
Dendritic cells (DC) are the uniquely potent APCs involved in
immune responses (9). As adjuvants for Ag delivery, immature DC
pick up Ags in the periphery and carry them to the T cell area in
lymphoid organs to prime the immune responses, meanwhile un-
dergoing maturation (10). Chemokines play a vital role in DC traf-
ficking, maturation, and function. In this work, we identified and
characterized a novel human CXC chemokine from human DC
cDNA library, which showed the highest homology to MIP-2
␣␤
(11) and was chemoattractant for neutrophils and DC.
Materials and Methods
Human DC culture and RNA preparation
Peripheral mononuclear cells were isolated by Histopaque-1077 (Sigma,
St. Louis, MO) density gradient centrifugation of heparinized blood from
healthy adult donors and cultured in six-well plates (Nunclon, Naperville,
IL) at 37°C for2hinRPMI 1640 medium containing 10% (v/v) FBS (Life
Technologies, Grand Island, NY), 10 mM glutamine, and penicillin/step-
tomycin. Nonadherent cells were removed by gentle washing twice with
prewarmed HBSS solution, and the resultant CD14
⫹
monocytes accounted
for ⬎90% of the remaining adherent cells by FACS analysis. Monocytes
were cultured in RPMI 1640 complete medium containing 100 ng/ml re-
combinant human GM-CSF and 500 U/ml IL-4 (Sigma). Cytokines were
replenished on day 3, and cell differentiation was monitored by light mi-
croscopy. On day 7, nonadherent cells were harvested as the DC population
by gentle aspiration and followed by minimagnetic bead-mediated enrich-
ment. For positive selection, the DC population was labeled with mouse
anti-human CD1a mAb (PharMingen, San Diego, CA) for 30 min at 4°C
and followed by labeling with minimagnetic bead-conjugated rabbit anti-
mouse mAb for 30 min at 15°C. The labeled cell suspension was passed
through a separation column placed in a magnetic field (MiniMACS;
Milteny1 Biotec, Bergisch, Germany). The resultant positive fractions were
over 95% CD1a
⫹
CD83
⫹
and used as DC, which were characterized further
Department of Immunology and Shanghai Brilliance Biotechnology Institute, Second
Military Medical University, Shanghai, People’s Republic of China
Received for publication May 28, 1999. Accepted for publication June 20, 2000.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported in part by Natural Science Foundation of Shanghai, China.
2
Address correspondence and reprint request to Dr. Xuetao Cao, Department of Im-
munology, Second Military Medical University, 800 Xiangyin Road, Shanghai
200433, People’s Republic of China. E-mail address: caoxt@public3.sta.net.cn
3
X.C. and W.Z. contributed equally to this work.
4
Abbreviations used in this paper: MIP, macrophage inflammatory protein; DC, den-
dritic cells; MCP, monocyte chemoattractant protein; AP, alkaline phosphatase; EST,
expressed sequence tag.
Copyright © 2000 by The American Association of Immunologists 0022-1767/00/$02.00
by guest on May 11, 2019http://www.jimmunol.org/Downloaded from

by phenotype analysis and allogeneic MLR. Total cellular RNA was iso-
lated from the DC using Trizol reagent (Life Technologies), and poly(A)
⫹
RNA was purified with a mRNA isolation kit (Boehringer Mannheim,
Mannheim, Germany) for cDNA synthesis or Northern blotting.
Isolation of a cDNA-encoding MIP-2
␥
cDNA was synthesized and cloned into pSPORT vector at the sites of SalI
and NotI using the Superscript plasmid system (Life Technologies) fol-
lowed by transformation into Escherichia coli DH10B bacteria. Plasmid
DNA was prepared from randomly picked individual transformants and
was used as a template for large-scale DNA sequencing of the insert 5⬘end
to create an expressed sequence tag (EST). Sequencing reactions were
performed on thermocycler PCR9600 (Perkin-Elmer, Norwalk, CT) by
BigDye terminator sequencing Kit (Perkin-Elmer) with SP6 primer. Reac-
tion products were electrophoresed on ABI377 DNA sequencers (Perkin-
Elmer), and the raw sequence data were automatically recorded. Approx-
imately 400–600 bp of the 5⬘end of plasmid inserts were sequenced and
compared with EMBL using BLAST in the Genetics Computer Group
program package (Madison, WI). An in-house EST database was generated
for human monocyte-derived DC, from which a full-length cDNA clone
SBBI25 was identified as the candidate for a human CXC chemokine des-
ignated as MIP-2
␥
. By BLAST analysis against mouse database EST from
the National Center for Biotechnology Information, two mouse ESTs (Gen-
Bank accession nos. AU035952 and W59562) were found to be highly
homologous to human MIP-2
␥
, from which mouse MIP-2
␥
full-length
cDNA was obtained by contig and confirmed by RT-PCR cloning from
mouse kidney. Mouse MIP-2
␥
full-length cDNA inserted into pGEM-3Zf
vector (Promega, Madison, WI) was used as a template (pGEM-mMIP2
␥
)
to synthesize RNA probes for in situ hybridization analysis.
Northern blotting
The cDNA containing the full-length encoding regions of human MIP-2
␣
or MIP-2
␥
were amplified by PCR, confirmed by DNA sequencing, and
used as templates for synthesis of probes in Northern blotting. MIP-2
␣
cDNA from nucleotides 41–363 (GenBank accession no. X53799) was
amplified from human placenta cDNA (Clontech Laboratories, Palo Alto,
CA), and MIP-2
␥
cDNA for Fc fusion expression was used as a probe
template. Ready-to-use blots containing human poly(A)
⫹
RNA from var-
ious tissues (2
␮
g/lane) were purchased from Clontech Laboratories. The
filters were hybridized with the
32
P-labeled cDNA probes in ExpressHyb
hybridization solution (Clontech Laboratories) according to the manufac-
turer’s instructions. After stringently washing at 50°C for 20 min in 0.1⫻
SSC and 0.1% SDS, the filters were subjected to autoradiography. The
filters were reprobed with a human
␤
-actin cDNA probe (Clontech
Laboratories).
RT-PCR analysis for MIP-2
␥
expression
In addition to human monocytes isolated from peripheral leukocytes and
activated by PMA and monocyte-derived DC, the human cell lines used for
RT-PCR analysis of MIP-2
␥
expression included human monocyte THP-1,
histiocytic lymphoma U937, acute promyelocytic leukemia cells HL-60,
Burkitt’s lymphoma Raji, acute lymphoblastic leukemia Molt-4, acute T
cell leukemia Jurkat, cutaneous T lymphoma Hut78, erythroleukemia
K562, and lung carcinoma A549. The upstream primer of MIP-2
␥
is 5⬘-
CTCCCCATGTCCCTGCTC-3⬘, and its downstream primer is 5⬘-ACCT
GCGCTTCTCGTTCC-3⬘, with the predicted product of 328 bp. The up-
stream primer of human
␤
-actin is 5⬘-GCATCGTGATGGACTCCG-3⬘,
and its downstream primer is 5⬘-TCGGAAGGTGGACAGCGA-3⬘, with
the expected product of 600 bp.
Preparation of polyclonal Ab against human MIP-2
␥
For expression of 6His-tagged MIP-2
␥
in E. coli,aBamHI restriction site
was introduced by PCR just before the predicted first codon of mature
MIP-2
␥
and also a 6His tag and BamHI restriction site introduced imme-
diately before the termination codon. The 50-
␮
l PCR mixture included a
200-ng template of plasmid SBBI25, 1.5 mM MgCl
2
, 50 mM KCl, 10 mM
Tris-HCl (pH 8.4), 200
␮
m dNTP, and 0.5 U Taq (Promega). The reactions
were incubated in a thermocycler PCR9600 (Perkin-Elmer) for 10 min at
98°C, followed by 25 cycles of denaturation for 15 s at 94°C, annealing for
30 s at 56°C, and extension for 30 s at 72°C. The PCR products were
in-frame ligated into pQE60 expression vector (Qiagen, Chatsworth, CA),
and MIP-2
␥
cDNA were confirmed by sequencing. Expression of His-
tagged MIP-2
␥
was induced by adding 1 mM isopropylthiogalactoside to
mid-log cultures (A
600
⫽0.7–0.8). After4hofisopropylthiogalactoside
induction at 37 °C, the cells were harvested and lysed in buffer B (8 M urea,
0.1 M NaH
2
PO
4
, 10 mM Tris-HCl, pH 8.0), and subjected to nitrilotriacetic
acid-Ni
2⫹
agarose (Qiagen) for purification under denaturing condition ac-
cording to the manufacturer’s instructions. The 6His-tagged MIP-2
␥
eluted
by buffer E (8 M urea, 0.1 M NaH
2
PO
4
, 10 mM Tris-HCl, pH 4.5) was
subsequently purified by HPLC chromatography, which resulted in a purity
of ⬎90%. Normal rabbits were immunized three times with 6His-tagged
MIP-2
␥
including two boostings. Two weeks after the last boosting, the
antisera were collected and subjected to affinity chromatography using a
protein G Hitrap column (Pharmacia Biotech, Piscataway, NJ).
Expression of Fc fusion protein of MIP-2
␥
For expression of IgG fusion protein to determine the N terminal of mature
MIP-2
␥
, MIP-2
␥
cDNA containing the full-length encoding region except
stop codon was amplified by PCR using the sense primer of 5⬘-GGAAT
TCGCCATGTCCCTGCTCCCACG and the antisense primer of 5⬘GG
GATCCGGTTCTTCGTAGAACCTG. As underlined, an EcoRI restric-
tion site was added before the start codon of MIP-2
␥
, and a BamHI site was
introduced before the stop codon for in-frame ligation with human IgG1
CH2 and CH3 fragment. The MIP2
␥
-IgG fusion gene was inserted into
pcDNA3.1 expression vector at the sites of EcoRI and KpnI, under the
control of CMV promoter/enhancer. Seventy-two hours after transfection
of the MIP2
␥
-IgG expression vector into 293 cells with lipofectamine (Life
Technologies), the 48-h culture supernatants were harvested and subjected
to protein A affinity chromatography. MIP2
␥
-IgG fusion protein was blot-
ted onto a polyvinylidene difluoride membrane for amino acid sequencing
of the MIP-2
␥
N terminus.
Eukaryotic expression of recombinant MIP-2
␥
for activity assay
For activity investigation, MIP-2
␥
cDNA containing the full-length encod-
ing region was amplified by PCR using the primers of 5⬘-GGAATTCGC
CATGTCCCTGCTCC CACG and 5⬘-GGGTACCTCATTCTTCGTA
GAACCTG, with the resultant protein product designated as MIP-2
␥
.
EcoRI and KpnI restriction sites were added before the start codon and
immediately after the stop codon of MIP-2
␥
respectively as underlined.
MIP-2
␥
cDNA was inserted into pcDNA3.1 expression vector, under the
control of CMV promoter, followed by transfection into 293 cells for tran-
sient expression with lipofectamine (Life Technologies) according to man-
ufacturer’s instructions. Twenty-four hours after transfection, metabolic
labeling was performed to monitor the expression and secretion of MIP-2
␥
.
MIP-2
␥
-transfected or mock-transfected 293 cells in six-well plates were
cultured in methioine and cysteine-free DMEM medium (Life Technolo-
gies) for 30 min at 37°C and then replaced with the same fresh medium (0.5
ml/well) containing 200
␮
Ci/ml Redivue [
35
S]methionine and [
35
S]cys-
teine (Amersham, Arlington Heights, IL) and 5% dialyzed serum (Life
Technologies). After overnight labeling at 37°C, the culture supernatants
were harvested and condensed ⬃5-fold with Centricon 5K (Millipore, Bed-
ford, MA) before fractionation by 16% SDS-PAGE and subsequent auto-
radiography. MIP-2
␥
expression was further confirmed by Western blot-
ting with its rabbit polyclonal Abs.
Western blotting analysis of MIP-2
␥
Forty-eight-hour culture supernatants from MIP-2
␥
-transfected or mock-
transfected 293 cells were condensed with Centricon 5K (Millipore), frac-
tionated by 16% SDS-PAGE, and electrically blotted onto a nitrocellulose
membrane (Amersham). The membrane was blocked with 5% nonfat dry
milk in TBST buffer (25 mM Tris-HCl pH 8.0, 125 mM NaCl, and 0.1%
Tween 20) for 1 h at room temperature before incubation with rabbit poly-
clonal Abs against MIP-2
␥
or normal rabbit IgG (Santa Cruz Biotechnol-
ogy, Santa Cruz, CA) for1hatroom temperature. After washing three
times in TBST, the membrane was incubated for 45 min with HRP-labeled
goat anti-rabbit Ab and washed as before. HRP was detected using en-
hanced chemiluminescence according to the manufacturer’s instructions
(Santa Cruz Biotechnology).
Chemotaxis assay
Polymorphonuclear neutrophils and mononuclear cells were separated hep-
arinized peripheral blood by double gradient centrifugation (30 min, 700 ⫻g)
on Histopaque-1119 and Histopaque-1077 (Sigma) according to the man-
ufacturer’s instructions. Granulocytes are found at the 1077/1119 inter-
phase, whereas mononuclear cells are found at the plasma/1077 interphase.
The total mononuclear cell fraction was used as a source for monocytes and
lymphocytes. Monocytes and T lymphocytes were further isolated by mag-
netic cell sorting (MiniMACS) using positive selection with anti-CD14 or
anti-CD3 mAbs, respectively. After positive magnetic cell sorting, mono-
cytes were ⬎85% pure, whereas the purity of I lymphocytes reached
2589The Journal of Immunology
by guest on May 11, 2019http://www.jimmunol.org/Downloaded from

⬎90%. The resultant granulocytes, monocytes, T lymphocytes, and mono-
cyte-derived DC were washed and resuspended in pyrogen-free HBSS con-
taining human plasma protein (1 mg/ml albumin). The monocytic THP-1
cells, grown in RPMI 1640 with 10% FCS (Life Technologies), were used
for chemotaxis assay as an alternative to fresh monocytes. The microche-
motaxis assay was conducted in duplicate using the Boyden chamber mi-
gration assay. Then, 200-
␮
l culture supernatants of appropriate dilutions
were added into the lower chambers of the assay assembly (NeuroProbe,
Cabin John, MD), and the upper chambers were filled with 200
␮
lofthe
appropriate cell suspension (2⫻10
6
cells/ml). The wells were separated by
a5-
␮
m (neutrophils, lymphocytes, monocytes) or 8-
␮
m (DC, THP-1)
pore-size polycarbonate filters (Poretics, Livermore, CA) with a diameter
of 13 mm. The chambers were incubated for 1 h (neutrophils), 2 h (mono-
cytes, DC), or 4 h (lymphocytes) at 37°C. After incubation, the filters were
removed, fixed, and stained. Data were obtained by counting five nonover-
lapping high-power microscope fields from each well. Cells were consid-
ered to be chemoattracted if the chemotactic index (number of cells mi-
grating in experimental well per number of cells migrating in media only)
was ⬎2.
Expression of alkaline phosphatase (AP) fusion protein
To express their AP fusion proteins, human IL-8 and MIP-2
␥
cDNA frag-
ments encoding their full mature proteins were amplified by PCR. Restric-
tion sites at the ends of the amplification primers were cut with BamHI and
in-frame inserted into the expression vector pAPtag-4 (GenHunter Corpo-
ration, Nashville, TN) at the BglII site, so that both chemokines were fused
at the N terminal through a 4-aa linker (Gly-Ser-Gly-Gly) to secreted hu-
man placental AP. By transfection of the expression vectors into 293T cells
with lipofectamine (Life Technologies) according to manufacturer’s in-
structions, the AP-IL-8 and AP-MIP-2
␥
fusion proteins detected up to 500
mU/ml of AP activity (1 unit of enzyme hydrolyzes 1
␮
mol/min of
p-nitropheny1 phosphate at 37°C) in their 72-h culture supernatants of
transient expression. The unfused AP with the activity of 560 mU/ml was
also produced as mock control by transfection of plasmid pAPtag-4 into
293T cells. The AP-tagged fusion proteins were stable for several months
when stored in tissue culture supernatant at 4°C.
Receptor binding assay
A receptor binding assay was performed using AP-tagged ligand proteins
according to the manufacturer’s instructions (GenHunter Corporation).
Briefly, 10
6
cells were washed with HBHA buffer (HBSS with 0.5 mg/ml
BSA, 0.1% NaN
3
, 20 mM HEPES, pH 7.0), and incubated with 2 ml of
culture medium containing AP fusion proteins. After incubation at room
temperature for 90 min, the cells were washed five times with HBHA over
a 10-min period, lysed in 500
␮
l of 1% Triton X-100, 10 mM Tris-HCl (pH
8.0), and vortexed vigorously for 10 s. The nuclei were spun down in a
microfuge tube for 2 min, and the supernatants were incubated at 65°C for
10 min to inactivate endogenous AP before AP assay using GenHunter AP
assay reagent A as instructed. After incubation of samples in the presence
of AP assay reagent A for 20 min at 37°C, the AP activity was determined
by OD
405 nm
in a spectrophotometer. A 293 cell clone stably expressing
CXCR2 was established to evaluate the CXCR2 binding capacity to MIP-
2
␥
. The cDNA-encoding full-length CXCR2 protein was amplified from
THP-1 cells by RT-PCR, using the primers of 5⬘-GGAATTCCGCCAT
GTCAAATATTACAGATCCAC-3⬘and 5⬘-GGGGTACCTCGAGTCA
GAGG TTGGAAGAGACATT-3⬘. After double digestion with EcoRI and
KpnI, the PCR products were cloned into pcDNA3.1 vector (Invitrogen,
San Diego, CA) and confirmed by DNA sequencing. The resultant CXCR2
expression vector was transfected into 293 cells by lipofectamine (Life
Technologies). After 2 wk screening with 800
␮
g/ml of G418, a positive
clone designated 293CXCR2 was obtained, the CXCR2 expression of
which was confirmed by FACS analysis using PE-conjugated anti-human
CXCR2 mAb (PharMingen). The mock-transfected 293 cell clone was also
established by transfection of pcDNA3.1 plasmid into 293 cells.
In situ hybridization
Sense and antisense digoxigenin-labeled cRNA probes of mouse MIP-2
␥
were synthesized with a digoxigenin-RNA labeling kit (Roche Diagnostics,
Hong Kong) using linearilzed pGEM-mMIP2
␥
as the template. In situ
hybridization was performed according to the method modified from Hoe-
fler et al. (12). The livers and kidneys from 6-wk-old male BALB/c mice
were rapidly frozen in ⫺70°C isopentane for 2 min, cut into 10-
␮
m sec-
tions in a cryostat, thaw-mounted on poly-L-lycine-coated slides, and air-
dried. The sections were fixed in 4% formaldehyde and 0.03% picric acid
in 0.1 M phosphate buffer (pH 7.4) for 10 min. After three rinses of PBS
and one rinse of 0.1 M glycine/PBS and 0.4% Triton X-100/PBS, the
sections were digested with 1
␮
g/ml of protease K in PBS at 37°C for 30
min, fixed in 4% paraformaldehyde for 5 min, and followed by two rinses
of PBS to remove the fixative. The sections were then incubated in 0.25%
acetic anhydride with 0.1 M triethanolamine (pH 8.0) for 10 min at room
temperature, followed by two rinses of 0.6 M sodium chloride, 0.06 M SSC
for 10 min. Digoxigenin-labeled cRNA (0.1–0.5
␮
g/ml) of either antisense
or sense probes was added to the hybridization solution containing 50%
formamide, 10% dextran sulfate, 0.05 M Tris-HCl (pH 8.0), 1 mM EDTA,
0.3 M NaCl, 1⫻Denhardt’s solution, and 250
␮
g/ml E. coli transfer RNA
(RNase-free). After overnight hybridization at 64°C in a hybridization
oven, the sections were rinsed with 4⫻SSC for 20 min at 37°C, treated
with 20
␮
g/ml RNase in 2⫻SSC, and followed by rinses with 1⫻SSC and
0.2⫻SSC at 37°C for 20 min, respectively. After incubation in PBS block-
ing buffer containing 5% BSA and 0.4% Triton X-100 at room temperature
for 30 min, the sections were incubated with AP-conjugated anti-
digoxigenin Ab (Roche Diagnostics) in the blocking buffer for3hatroom
temperature. The sections were rinsed four times with PBS before color
development with 400
␮
g/ml nitroblue tetrazolium, 200
␮
g/ml 5-bromo-
4-chloro-3-indolyl phosphate and 100
␮
g/ml levamisole in 0.1 M Tris-HCl
buffer (pH 9.5) at room temperature. The sections were rinsed for 10 min
in 10 mM Tris-HCl (pH 8.0) and 1 mM EDTA to stop color development,
then mounted with 50% glycerol in the Tris-HCl/EDTA buffer and stored
at 4°C in the dark.
Results
Isolation of MIP-2
␥
cDNA from human DC
By randomly large-scale sequencing of human DC cDNA library,
we identified a full-length cDNA clone encoding a novel CXC
chemokine designated as MIP-2
␥
(Fig. 1). It contains an open
reading frame of 111 aa with a conserved four-cysteine motif. The
first two cysteine residues of the amino terminus are separated by
a nonconserved lysine, which is characteristic of CXC chemokines
(Fig. 2). The protein product shares 30% identity and 50% simi-
larity with MIP-2
␣␤
(11), so it was designated as MIP-2
␥
. In con-
trast to MIP-2
␣␤
, MIP-2
␥
does not contain an ELR motif, which
is also found in IL-8 and other CXC chemokines. MIP-2
␥
contains
a putative signal peptide of 34 aa based on peptide hydrophilicity
analysis, so the mature protein consists of 77 aa with a predicted
relative molecular mass of 9.5 kDa. To confirm the predicted NH
2
terminus of the mature peptide, MIP-2
␥
cDNA was in-frame fused
with human IgG1 CH2 and CH3 and inserted into pcDNA3.1 vec-
tor to express MIP2
␥
-IgG fusion protein in 293 cells. Amino-ter-
minal sequencing of protein A-purified MIP2
␥
-IgG yields the se-
quence SKCKCSRKGP, confirming the predicted NH
2
terminus of
mature MIP-2
␥
. Mouse MIP-2
␥
shared 95% and 98% identity with
human MIP-2
␥
at nucleotide and protein levels, respectively (Fig.
2, GenBank accession no. AF252873), suggesting that MIP-2
␥
was highly conserved.
Tissue expression pattern of human MIP-2
␥
Northern blotting revealed constitutive expression of MIP-2
␥
in
most normal tissues. The greatest expression of MIP-2
␥
was ob-
served in the kidney, with weaker expression in small intestine,
brain, placenta, skeletal muscle, liver, spleen, thymus, and pan-
creas (Fig. 3). Very faint expression of MIP-2
␥
was detected in
testis, ovary, heart, and lung, and no expression was seen in PBL.
Two different transcripts of human MIP-2
␥
were detected in nor-
mal tissues. The dominant one is ⬃2 kb, and another is about 0.5
kb. Constitutive expression of MIP-2
␣
was also detectable in most
normal tissues, with the greatest expression in liver and abundant
expression in lung, brain, heart, and spleen, but no expression in
kidney and PBL was observed (Fig. 3). MIP-2
␣
also has two tran-
scripts with the sizes of 2.5 kb and 1.5kb, respectively, and the
larger one seemed to be dominant. These suggested that the ex-
pression pattern of MIP-2
␥
in normal tissues was similar to that of
its homologue MIP-2
␣
to some extent.
2590 IDENTIFICATION AND CHARACTERIZATION OF HUMAN MIP-2
␥
by guest on May 11, 2019http://www.jimmunol.org/Downloaded from

In contrast to normal tissues, MIP-2
␥
expression was undetect-
able in cancer cell lines by Northern blotting, including HL-60,
HeLa, K562, Molt-4, Raji, colorectal adenocarcinoma SW480
cells, lung carcinoma A549 cells, and melanoma G361 cells (data
not shown). RT-PCR analysis also demonstrated no expression of
MIP-2
␥
in cancer cell lines detected, including U937, HL-60,
K562, Molt-4, Jurkat, Hut78, Raji, and A549, with the exception
of THP-1 cell line (Fig. 4A). Meanwhile, MIP-2
␣
was detectable
by Northern blotting in A549, melanoma G361 cells, and HeLa
cells (Fig. 3). Although MIP-2
␥
mRNA expression was not ob-
served in freshly isolated or PMA-treated peripheral monocytes,
monocyte-derived DC cultured with GM-CSF/IL-4 did express de-
tectable MIP-2
␥
by RT-PCR (Fig. 4B). In situ hybridization dem-
onstrated that MIP-2
␥
was mainly expressed by parenchyma cells
FIGURE 1. Sequence and deduced translation of human MIP-2
␥
cDNA. The predicted signal sequence is underlined. The mature NH
2
terminus was
confirmed by amino acid sequence of recombinant MIP-2
␥
produced by 293 cells. The four conserved cysterine residues are indicated by asterisks
underneath them. The cDNA sequence of human MIP-2
␥
has been deposited in GenBank under the accession no. AF106911.
FIGURE 2. Alignment of amino acid sequences between MIP-2
␥
and other CXC chemokines. The cDNA sequence of mouse MIP-2
␥
has been deposited
in GenBank under the accession no. AF252873.
2591The Journal of Immunology
by guest on May 11, 2019http://www.jimmunol.org/Downloaded from

in kidney and liver, including epithelium of uriniferous tubule and
liver cells (Fig. 5). This implied that MIP-2
␥
might possess growth
regulatory functions under physiological conditions.
Recombinant expression of human MIP-2
␥
protein
To detect MIP-2
␥
protein expression, we developed rabbit poly-
clonal Abs against human MIP-2
␥
by immunizing with 6His-
tagged MIP-2
␥
, which was expressed in bacteria and purified by
nickel-nitrilotriacetic acid-mediated affinity chromatography. For
bioactivity analysis, human MIP-2
␥
cDNA with a full-length en-
coding region was inserted into pcDNA3.1 expression vector and
expressed transiently in human embryonic kidney 293 cell line. By
35
S metabolic labeling and autoradiography, the protein product of
⬃9.5 kDa could be detected in the supernatants from MIP-2
␥
-
transfected 293 cells (Fig. 6A), which was confirmed to be human
MIP-2
␥
by Western blotting with rabbit polyclonal Abs against
human MIP-2
␥
(Fig. 6B), whereas untransfected or mock-trans-
fected 293 cells didn’t express any detectable human MIP-2
␥
by
Western blotting.
Chemotactic activity of human MIP-2
␥
For microchemotactic assay, the 24-h serum-free culture superna-
tants from MIP-2
␥
-transfected or mock-transfected 293 cells were
harvested 48 h after transfection. The culture supernatants from
MIP-2
␥
-transfected 293 cells could attract neutrophils markedly
even at the 100-fold dilution, but not T lymphocytes or monocytes
(Fig. 7), which is consistent with most of CXC chemokines. To a
lesser extent, it was also chemoattractive to human monocyte-de-
rived DC, but inactive on B lymphocytes or NK cells, whereas the
mock control supernatants had no obvious chemoattractant activity
on neutrophils, T lymphocytes, monocytes, or DC.
CXCR2 binding assay
Putatively, ELR
⫹
CXC chemokine mediates the chemotaxis of
neutrophils via CXCR2. Although MIP-2
␥
was absent of the ELR
motif, it did attract neutrophils. To evaluate whether CXCR2 me-
diates the chemotactic capacity of MIP-2
␥
, we carry out CXCR2
binding assay. CXCR2-transfected 293 cells (293CXCR2) were
established, CXCR2 expression of which was confirmed by FACS
analysis (data not shown). AP-tagged MIP-2
␥
fusion protein could
bind efficiently to neutrophils, but bind poorly to 293CXCR2 cells
(Fig. 8). As a positive control, IL-8 AP fusion protein could bind
efficiently to 293CXCR2 cells. These showed that MIP-2
␥
didn’t
bind to receptor CXCR2 and suggested that other chemokine re-
ceptors might mediate the biological functions of MIP-2
␥
.
Discussion
A new chemokine cDNA was isolated from a human DC cDNA
library, which encodes 111 aa with a putative signal peptide of 34
aa. It contains a CXC motif characteristic of CXC chemokine,
shares high homology with the previously identified MIP-2
␣␤
(11), and can attract neutrophils markedly, so it’s designated as
MIP-2
␥
. In contrast to MIP-2
␣␤
, MIP-2
␥
doesn’t contain the ELR
motif, which is found in the CXC chemokines attracting neutro-
phils via CXCR1 or CXCR2. We have no evidence that MIP-2
␥
could bind to CXCR1 (data not shown) or CXCR2, which implies
FIGURE 3. Northern blotting analysis for human
MIP-2
␥
and MIP-2
␣
in human tissues. Multiple tis-
sue Northern blots were probed with
32
P-labeled hu-
man MIP-2
␥
or MIP-2
␣
cDNA and washed with
high stringency (0.2⫻SSC, 50°C). The RNA mark-
ers are indicated in kilobases.
FIGURE 4. RT-PCR analysis for human MIP-2
␥
expression. Human
tumor cell lines (A) or freshly isolated human peripheral monocytes
(Mono) or PMA-treated peripheral monocytes (Mono/PMA) or human
monocyte-derived dendritic cells (Mono-DC) (B) were subjected to RT-
PCR analysis for human MIP-2
␥
. Human
␤
-actin was also amplified by
RT-PCR as a positive control.
2592 IDENTIFICATION AND CHARACTERIZATION OF HUMAN MIP-2
␥
by guest on May 11, 2019http://www.jimmunol.org/Downloaded from

that a novel CXC chemokine receptor other than CXCR1 or
CXCR2 may mediate neutrophil trafficking by MIP-2
␥
. Interest-
ingly, MIP-2
␥
is also a chemoattractant of monocyte-derived DC.
The identification of a MIP-2
␥
receptor may facilitate understand-
ing the chemotactic features of MIP-2
␥
.
Although it was isolated from human monocyte-derived DC, no
detectable expression of human MIP-2
␥
was observed in PBL by
Northern blotting, or in freshly isolated or PMA-treated monocytes
by RT-PCR, suggesting MIP-2
␥
expression is tightly regulated
under physiological conditions. DC are regarded as the most pow-
erful APCs in vivo, and chemokines expressed by DC may par-
tially account for the potential roles of DC in immune responses.
Up to now, several CC chemokines including MIP-1
␣
, MIP-1
␤
,
MIP-1
␥
, RANTES, monocyte chemoattractant protein (MCP)-1,
and DC-CK1 have been found to be expressed in DC (13–16), and
MCP-3 was also found in our EST database from the DC cDNA
library (data not shown). Recently, it was reported that monocyte-
derived chemokine (MDC) expression was up-regulated on DC
maturation (17). CC chemokines expressed by DC may facilitate
DC actively attracting T cells and subsequently priming T cell-
mediated immunity. This notion is supported by our previous stud-
ies that augmenting DC’s preferential chemotaxis on T cells could
enhance the induction of T cell immune responses (18, 19). Be-
sides CC chemokines, DC has been shown to express CXC che-
mokine, e.g., IL-8, which is the potent chemoattractant for neu-
trophils (13). To our knowledge, MIP-2
␥
is the second CXC
chemokine reported to be expressed by DC, which supports the
hypothesis that DC could contribute to innate immunity through
the production of inflammatory cytokines.
The in vivo trafficking of DC is highly regulated by chemokines
under resting or stimulated conditions. DC has been found to ex-
press appreciable levels of the CCR1, CCR2, CCR3, CCR5, and
CCR7 receptors for the CC chemokines and CXCR1, CXCR2, and
CXCR4 for CXC chemokines (20, 21), which are vital for DC
trafficking, in vivo localization, and Ag presentation (22–24). Che-
mokine receptor expression was observed to be strictly regulated
on DC differentiation and maturation. The CC chemokine recep-
tors CCR3 and CCR5 were found to be down-regulated, while
CCR7 and CXC chemokine receptor CXCR4 were enhanced on
DC maturation (25–27). So, it was postulated that different che-
mokines and chemokine receptors may be involved in DC migra-
tion in vivo, depending on the functional and maturation status of
DC (27). It seems likely that MIP-1
␣
, MCP-3, and RANTES can
direct the migration of immature DC located in the periphery,
whereas MIP-3
␤
can mediate the trafficking of Ag-carrying DC
from peripheral inflammatory sites, where DC are stimulated to
up-regulate the expression of CCR7, to lymphoid organs (20, 21,
FIGURE 5. In situ hybridization analysis for mouse
MIP-2
␥
in normal kidney and liver. The sections from mouse
kidney and liver were subjected to hybridization overnight at
64°C with digoxigenin-labeled sense or antisense cRNA
probes, incubated with AP-conjugated anti-digoxigenin, and
then developed by AP staining with nitroblue tetrazolium/5-
bromo-4-chloro-3-indolyl phosphate. A, Kidney section
probed with mouse MIP-2
␥
sense cRNA probe (magnifica-
tion, ⫻100). B, Kidney section probed with mouse MIP-2
␥
antisense cRNA, and the positive uriniferous tubules were
marked with 3(magnification, ⫻200). C, Liver section
probed with mouse MIP-2
␥
sense cRNA (magnification,
⫻100). D, Liver section probed with mouse MIP-2
␥
anti-
sense cRNA. The central vein was marked with ➯, the sinus
hepaticus was marked with ➡, and positive liver cells were
marked with 3(magnification, ⫻200).
FIGURE 6. Recombinant expression and Western blotting analysis of
human MIP-2
␥
.A, Metabolic labeling of recombinant human MIP-2
␥
.
MIP-2
␥
gene-transfected or mock-control 293 cells were labeled with
[
35
S]methionine and [
35
S]cysteine overnight, and the culture supernatants
were condensed ⬃5-fold with Centricon 5K before fractionated by 16% Tris-
glycine SDS-polyacrylamide electrophoresis. B, Western blotting analysis for
the culture supernatants using rabbit anti-MIP-2
␥
polyclonal Abs. The su-
pernatants from human MIP-2
␥
gene-transfected (lanes 2 and 3) or mock-
control 293 cells (lane 1) were fractionated on 16% Tris-glycine SDS-
PAGE gel, electrically blotted onto a nitrocellulose membrane, and
followed by detection with anti-MIP-2
␥
polyclonal Abs (lanes 1 and 2)or
control rabbit IgG. The protein markers are indicated in kilodaltons.
2593The Journal of Immunology
by guest on May 11, 2019http://www.jimmunol.org/Downloaded from

27, 28). The CXC chemokines seem to be less important in reg-
ulating DC trafficking. Although DC express CXC chemokine re-
ceptors, most CXC chemokines, including IL-8, IFN-
␥
-inducible
protein-10, and growth-related oncogene-
␤
, are inactive on DC
(29), and stromal cell-derived factor-1 was the only CXC chemo-
kine found to be chemoattractive on DC (26). Our finding that
another CXC chemokine MIP-2
␥
other than stromal cell-derived
factor-1 can mediate DC migration will extend the knowledge
about the regulation of DC trafficking. The receptor mediating
MIP-2
␥
binding and function needs to be identified and charac-
terized for better understanding the functional role of MIP-2
␥
in
DC migration and maturation. Recently, the concept of DC sub-
population has been postulated on the basis of the cytokine profile
(30); it will be interesting to characterize the chemokine profile
and the chemokine responsiveness of different DC subpopulations.
Our data showed that MIP-2
␥
mRNA was widely and consti-
tutively expressed in normal tissues, including kidney, small in-
testine, brain, placenta, skeletal muscle, liver, spleen, thymus, and
pancreas, with the highest expression observed in kidney. In situ
hybridization analysis demonstrated that the parenchymal cells in
kidney and liver were the predominant cells to express MIP-2
␥
.
MIP-2
␥
protein expression in normal kidney was also detectable
(data not shown). The phenomenon is interesting in that no neu-
trophil infiltration occurs in kidney and liver under normal condi-
tion despite abundant MIP-2
␥
expression in the loci. Moreover, the
constitutive expression in normal tissues was also observed for
chemokine other than MIP-2
␥
, e.g., MCP-2 and MIP-1
␥
(31, 32).
Therefore, we predicted that there might exist certain mechanisms
under normal physiological condition to suppress or reverse the
chemokine-mediated accumulation of inflammatory cells and the
potential for self-perpetuation of inflammation. Our hypothesis is
that migratory responses of target cells to a certain chemokine may
be dependent of the physiological status of themselves as well as
the chemokine concentration gradient in the loci. This is supported
by the recent report that high concentrations of stromal cell-de-
rived factor-1 could drive T cells to move away from it and inhibit
T cell accumulation in inflammatory loci (33). Whether MIP-2
␥
could bidirectionally regulate the migration of neutrophils is under
investigation in our laboratory. In contrast the abundant expression
FIGURE 7. Chemotactic activity of human MIP-2
␥
. The culture super-
natants from MIP-2
␥
gene-transfected (䡺) or mock-control 293 cells (E)
direct the migration of freshly isolated neutrophils (A), T lymphocytes (B),
monocytes (C) from human peripheral blood, or monocyte-derived DC
(D). Migration is presented with chemotactic index. The data are repre-
sentative of three individual experiments.
FIGURE 8. CXCR2 binding assay of MIP-2
␥
. Neutrophils or CXCR2-
transfected 293 cells were incubated with culture medium containing AP-
tagged IL-8 or MIP-2
␥
fusion proteins for 90 min at 37°C, washed with
HBHA, and lysed with 1% Triton X-100/10 mM Tris-HCl. After the nuclei
were spun down, the supernatants were incubated for 10 min at 65°C to
inactivate endogenous AP and were subjected to AP assay by incubation
with AP assay reagent A for 20 min at 37°C. The AP activities were
determined by OD
405 nm
read in a spectrophotometer and represented re-
ceptor binding capacity. ⴱ,p⬍0.01 in comparison with AP control. The
data are representative of three individual experiments.
2594 IDENTIFICATION AND CHARACTERIZATION OF HUMAN MIP-2
␥
by guest on May 11, 2019http://www.jimmunol.org/Downloaded from

of chemokines in normal tissues also indicates that they may pos-
sess other important biological activities in vivo than chemotaxis.
It is evident that some chemokines could regulate cell proliferation
and differentiation, participate in hemopoiesis, immunoregulation,
angiogenesis, and oncogenesis (1, 2, 34). MIP-2
␣␤
could augment
GM-CSF-mediated hemopoiesis and stimulate the proliferation of
alveolar epithelial cells (1, 35) and enhance liver regeneration after
acute liver injury (36). The contribution of MIP-2
␣
as a potential
hepatic regenerative factor is consistent with our finding of abun-
dant MIP-2
␣
expression in the liver. So, the growth regulatory
functions of MIP-2
␥
may be predictable. Presently, we did not find
any obviously stimulatory or inhibitory activity of MIP-2
␥
in GM-
CSF/IL-3/erythyropoietin-stimulating colony formation assay us-
ing CD34
⫹
hemopoietic progenitors (data not shown). The expres-
sion of MIP-2
␥
by parenchyma cells in kidney and liver may imply
its potential involvement in the tissue regeneration, and its abun-
dant expression by normal tissues but poor expression by cancer
cells suggest its potential roles in oncogenesis. These need to be
characterized by further investigation.
In this report, we described a new CXC chemokine MIP-2
␥
isolated from monocyte-derived DC that exhibited potent chemo-
taxis on neutrophils, indicating its potential roles in innate immu-
nity. Most interestingly, MIP-2
␥
can drive the migration of DC.
This will extend the knowledge about the controlling of DC mi-
gration and the contribution of DC to innate immunity.
Acknowledgments
We acknowledge Dr. Zhenghua Xiang, Mei Jin, Xuebing Wu, and Dong-
ming Zhang for their excellent technical assistance.
References
1. Broxmeyer, H. E., B. Sherry, L. Lu, S. Cooper, C. Carow, S. D. Wolpe, and
A. Cerami. 1989. Myelopoietic enhancing effects of murine macrophage inflam-
matory proteins 1 and 2 on colony formation in vitro by murine and human bone
marrow granulocyte/macrophage progenitor cells. J. Exp. Med. 170:1583.
2. Cao, Y., C. Chen, J. A. Weatherbee, M. Tsang, and J. Folkman. 1995. Gro-
␤
,a
C-X-C- chemokine, is an angiogenesis inhibitor that suppresses the growth of
Lewis lung carcinoma in mice. J. Exp. Med. 182:2069.
3. Strieter, R. M., P. J. Polverini, S. L. Kunkel, D. A. Arenberg, M. D. Burdick,
J. Kasper, J. Dzuiba, J. Van Damme, A. Walz, and D. Marriott. 1995. The func-
tional role of the ELR motif in CXC chemokine-mediated angiogenesis. J. Biol.
Chem. 270:27348.
4. Cocchi, F., A. L. DeVico, A. Garzino-Demo, S. K. Arya, R. C. Gallo, and
P. Lusso. 1995. Identification of RANTES, MIP-1
␣
, and MIP-1
␤
as the major
HIV-suppressive factors produced by CD8
⫹
T cells. Science 270:1811.
5. Bazan, J. F., K. B. Bacon, G. Hardiman, W. Wang, K. Soo, D. Rossi,
D. R. Greaves, A. Zlotnik, and T. J. Schall. 1997. A new class of membrane-
bound chemokine with a CX3C motif. Nature 385:640.
6. Pan, Y., C. Lloyd, H. Zhou, S. Dolich, J. Deeds, J. A. Gonzalo, J. Vath,
M. Gosselin, J. Ma, B. Dussault, et al. 1997. Neurotactin, a membrane-anchored
chemokine upregulated in brain inflammation. Nature 387:611.
7. Kelner, G. S., J. Kennedy, K. B. Bacon, S. Kleyensteuber, D. A. Largaespada,
N. A. Jenkins, N. G. Copeland, J. F. Bazan, K. W. Moore, T. J. Schall, and
A. Zlotnik. 1994. Lymphotactin: a cytokine that represents a new class of che-
mokine. Science 266:1395.
8. Kennedy, J., G. S. Kelner, S. Kleyensteuber, T. J. Schall, M. C. Weiss, H. Yssel,
P. V. Schneider, B. G. Cocks, K. B. Bacon, and A. Zlotnik. 1995. Molecular
cloning and functional characterization of human lymphotactin. J. Immunol. 155:
203.
9. Banchereau, J., and R. M. Steinman. 1998. Dendritic cells and the control of
immunity. Nature 392:245.
10. Steinman, R. M., M. Pack, and K. Inaba. 1997. Dendritic cells in the T-cell areas
of lymphoid organs. Immunol. Rev. 156:25.
11. Tekamp-Olson, P., C. Gallegos, D. Bauer, J. McClain, B. Sherry, M. Fabre,
S. van Deventer, and A. Cerami. 1990. Cloning and characterization of cDNAs
for murine macrophage inflammatory protein 2 and its human homologues.
J. Exp. Med. 172:911.
12. Hoefler, H., H. Childers, M. R. Montminy, R. M. Lechan, R. H. Goodman, and
H. J. Wolfe. 1986. In situ hybridization methods for the detection of somatostatin
mRNA in tissue sections using antisense RNA probes. Histochem. J. 18:597.
13. Caux, C., C. Massacrier, B. Vanbervliet, B. Dubois, C. Van Kooten, I. Durand,
and J. Banchereau. 1994. Activation of human dendritic cells through CD40
cross-linking. J. Exp. Med. 180:1263.
14. Zhou, L. J., and T. F. Tedder. 1995. A distinct pattern of cytokine gene expression
by human CD83
⫹
blood dendritic cells. Blood 86:3295.
15. Mohamadzadeh, M., A. N. Poltorak, P. R. Bergstressor, B. Beutler, and
A. Takashima. 1996. Dendritic cells produce macrophage inflammatory protein-1
gamma, a new member of the CC chemokine family. J. Immunol. 156:3102.
16. Adema, G. J., F. Hartgers, R. Verstraten, E. de Vries, G. Marland, S. Menon,
J. Foster, Y. Xu, P. Nooyen, T. McClanahan, K. B. Bacon, and C. G. Figdor.
1997. A dendritic-cell-derived C-C chemokine that preferentially attracts naive T
cells. Nature 387:713.
17. Tang, H. L., and J. G. Cyster. 1999. Chemokine up-regulation and activated T cell
attraction by maturing dendritic cells. Science 284:819.
18. Cao, X., W. Zhang, L. He, Z. Xie, S. Ma, Q. Tao, Y. Yu, H. Hamada, and
J. Wang. 1998. Lymphotactin gene-modified bone marrow dendritic cells act as
more potent adjuvants for peptide delivery to induce specific antitumor immunity.
J. Immunol. 161:6238.
19. Zhang, W., L. He, Z. Yuan, Z. Xie, J. Wang, H. Hamada, and X. Cao. 1999.
Enhanced therpeutic efficacy of tumor RNA-pulsed dendritic cells after genetic
modification with lymphotactin. Hum. Gene Ther. 10:1151.
20. Sozzani, S., W. Luini, A. Borsatti, N. Polentarutti, D. Zhou, L. Piemonti, G.
D’Amico, C. A. Power, T. N. Wells, M. Gobbi, P. Allavena, and A. Mantovani.
1997. Receptor expression and responsiveness of human dendritic cells to a de-
fined set of CC and CXC chemokines. J. Immunol. 159:1993.
21. Dieu, M. C., B. Vanbervliet, A. Vicari, J. M. Bridon, E. Oldham, S. Ait-Yahia,
F. Briere, A. Zlotnik, S. Lebecque, and C. Caux. 1998. Selective recruitment of
immature and mature dendritic cells by distinct chemokines expressed in different
anatomic sites. J. Exp. Med. 188:373.
22. Gunn, M. D., S. Kyuwa, C. Tam, T. Kakiuchi, A. Matsuzawa, L. T. Williams, and
H. Nakano. 1999. Mice lacking expression of secondary lymphoid organ che-
mokine have defects in lymphocyte homing and dendritic cell localization.
J. Exp. Med. 189:451.
23. Saeki, H., A. M. Moore, M. J. Brown, and S. T. Hwang. 1999. Cutting edge:
secondary lymphoid-tissue chemokine (SLC) and CC chemokine receptor 7
(CCR7) participate in the emigration pathway of mature dendritic cells from the
skin to regional lymph nodes. J. Immunol. 162:2472.
24. Sato, K., H. Kawasaki, H. Nagayama, R. Serizawa, J. Ikeda, C. Morimoto,
K. Yasunaga, N. Yamaji, K. Tadokoro, T. Juji, and T. A. Takahashi. 1999. CC
chemokine receptors, CCR-1 and CCR-3, are potentially involved in antigen-
presenting cell function of human peripheral blood monocyte-derived dendritic
cells. Blood 93:34.
25. Delgado, E., V. Finkel, M. Baggiolini, C. R. Mackay, R. M. Steinman, and
A. Granelli-Piperno. 1998. Mature dendritic cells respond to SDF-1, but not to
several
␤
-chemokines. Immunobiology 198:490.
26. Lin, C. L., R. M. Suri, R. A. Rahdon, J. M. Austyn, and J. A. Roake. 1998.
Dendritic cell chemotaxis and transendothelial migration are induced by distinct
chemokines and are regulated on maturation. Eur. J. Immunol. 28:4114.
27. Yanagihara, S., E. Komura, J. Nagafune, H. Watarai, and Y. Yamaguchi. 1998.
EBI1/CCR7 is a new member of dendritic cell chemokine receptor that is up-
regulated upon maturation. J. Immunol. 161:3096.
28. Sozzani, S., P. Allavena, G. D’Amico, W. Luini, G. Bianchi, M. Kataura, T. Imai,
O. Yoshie, R. Bonecchi, and A. Mantovani. 1998. Differential regulation of che-
mokine receptors during dendritic cell maturation: a model for their trafficking
properties. J. Immunol. 161:1083.
29. Sozzani, S., F. Sallusto, W. Luini, D. Zhou, L. Piemonti, P. Allavena,
J. Van Damme, S. Valitutti, A. Lanzavecchia, and A. Mantovani. 1995. Migration
of dendritic cells in response to formyl peptides, C5a, and a distinct set of che-
mokines. J. Immunol. 155:3292.
30. Rissoan, M. C., V. Soumelis, N. Kadowaki, G. Grouard, F. Briere,
R. de Waal Malefyt, and Y. J. Liu. 1999. Reciprocal control of T helper cell and
dendritic cell differentiation. Science 283:1183.
31. Van Coillie, E., P. Fiten, H. Nomiyama, Y. Sakaki, R. Miura, O. Yoshie,
J. Van Damme, and G. Opdenakker. 1997. The human MCP-2 gene (SCYA8):
cloning, sequence analysis, tissue expression, and assignment to the CC chemo-
kine gene contig on chromosome 17q11.2. Genomics 40:323.
32. Poltorak, A. N., F. Bazzoni, Smirnova, II, E. Alejos, P. Thompson, G. Luheshi,
N. Rothwell, and B. Beutler. 1995. MIP-1
␥
: molecular cloning, expression, and
biological activities of a novel CC chemokine that is constitutively secreted in
vivo. J. Inflamm. 45:207.
33. Poznansky, M. C., I. T. Olszak, R. Foxall, R. H. Evans, A. D. Luster, and
D. T. Scadden. 2000. Active movement of T cells away from a chemokine. Nat.
Med. 6:543.
34. Ward, S. G., K. Bacon, and J. Westwick. 1998. Chemokines and T lymphocytes:
more than an attraction. Immunity 9:1.
35. Driscoll, K. E., D. G. Hassenbein, B. W. Howard, R. J. Isfort, D. Cody,
M. H. Tindal, M. Suchanek, and J. M. Carter. 1995. Cloning, expression, and
functional characterization of rat MIP-2: a neutrophil chemoattractant and epi-
thelial cell mitogen. J. Leukocyte Biol. 58:359.
36. Hogaboam, C. M., C. L. Bone-Larson, M. L. Steinhauser, N. W. Lukacs,
L. M. Colletti, K. J. Simpson, R. M. Strieter, and S. L. Kunkel. 1999. Novel
CXCR2-dependent liver regenerative qualities of ELR-containing CXC chemo-
kines. FASEB J. 13:1565.
2595The Journal of Immunology
by guest on May 11, 2019http://www.jimmunol.org/Downloaded from