Interleukin-10 Prevents Glutamate-Mediated Cerebellar Granule Cell Death by Blocking Caspase-3-Like Activity

Abstract

Interleukin-10 (IL-10) has been shown to reduce neuronal degeneration after CNS injury. However, the molecular mechanisms underlying the neuroprotective properties of this cytokine are still under investigation. Glutamate exacerbates secondary injury caused by trauma. Thus, we examined whether IL-10 prevents glutamate-mediated cell death. We used rat cerebellar granule cells in culture because these neurons undergo apoptosis upon exposure to toxic concentrations of glutamate (100-500 microm) or NMDA (300 microm). Pretreatment of cerebellar granule cells with IL-10 (1-50 ng/ml) elicited a dose- and time-dependent reduction of glutamate-induced excitotoxicity. Most importantly, IL-10 reduced the number of apoptotic cells when added to the cultures together or 1 hr after glutamate. Using patch-clamping and fluorescence Ca(2+) imaging techniques, we examined whether IL-10 prevents glutamate toxicity by blocking the function of NMDA channel. IL-10 failed to affect NMDA channel properties and to reduce NMDA-mediated rise in intracellular Ca(2+). Thus, this cytokine appears to prevent glutamate toxicity by a mechanism unrelated to a blockade of NMDA receptor function. Various proteases, such as caspase-3, and transcription factors, such as nuclear factor kappaB (NF-kappaB), have been proposed to participate in glutamate-mediated apoptosis. Thus, we examined whether IL-10 modulates the activity of these apoptotic markers. IL-10 blocked both the glutamate-mediated induction of caspase-3 as well as NF-kappaB DNA binding activity, suggesting that the neuroprotective properties of IL-10 may rely on its ability to block the activity of proapoptotic proteins.

Full text

Interleukin-10 Prevents Glutamate-Mediated Cerebellar Granule
Cell Death by Blocking Caspase-3-Like Activity
Alessia Bachis,
1,4
Anna M. Colangelo,
1
Stefano Vicini,
2
Pylord P. Doe,
2
Maria A. De Bernardi,
3
Gary Brooker,
3
and Italo Mocchetti
1,4
Departments of
1
Neuroscience and
2
Physiology, Georgetown University, Washington, DC 20007,
3
Department of Biology,
Johns Hopkins University, Baltimore, Maryland 21218, and
4
University of Cagliari, School of Pharmacy, 09124 Cagliari, Italy
Interleukin-10 (IL-10) has been shown to reduce neuronal de-
generation after CNS injury. However, the molecular mecha-
nisms underlying the neuroprotective properties of this cytokine
are still under investigation. Glutamate exacerbates secondary
injury caused by trauma. Thus, we examined whether IL-10
prevents glutamate-mediated cell death. We used rat cerebellar
granule cells in culture because these neurons undergo apo-
ptosis upon exposure to toxic concentrations of glutamate
(100–500
␮
M) or NMDA (300
␮
M). Pretreatment of cerebellar
granule cells with IL-10 (1–50 ng/ml) elicited a dose- and time-
dependent reduction of glutamate-induced excitotoxicity. Most
importantly, IL-10 reduced the number of apoptotic cells when
added to the cultures together or 1 hr after glutamate. Using
patch-clamping and fluorescence Ca
2⫹
imaging techniques,
we examined whether IL-10 prevents glutamate toxicity by
blocking the function of NMDA channel. IL-10 failed to affect
NMDA channel properties and to reduce NMDA-mediated rise
in intracellular Ca
2⫹
. Thus, this cytokine appears to prevent
glutamate toxicity by a mechanism unrelated to a blockade of
NMDA receptor function. Various proteases, such as
caspase-3, and transcription factors, such as nuclear factor
␬
B
(NF-
␬
B), have been proposed to participate in glutamate-
mediated apoptosis. Thus, we examined whether IL-10 modu-
lates the activity of these apoptotic markers. IL-10 blocked
both the glutamate-mediated induction of caspase-3 as well as
NF-
␬
B DNA binding activity, suggesting that the neuroprotec-
tive properties of IL-10 may rely on its ability to block the
activity of proapoptotic proteins.
Key words: apoptosis; Ca
2⫹
; caspase-3; EAA; IL-10; NF-
␬
B;
NMDA receptors
Injury to the CNS triggers an abnormal release of glutamate and
other excitatory amino acids (EAAs) that contribute significantly
to the neurological outcome (Wielock, 1985; Rothman and Olney,
1986). The released glutamate causes an excessive activation of
glutamate receptors of the NMDA subtype, leading to an abnor-
mal influx of Ca
2⫹
in viable neurons (Garthwaite et al., 1986;
MacDermott et al., 1986) and a subsequent neuronal death (Choi,
1988; Hahn et al., 1988). The type of cell death caused seems to
depend on the nature of the injury. Necrosis occurs after an acute
insult, whereas apoptotic cell death is involved in propagation of
the secondary injury (Bonfoco et al., 1995; Liu et al., 1997;
Yakovlev et al., 1997). Because apoptotic neurons can be rescued,
because they remain viable for a period of time, compounds that
prevent apoptosis may have a therapeutic significance.
The cytokine interleukin-10 (IL-10) has been shown to im-
prove neurological outcome after CNS injury (Knoblach and
Faden, 1998; Bethea et al., 1999) and to render neurons in culture
less vulnerable to ischemic and EAA-mediated damage (Grilli et
al., 2000). IL-10 is notoriously known as an inhibitor of the
synthesis of inflammatory cytokine, including tumor necrosis
factor-
␣
(TNF-
␣
) and IL-1
␤
(Bogdan et al., 1992; Wang et al.,
1994; Kline et al., 1995; Di Santo et al., 1997; Bethea et al., 1999;
Sawada et al., 1999). Some of these cytokines can exacerbate
neuronal damage after CNS trauma (Mocchetti and Wrathall,
1995; Feuerstein et al., 1998); therefore, it has been suggested that
the IL-10 ability to improve neurological outcome after CNS
injury relies on its anti-inflammatory effects. However, these
properties cannot fully explain why IL-10 can also reduce
glutamate-mediated cell death (Grilli et al., 2000). Thus, the
mechanisms underlying the neuroprotective properties of IL-10
are not fully understood.
Evidence has accumulated suggesting that neurotrophic fac-
tors, such as brain-derived neurotrophic factor (BDNF) and basic
fibroblast growth factor (FGF2), prevent glutamate-mediated
neuronal cell death in culture by blocking the sustained increase
in cytosolic free Ca
2⫹
concentration evoked by toxic concentra-
tions of glutamate (Mattson et al., 1989; Cheng et al., 1995). This
effect has been shown to depend on the ability of these neurotro-
phic factors to reduce the synthesis of specific subunits of NMDA
receptors (Brandoli et al., 1998). In contrast, the proinflammatory
cytokine IL-6 increases excitotoxicity by enhancing NMDA re-
ceptor function (Qiu et al., 1998). IL-10 may exert a neuropro-
tective effect by a mechanism similar to that of growth factors and
opposite to that of IL-6. However, this hypothesis remains pri-
marily speculative. In addition, IL-10 has been shown to slow
down progression of apoptosis in immuno-derived cells (Schot-
telius et al., 1999). Hence, IL-10 may improve neurological out-
come after CNS trauma by reducing apoptosis and, thus, second-
ary injury processes.
The current study was undertaken to examine the ability of
IL-10 to prevent EAA-mediated neuronal cell death in cerebellar
Received Oct. 9, 2000; revised Feb. 9, 2001; accepted Feb. 14, 2001.
This work was supported by grants from American Heart Association Nation’s
Affiliate (I.M.), Health and Human Services Grants HL 28940 (G.B.) and MH58946
and MH01680 (S.V.), and a fellowship from Schering Plough Research Institute
(A.B.). We thank Randi Goodnight for her help in computer programs and image
analysis and Dr. S. Narula for the gift of IL -10.
Correspondence should be addressed to Dr. Italo Mocchetti, Department of
Neuroscience, Research Building, Georgetown University, 3900 Reservoir Road
NW, Washington, DC 20007. E-mail: moccheti@gunet.georgetown.edu.
Copyright © 2001 Society for Neuroscience 0270-6474/01/213104-09$15.00/0
The Journal of Neuroscience, May 1, 2001, 21(9):3104–3112

granule cells and gain insights into the mechanisms underlying
this effect. We report that IL-10 prevents glutamate-mediated
apoptotic cell death by blocking the activity of proapoptotic
markers.
MATERIALS AND METHODS
Cell culture
Cerebellar granule cells were prepared from 8-d-old Sprague Dawley rat
pups (Taconic Farms, Germantown, NY) as described previously (Bran-
doli et al., 1998; Marini et al., 1998). Briefly, neurons were plated onto
poly-L-lysine (1%) precoated 100 mm plastic dishes at a density of 2.5 ⫻
10
6
cells/ml and grown in Basal Medium Eagle (Life Technologies,
Gaithersburg, MD) containing glutamine (2 mM), fetal calf serum (10%),
KCl (25 mM), gentamicin (100
␮
g/ml), and penicillin–streptomycin
(10,000U/ml). Cells were maintained at 37°C in 5% C O
2
–95% air.
Cytosine arabinoside (10
␮
M) was added 24 hr after cell plating to inhibit
glial proliferation. At the time of the experiments, these cultures were
composed of ⬃95% neurons and ⬃5% of non-neuronal cells, such as
astrocytes, oligodendrocytes, and endothelial cells. Human recombinant
IL-10 (a gift from Dr. S. Narula, Schering-Plough, Kenilworth, NJ),
glutamate, or NMDA (Sigma, St. Louis, MO) were added to the cultures
at8din vitro. After the addition of glutamate or other compounds,
cultures were kept in the same medium until analysis of cell viability.
Sister cultures that received medium alone were used as a control.
Cell survival
The percent of surviving neurons in the presence of IL-10 and/or gluta-
mate was estimated by determining the activity of mitochondrial dehy-
drogenases [3(4,5-dimethylthiazol-2-yl)-2.5-diphenyltetrazolium bromide
(MTT) assay] and the number of apoptotic cells [in situ terminal deoxy-
nucleotidyl transferase-mediated biotinylated UTP nick end labeling
(TUNEL)].
MTT assay. The conversion of the yellow tetrazolium salt (MTT) to
the purple formazan dye is dependent on the activity of mitochondrial
dehydrogenases and is, therefore, reflective of the viability of the cell and
the cytotoxicity of glutamate. The assay was performed according to the
specifications of the manufacturer (MTT Kit I; Boehringer Mannheim,
Indianapolis, IN). Briefly, neurons were cultured on 96-well plates, 10
␮
g
of the 5 mg/ml MTT labeling reagent was added to each well containing
neurons in 100
␮
l of medium, and the plate was incubated for 4 hr in a
humidified atmosphere. After the incubation, 100
␮
l of the solubilization
solution were added to each well for 18 hr. The absorbance of the
samples was measured at a wavelength of 570 and 700 nm (reference
wavelength). Unless otherwise indicated, the extent of MTT conversion
in cells exposed to glutamate is expressed as a percentage of control.
In situ TUNEL. Cerebellar granule cells were plated onto 25-mm-
round, 1-mm-thick glass coverslips (Fisher Scientific, Houston, TX) pre-
coated with poly-L-lysine (1%). Cells were washed with PBS, fixed with
4% paraformaldehyde for 30 min, and rinsed three times with PBS. C ells
were then permeabilized with 0.1% Triton X-100 in PBS and then
treated with 0.3% H
2
O
2
for 30 min to eliminate endogenous peroxidases.
The DNA nick labeling reaction was performed using 50 U/ml Klenow
(Boehringer Mannheim) and 2 mMdN TP with 0.5 nMbiotin-16-dUTP in
buffer A (0.05 MTris HCl, pH 5.5, 5 mMMgC l
2
, 14.5 mM
2-mercaptoethanolsulfonic acid, and 50 mg/ml BSA) for 60 min at 37°C.
Cells were then rinsed in PBS and incubated with streptavidin-
peroxidase-HRP (50
␮
g/ml) for 30 min at 37°C. After rinsing, the
labeling was visualized using diaminobenzidine. T he viable neurons were
quantified by counting TUN EL-positive cell bodies, and results are
expressed as percent of cell survival.
Double labeling
For caspase-3 and TUNEL double labeling, neurons were plated onto
12-mm-round, 1-mm-thick precoated glass coverslips. Cells were fixed
with 4% paraformaldehyde, post-fixed in ethanol/acetic acid 2:1, washed,
and incubated with caspase-3-p20 antibody (1:1000 dilution; Santa Cruz
Biotechnology, Santa Cruz, CA). After rinsing with PBS, cells were
equilibrated according to the instructions of the manufacturer (ApoTag;
Intergen, Purchase, NY), incubated with TdT enzyme in the presence of
digoxigenin-labeled dN TP, followed by anti-digoxigenin (fluorescein
conjugate) antibody. Cells were then incubated with secondary antibody
for caspase-3, Texas Red anti-goat (1:500; Vector Laboratories, Burlin-
game, CA) and mounted using Vectashield Mounting Medium with
4⬘,6⬘-diamidino-2-phenylindole (Vector Laboratories) to detect viable
cells. Reaction was visualized with the Nikon (Tokyo, Japan) inverted
fluorescent microscope ECLIPSE TE300. Optronics Magnafire software
(Optronics, Goleta, CA) was used to analyze positive cells.
Caspase-3-like activity
Neurons were plated onto 100 mm dishes. Caspase-3-like activity was
measured in lysates of cerebellar granule cells using the caspase-3 col-
orimetric assay protease kit (Chemicon, Temecula, CA) following the
instructions of manufacturer. In brief, neurons were lysed in ice-cold lysis
buffer (150 mMNaCl, 20 mMTris HC l, pH 7.2, 1% Triton X-100, and 1
mMDTT) for 10 min. After removal of cellular debris by centrifugation,
protein levels in the lysates (cytosolic extract) were measured by the
Bradford Coomassie blue colorimetric assay (Bio-Rad, Hercules, CA)
and equalized accordingly to obtain 150
␮
g of cytosolic extract per
sample. Samples were incubated with 200
␮
Mcaspase-3 substrate
N-acethyl-Asp-Glu-Val-Asp (DEVD)-p-nitroanilide at 37°C for 2 hr.
Samples were analyzed at 400 nm in a microtiter plate reader. Data are
expressed as fold increase –decrease in caspase-3 activity compared with
control cells.
Fluorescence Ca
2⫹
imaging
Cytosolic free Ca
2⫹
concentration ([Ca
2⫹
]
i
) was measured by single-cell
fura-2 fluorescence ratio imaging as described previously (De Bernardi
et al., 1996). For this purpose, neurons were plated onto 25-mm-round,
1-mm-thick glass coverslips (Fisher Scientific) precoated with poly-L-
lysine (1%). For the acute (10 min) treatment, cells were labeled with
fura-2 (fura-2 AM; Molecular Probes, Eugene, OR) in growth medium
for 30 min at 37°C in an atmosphere of 5% CO
2
, washed in Mg
2⫹
-free
Locke’s solution (in mM: 154 NaCl, 5.6 KCl, 3.6 NaHC O
3
,2.3CaCl
2
, 5.6
glucose, and 15 HEPES, pH 7.4) and imaged. Resting [Ca
2⫹
]
i
was
recorded for ⬃60 sec, vehicle (medium alone) or IL-10 (50 ng/ml) was
added, and [Ca
2⫹
]
i
was followed for 10 min. Cells were then exposed to
NMDA (50
␮
M), and [Ca
2⫹
]
i
was monitored over a 20–30 min period.
For the 24 hr treatment, neurons were incubated with growth medium or
IL-10 (50 ng/ml) for 24 hr. C ells were then labeled with fura-2, imaged
and challenged with NMDA as described above. Ca
2⫹
imaging was
performed at room temperature using an Attofluor RatioVision digital
fluorescence microscopy system (Atto Instruments, Rockville, MD)
equipped with a Zeiss Axiovert 135 microscope and a F-Fluar 40⫻, 1.3
numerical aperture oil-immersion objective, as described previously (De
Bernardi et al., 1996). Briefly, fura-2 was excited at 334 and 380 nm with
its emission monitored at 510 –530 nm; the 334/380 nm excitation ratio
increases as a function of the [Ca
2⫹
]
i
. Before the experiments, the
instrument was calibrated (calibration was done in vitro with f ura-2
pentapotassium salt in the presence of high concentration of C a
2⫹
or
EGTA), and the 334/380 nm excitation ratio was converted to [Ca
2⫹
]
i
nM
values (Grynkiewicz et al., 1985). For each coverslip, 50 –99 neurons were
simultaneously imaged in a given microscopic field, and single-cell Ca
2⫹
responses were collected and averaged to yield [C a
2⫹
]
i
population
means ⫾SEM) that were plotted versus time.
Electrophysiology
Electrodes were pulled from thin-walled borosilicate glass (Drummond
Scientific, Broomall, PA) using a Narashige (Tokyo, Japan) PP-83 vertical
puller. Electrodes had open-tip resistances of 5– 8 M⍀. Recordings were
made on the stage of a CK2 inverted phase-contrast microscope (Olym-
pus Optical, Lake Success, NY) at room temperature (22–25°C). Cul-
tured granule cells were voltage clamped at ⫺60 mV in the whole-cell
configuration using the patch-clamp technique after series resistance
compensation (typically 15–20 M⍀). Series resistance was monitored for
constancy, and cell capacitance was estimated from the average of 10
transient relaxation currents produced by 5 mV hyperpolarizing voltage
pulses. The recording pipette contained (in mM): 145 K-gluconate, 5
EGTA, 5 MgATP, 0.2 NaGTP, and 10 mMHEPES at pH 7.2 with KOH.
Cells were bathed in 145 mMNaCl, 5 mMKCl, 1 mMCaCl
2
,5mM
glucose, 5 mMHEPES, and 20
␮
Mglycine at pH 7.4. Osmolarity was
adjusted to 325 mOsm with sucrose. The culture dish in the recording
chamber (⬍500
␮
l total volume) was continuously perfused (5 ml /min)
to prevent accumulation of drugs.
Drug application. All of the drugs were diluted in bath solution.
NMDA (200
␮
M) was applied directly by a gravity-fed Y-tubing delivery
system (Murase et al., 1989) placed within 100
␮
m of the recorded cell.
Drug application had fast onset (⬍10 msec) and achieved a completely
local perfusion of the recorded cell. Ifenprodil (Reseach Biochemicals,
Bachis et al. •IL-10 and Glutamate Toxicity J. Neurosci., May 1, 2001, 21(9):3104–3112 3105

Natick, MA) or IL-10 were coapplied with NMDA after at least 1 min of
preperfusion. The response recovery was achieved after 5–7 min of wash
from the last application. Recordings were performed in the presence of
GABA
A
and AMPA receptor antagonists bicuculline methiodide (10
␮
M; Sigma) and 5
␮
M6-nitro-7-sulfamoilbenzo[f]quinoxaline-2,3-dione
(Tocris Coockson, St. Louis, MO), diluted in bath solution from stock
solutions prepared in water and DMSO, respectively.
Data acquisition and analysis. Currents were monitored with a patch
amplifier (EPC-7; List Electronics, Darmstadt, Germany), filtered at 1.5
kHz (eight-pole low-pass Bessel; Frequency Devices, Haverhill, M A),
and digitized using a IBM-compatible microcomputer equipped with the
Digidata 1200 data acquisition board and pClamp 8 software (Axon
Instruments, Foster City, CA). Off-line data analysis, dose–response
fitting, and figure preparation were performed with Origin (MicroC al
Software, Northampton, MA) and pClamp 8 software (Axon Instru-
ments). Data values are expressed as mean ⫾SEM. Significance was
assessed with ANOVA followed by independent ttests, unless otherwise
indicated.
Electrophoretic mobility shift assay
Nuclear factor
␬
B (NF-kB) binding activity was analyzed in nuclear
extracts from cerebellar granule cells prepared as described previously
(Colangelo et al., 1998). Nuclei were incubated with a double-stranded
oligonucleotide containing a consensus NF-kB binding site (5⬘-
GGCAGAGGGGACTTTCCGAGAGGC -3⬘) labeled with
32
P-dCTP
by Klenow polymerase (Boehringer Mannheim). Binding reactions were
performed for 20 min at room temperature in a 25
␮
l of reaction
containing 10 mMHEPES, pH 7.6, 134 mMNaCl, 4% (w/v) Ficoll, 5%
(v/v) glycerol, 1 mMEDTA, 10 mMDTT, 0.25
␮
g of BSA, 0.06%
bromophenol blue, 1
␮
g poly(dI-dC), and 0.5 ng of probe. Protein:DNA
complexes were separated on 6% PAGE. For supershift assays, nuclear
extracts were preincubated with 1
␮
l of antisera at 4°C for 20 min before
addition of the probe. Quantitation of binding activity was done by
densitometry as described previously (Colangelo et al., 1998).
RESULTS
IL-10 prevents glutamate-mediated cell death
Before examining whether IL-10 limits glutamate excitotoxicity,
we first established time- and dose-dependent excitotoxicity in
cerebellar granule cells exposed continuously to glutamate. Thus,
cultures were exposed to medium alone or containing increasing
concentrations of glutamate for various times without replacing
the medium. Cell death–survival was measured by MTT assay.
Glutamate (300
␮
M) induced a time-dependent decrease in cell
viability starting at 6 hr and culminating at 24 hr (Fig. 1A).
Glutamate-mediated excitotoxicity was blocked by the NMDA
receptor antagonist (⫹)-5-methyl-10,11-dihydro-5H-dibenzo [a,d]
cyclohepten-5,10-imine maleate (MK-801) (Fig. 1A), supporting
previous findings that glutamate toxicity depends on stimulation
of NMDA receptors (Schramm et al., 1990; Marini et al., 1997).
Glutamate also evoked a dose-dependent excitotoxic effect start-
ing from a concentration of 100
␮
Mand peaking at 500
␮
M(Fig.
1B). Neurons were then exposed to IL-10 (50 ng/ml) for 14 hr
before the addition of glutamate, and cell survival was measured
14 hr later. IL-10 prevented glutamate-mediated cell death even
when glutamate was used at the highest concentration (Fig. 1 B).
IL-10 inhibits glutamate-mediated apoptosis
In cerebellar granule cells, glutamate evokes necrosis and /or
apoptosis depending on the experimental conditions used (Res-
ink et al., 1994; Ankarcrona et al., 1995; Du et al., 1997). Thus, we
determine whether IL-10 prevented glutamate-mediated apopto-
sis by in situ TUNEL (Fig. 2). In control neurons, few cells (at the
most 5%) were TUNEL-positive (Fig. 2 A). E xposure of cells to
glutamate for 24 hr increased the number of TUNEL -positive
cells (Fig. 2B). Pretreatment of neurons with IL-10 for 24 hr, a
treatment that per se did not alter cell viability (Fig. 2C), blocked
glutamate-mediated increase in TUNEL-positive cells (Fig. 2 D).
To confirm that, in our experimental condition glutamate evokes
cell death by apoptosis, caspase-3 staining and in situ TUNEL
were performed in the same cells. Caspase-3 is a protease that
plays a role in the EAA-mediated apoptosis in cerebellar granule
cells (Du et al., 1997; Tenneti and Lipton, 2000). Figure 3 shows
that all TUN EL-positive cells were also caspase-3-positive, sug-
gesting that, in our experimental conditions, apoptosis could be
the main cause of cell death by glutamate.
IL-10 prevents NMDA-mediated cell death
Cell death of cerebellar granule neurons is attributable to the
overactivation of the NMDA subtype of receptors (Schramm et
al., 1990; Marini et al., 1997). We then examined whether IL -10
prevented glutamate and NMDA-mediated cell death by
TUNEL (Fig. 4A) and MTT (Fig. 4B) assays. Exposure of
cerebellar granule cells to IL-10 for 24 hr elicited a dose-
dependent neuronal protection against both EAAs (Fig. 4). In-
Figure 1. Glutamate induces a time- and dose-dependent excitotoxicity
blocked by IL-10. A, Cerebellar granule cells were exposed to glutamate
(300
␮
M) in the presence or absence of M K-801 (10
␮
M) for the indicated
times, and then cell viability was measured at the indicated times by MTT
assay. B, Neurons were exposed to IL-10 (50 ng/ml) for 14 hr before the
addition of different concentrations of glutamate. Cell viability was mea-
sured by MTT assay 14 hr after glutamate addition. Data, expressed as
percentage of control, are the mean ⫾SEM of four separate experiments.
*p⬍0.01, **p⬍0.005 versus control; ^p⬍0.01, ^^p⬍0.005 versus
glutamate (ANOVA and Dunnett’s test).
3106 J. Neurosci., May 1, 2001, 21(9):3104–3112 Bachis et al. •IL-10 and Glutamate Toxicity

deed, a significant effect of IL-10 was seen already at a concen-
tration of 10 ng/ml (⬃70% survival), whereas the maximal
neuroprotection (95% of survival) was obtained with a concen-
tration of 50 ng/ml (Fig. 4). Similar neuroprotection was observed
when neurons were exposed to MK-801 (1
␮
M) 30 min before
glutamate (data not shown).
To establish the temporal profile of IL-10 neuroprotective
effect, neurons were exposed to IL-10 (50 ng/ml) for various
times (6, 12, and 24 hr) before glutamate. In addition, to examine
the effect of an acute exposure to IL-10, neurons were incubated
with glutamate either concomitantly with IL-10 or 1 hr before
IL-10. Cell death was then measured by both MTT and TUNEL
assays 14 hr later. IL-10 evoked a time-dependent neuroprotec-
tion that was maximal when IL-10 was added several hours before
glutamate (Fig. 5). When IL-10 was added concomitantly or after
glutamate, a modest but significant neuroprotective effect was still
observed (Fig. 5). These data suggest that IL-10 is an effective
neuroprotective agent against glutamate-mediated cell death.
Effect of IL-10 on NMDA receptor channel
The effect of IL-10 in preventing glutamate and NMDA toxicity
is rapid because it occurs even if the addition of IL -10 is delayed
after glutamate. These data suggest that IL-10 may interact
directly with the NMDA receptor. To test this hypothesis, we
examined whether IL-10 alters NMDA currents. Cerebellar gran-
ule cells in culture were voltage clamped at ⫺60 mV using
whole-cell recordings with a potassium gluconate-based solution.
On average, the current recorded from granule cells normalized
by the cell capacitance was 25 ⫾7.3 pA /pF (n⫽65). NMDA
applications produced desensitizing whole-cell currents (Fig. 6A).
Coapplication of IL-10 (50 ng/ml) with NMDA did not change
the NMDA response (Fig. 6A). The ratio of the maximal current
densities recorded in each cell in the presence or the absence of
IL-10 (50 ng/ml) revealed that the current density did not change
in cells exposed concomitantly to IL-10 and NMDA (Fig. 6B,first
bar) or preexposed to IL-10 for 30 min, 180 min, or 14 hr before
NMDA (Fig. 6B).
Because some neuroprotective neurotrophic factors have been
shown to alter the synthesis of NMDA receptor subunits (Bran-
doli et al., 1998), NMDA currents were also studied in the
presence of Ifenprodil, a selective antagonist of NMDA receptor
that include the NR1 and NR2B subunits (Williams, 1993).
Similar to a previous report (Corsi et al., 1998), 10
␮
MIfenprodil
reduced the peak currents elicited by 200
␮
MNMDAby50⫾
16%. In 12 granule cells from three distinct experiments, IL-10
(50 ng/ml) incubation did not alter the Ifenprodil effect, which
was 49 ⫾11% after 30 min of IL -10 treatment, 52 ⫾19% after
180 min of treatment, and 48 ⫾18% for the overnight treatments.
These results indicate that IL -10 treatment failed to alter the
functional expression of distinct subunits of NMDA receptor in
cerebellar granule cells.
IL-10 does not prevent EAA-evoked [Ca
2ⴙ
]
i
increase
The relatively rapid effect of IL-10 in preventing glutamate and
NMDA toxicity suggests that IL-10 might interact directly with
the NMDA receptor. Because activation of NMDA receptor
promotes influx of extracellular Ca
2⫹
through its own channel,
the functional state of the NMDA receptor can be assessed by
measuring its ability to evoke an [Ca
2⫹
]
i
increase after stimula-
Figure 3. Caspase-3 immunoreactivity in TUN EL -
positive cells. Neurons were exposed to medium alone
or glutamate (300
␮
M) for 3 hr. Determination of
apoptotic neurons was performed by TUNEL (A,D)
and caspase-3-p20 (B,E) staining. A–C, Control cells;
D–F, glutamate-treated cells. Analysis by Magnafire
revealed that all TUN EL-positive cells were also pos-
itive for caspase-3 (overlay). Scale bar, 15
␮
m.
Figure 2. IL-10 reduces the increase of TUN EL-positive cells glutamate
mediated. Cerebellar granule cells were exposed to medium alone (A),
glutamate (B; 300
␮
M), or IL-10 (C; 50 ng/ml) for 14 hr, or IL -10 for 14
hr followed by glutamate for 14 hr ( D). Cells were then fixed and stained
for TUNEL for the determination of apoptosis. In both control and
IL-10-treated cultures, 95% of cells were TUN EL-negative, whereas
⬃65% of neurons after glutamate treatment were TUNEL -positive (dark
brown). Scale bar, 15
␮
m.
Bachis et al. •IL-10 and Glutamate Toxicity J. Neurosci., May 1, 2001, 21(9):3104–3112 3107

tion with a proper ligand. Thus, we investigated whether IL-10
blocks glutamate- or NMDA-mediated surge in [Ca
2⫹
]
i
. Cere-
bellar granule cells were exposed to either vehicle or IL-10 (50
ng/ml) for 10 min or 24 hr, NMDA (50
␮
M) was then added, and
[Ca
2⫹
]
i
was measured over time. Exposure of neurons to IL -10
did not affect [Ca
2⫹
]
i
, and the resting [Ca
2⫹
]
i
monitored before
the addition of NMDA showed no statistically significant differ-
ences between neurons treated with vehicle or IL-10 for either 10
minor24hr(inn
M: vehicle-treated, 40 ⫾8.6, n⫽10; IL-10-
treated, 52 ⫾7.8, n⫽10). [Ca
2⫹
]
i
increase induced by NMDA
peaked within 10 min from EAA addition and remained elevated
for at least 20 min. The [C a
2⫹
]
i
rise evoked by NMDA in neurons
pretreated with IL-10 for 10 min or 24 hr (the latter treatment
maximally preventing excitotoxicity) was comparable, in both
magnitude and kinetics, with that elicited in control, vehicle-
treated cells (Fig. 7A,B). The magnitude of the EAA-evoked
Ca
2⫹
response varied among the four cerebellar granule neuron
preparations used in this study, regardless of the pretreatment
(vehicle or IL-10, 10 min or 24 hr). Peak [Ca
2⫹
]
i
increase (ex-
pressed as fold above basal) was as follows: NMDA-treated cells,
10.7 ⫾3.6, n⫽6; IL-10 plus NMDA-treated cells, 12.5 ⫾5.6, n⫽
6. These results show that IL-10 does not prevent the EAA-
mediated increase in [Ca
2⫹
]
i
through NMDA receptor channels.
IL-10 prevents the increase in NF-
␬
B binding activity
evoked by glutamate
One way to prevent EAA-mediated apoptosis is to block the
activity of proapoptotic proteins. The transcription factor NF-
␬
Bis
associated with differentiation and apoptosis (O’Neill and
Kaltschmidt, 1997). In neurons, induction of NF-
␬
B DNA binding
by glutamate is believed to play a role in programmed neuronal cell
death (Kaltschmidt et al., 1995; Grilli et al., 1996). Thus, we
examined whether IL-10 affected NF-
␬
B nuclear activity in cere-
bellar granule cells. Electrophoretic mobility shift assay (EMSA) of
nuclear extracts of cells exposed for 1 hr to glutamate (300
␮
M)
showed higher NF-
␬
B binding activity than control cells (Fig. 8A).
Supershift experiments with specific antibodies (Fig. 8A) indicated
that the active complex consisted of the typical heterodimer of
NF-
␬
B p52 and p65 found in mammalian cells (Baeuerle and
Baltimore, 1996). The effect of glutamate began at 30 min and
lasted for at least up to 3 hr (Fig. 8B). We then examined whether
IL-10, added immediately before (10 min) glutamate, could affect
the glutamate-mediated increase in N F-
␬
B DNA binding activity.
IL-10, which per se decreased NF-
␬
B DNA binding activity
slightly below control levels (Fig. 8A), blocked the glutamate-
mediated increase in NF-
␬
B binding activity tested at 30 min, 1 hr,
and 3 hr after EAA application (Fig. 8B).
IL-10 and caspase-3-like activity
The inhibition of N F-
␬
B activity is very often associated with
inactivation of caspases (O’Neill and Kaltschmidt, 1997), pro-
teases that participate in the pathogenesis of C NS disorders
associated with apoptosis. Several lines of independent investiga-
tions have demonstrated that, in cerebellar granule cells,
caspase-3 but not caspase-1 plays a role in the NMDA-mediated
apoptosis (Du et al., 1997; Tenneti and Lipton, 2000). In addition,
we have shown that TUNEL-positive cells are also caspase-3-
positive (Fig. 3). Thus, we evaluated whether the neuroprotective
properties of IL-10 might involve an inhibition of caspase-3-like
activity. To provide quantitative data, caspase-3 was measured by a
colorimetric assay. E xposure of cerebellar granule cells to gluta-
Figure 4. The neuroprotective effect of IL -10 is dose-dependent. C ere-
bellar granule cells were exposed to different concentrations of IL-10 for
14 hr, and then glutamate or NMDA (300
␮
Meach) was added for
additional 14 hr. Cell survival was determined by in situ TUNEL (A) and
MTT (B) assay. Data, expressed as percentage of control, are the mean ⫾
SEM of four separate experiments (n⫽12 each group). *p⬍0.01, **p⬍
0.005 versus glutamate or NMDA alone (ANOVA and Dunnett’s test).
Figure 5. IL-10 elicits a time-dependent neuroprotection against gluta-
mate. Neurons were exposed to IL-10 alone (50 ng/ml) for 6, 12, and 24
hr before glutamate, to IL-10 and glutamate simultaneously ( 0), or to
glutamate 1 hr before IL-10 (⫺1). Cell survival was measured 14 hr after
glutamate by TUN EL assay. Data are the mean ⫾SEM of three inde-
pendent experiments (n⫽15 each group). ^p⬍0.005 versus control;
*p⬍0.05, **p⬍0.005 versus glutamate (ANOVA and Dunnett’s test).
3108 J. Neurosci., May 1, 2001, 21(9):3104–3112 Bachis et al. •IL-10 and Glutamate Toxicity

mate (300
␮
M) evoked an increase in caspase-3-like activity within
1 hr (Fig. 9), an effect that lasted at least up to 3 hr (data not
shown). In lysates of cells exposed to IL -10 for 1 hr, the basal levels
of caspase-3-like activity were reduced (Fig. 9). This effect was
similar to that obtained with the relatively specific, irreversible
caspase-3-like protease inhibitor acetyl-DEVD-chloromethylke-
tone (DEVDK) (Fig. 9). Most importantly, IL-10, similar to
DEVDK, blocked the glutamate-mediated rise in caspase-3-like
activity (Fig. 9), suggesting that IL-10 may be an effective caspase-3
inhibitor.
To further examine the role of caspase-3 in the glutamate-
mediated cell death, cells were incubated with IL-10 or DEVDK
(100
␮
M) 10 min before glutamate (300
␮
M), and cell death was
measured 14 hr later. Both compounds blocked the glutamate-
mediated neuronal cell death (Fig. 10), further suggesting that in
these neurons excitotoxicity involves a caspase-mediated pathway.
DISCUSSION
The anti-inflammatory cytokine IL-10 has been shown to reduce
vulnerability of neurons to CNS ischemia and trauma (Knoblach
and Faden, 1998; Bethea et al., 1999; Grilli et al., 2000). However,
the mechanisms underlying its neuroprotective activity remain to
be fully elucidated. In these studies, we demonstrated that IL-10
prevents glutamate and NMDA-mediated cell death in primary
cultures of cerebellar granule cells by blocking apoptosis. Re-
markably, IL-10 prevents EAA-mediated apoptotic cell death,
even when added after glutamate. Apoptosis is an event that plays
an important pathophysiological role in CNS after trauma,
stroke, or ischemia. In fact, apoptosis has been demonstrated to
contribute to neuronal or glial cell death occurring several hours
after brain or spinal cord injury (Hara et al., 1997; Liu et al., 1997;
Yakovlev et al., 1997). Moreover, several lines of independent
investigations have shown that apoptosis may be the major form
of cell death following EAA accumulating after an insult to the
CNS (for review, see Bettmann and Henderson, 1998). Thus, the
ability of IL-10 to reduce EAA-mediated apoptosis could explain
the therapeutic efficacy of this cytokine and shed some insights
into the mechanisms whereby IL -10 reduces infarct volume after
middle cerebral artery occlusion (Spera et al., 1998; Grilli et al.,
Figure 6. IL-10 fails to inhibit NMDA-activated currents. A, Current
traces from cerebellar granule cells elicited by 200
␮
MNMDA in the
presence and absence of IL-10 (50 ng/ml). NMDA was applied by a
Y-tubing device for the duration indicated by the bars. Holding potential,
⫺60 mV. B, Summary of the action of IL-10 treatments in cerebellar
granule cells. The left histog ram bar labeled IL-10 represents the percent-
age control of peak currents normalized to the cell capacitance recorded
from 31 individual cells during application of NMDA in the presence of
IL-10 (50 ng/ml). The other histogram bars represent the percentage
control peak current density from at least 10 distinct granule neurons in
three distinct sets of experiments in which cells were pretreated with
IL-10 (50 ng/ml) for 30 min, 180 min, or 14 hr. Each point represents the
mean ⫾SEM of the ratios of normalized current. No significant differ-
ences were found between control and treated cells.
Figure 7. IL-10 fails to block EAA-mediated [Ca
2⫹
]
i
increase. Ca
2⫹
imaging in cerebellar granule neurons from four independent prepara-
tions was performed as described in Materials and Methods. A, Peak
[Ca
2⫹
]
i
increase evoked by NMDA in IL-10-treated cells and expressed
as percentage of the Ca
2⫹
response in vehicle-treated (control) cells that
were imaged in parallel experiments. Data represent mean ⫾SEM (n⫽
5) for both 10 min and 24 hr (n⫽1 coverslip with 50 –99 neurons being
imaged simultaneously). B,Ca
2⫹
traces representative of NMDA-evoked
[Ca
2⫹
]
i
increase in neurons pretreated for 24 hr with either vehicle
(control) or IL-10. Data (mean ⫾SEM) represent the [Ca
2⫹
]
i
population
mean from 96 (control) and 99 (IL-10) neurons imaged simultaneously.
Bachis et al. •IL-10 and Glutamate Toxicity J. Neurosci., May 1, 2001, 21(9):3104–3112 3109

2000), enhances neurological recovery after traumatic brain in-
jury (Knoblach and Faden, 1998), or spinal cord lesion (Bethea et
al., 1999) in rats. We suggest that IL-10 is an effective compound
against EAA-mediated excitotoxicity.
Several growth factors– cytokines, in addition to IL-10, have
been shown to prevent glutamate toxicity in cerebellar granule
cells, among others BDNF and FGF2 (Fernandez-Sanchez and
Novelli, 1993; Lindholm et al., 1993; Courtney et al., 1997; Marini
et al., 1998). Indeed, we have reported recently that the neuro-
protective activity of BDNF and FGF2 correlates with their
ability to evoke a downregulation of the synthesis of NMDA
receptor subunit NR2A and NR2C (Brandoli et al., 1998). Con-
sequently, these growth factors decreased the abnormally sus-
tained [Ca
2⫹
]
i
typically seen after excessive stimulation of
NMDA receptors (Brandoli et al., 1998) and implicated in neu-
ronal cell death (Garthwaite et al., 1986; Rothman and Olney,
1986; Choi, 1988; Hahn et al., 1988; Anegawa et al., 1995). In
contrast, neurotoxic cytokines, such as IL-6, has been shown to
significantly potentiate NMDA-mediated increase intracellular
calcium in cerebellar granule cells and, consequently, NMDA-
mediated excitotoxicity (Qiu et al., 1998). Thus, it was important
to ascertain whether IL-10, a physiological anti-inflammatory
cytokine, could prevent NMDA-mediated neurotoxicity by re-
ducing NMDA current responses or Ca
2⫹
influx. IL-10, used at
a concentration and time effective against EAA-evoked cell
death, failed to block glutamate or NMDA-mediated Ca
2⫹
influx
or NMDA-mediated Ifenprodil-sensitive membrane depolariza-
tion. Thus, our data exclude that the neuroprotective effect of
IL-10 is attributable to a direct effect on the NMDA channel.
Apoptosis, in addition to toxic concentrations of EAA, can be
caused experimentally by a wide variety of stimuli. However, each
given cell type may use different molecular mechanisms to acti-
vate the cell death pathway. Cell death may be caspase-dependent
or -independent and may involve a particular type of caspases.
For instance, in cerebellar granule cells, caspase-3 does not ap-
pear to be involved in cell death evoked by serum deprivation
(Miller et al., 1997). Instead, caspase-3, but not caspase-1, plays an
important role in glutamate-mediated apoptosis (Du et al., 1997;
Tenneti and Lipton, 2000). Evidence has also suggested that
caspase-3 participates in apoptotic cell death after brain injury
(Yakovlev et al., 1997) or ischemia (Cheng et al., 1998; Namura et
al., 1998), indicating that caspase-3 plays a critical role in the
terminal stage of the apoptotic pathway after C NS injury. In this
report, we have shown that IL-10 prevents the increase in
Figure 8. IL-10 blocks the glutamate-mediated increase in N F-kB bind-
ing activity. Cells were exposed to glutamate (300
␮
M), IL-10 (50 ng/ml),
or a combination of glutamate and IL-10 for various times, nuclear
extracts were prepared, and then N F-kB binding activity was measured by
EMSA. A, Typical EMSA showing NF-
␬
B complexes (arrows). These
complexes were supershifted by
␣
-p50 and p65 but not p52 and c/Rel
antibodies. C, Control; glut, glutamate; NRS, normal rabbit serum. B,
Relative levels of NF-
␬
B binding activity were quantified by phosphorim-
ager analysis of the band corresponding to NF-
␬
B complexes. Data are
the mean ⫾SEM of three separate experiments, with two to three
independent samples each experiment. **p⬍0.01 versus glutamate
(ANOVA and Dunnett’s test).
Figure 9. IL-10 prevents the increase in caspase-3-like activity evoked by
glutamate ( glut). Cerebellar granule cells exposed to glutamate (300
␮
M),
IL-10 (50 ng/ml), or DEV DK (100
␮
M) alone or in combination. IL-10
and DEVDK were added 10 min before glutamate. Caspase-3-like activ-
ity was measured 1 hr later. Data are the mean ⫾SEM of three indepen-
dent preparations (n⫽6 each group). *p⬍0.01, **p⬍0.005 versus
control; ^p⬍0.005 versus glutamate (ANOVA and Dunnett’s test).
3110 J. Neurosci., May 1, 2001, 21(9):3104–3112 Bachis et al. •IL-10 and Glutamate Toxicity

caspase-3-like activity mediated by glutamate with a temporal
profile and magnitude similar to that of DEVDK, a typical
caspase inhibitor. In addition, IL-10 induced a rapid (within
hours) decrease in caspase-3-like activity, regardless of its lack of
effect on [C a
2⫹
]
i
, whose levels modulate caspase-3 induction
(Moran et al., 1999). Thus, it appears that IL-10 has an intrinsic
ability to inhibit directly or indirectly caspase-3-like activity; this
mechanism could explain the neuroprotective properties of IL -10
in vivo (Knoblach and Faden, 1998; Bethea et al., 1999; Grilli et
al., 2000). It remains to be established whether IL -10 affects other
caspases as well and the mechanisms whereby IL -10 reduces
caspase-3 activity in neurons.
Recent findings have implicated the transcription factor NF-
␬
B
as a mediator of neuronal apoptosis. Also, NF-
␬
B appears to
have a deleterious role on neuronal survival. In fact, cell death
occurs in neurons when NF-
␬
B is permanently activated, such as
after trauma (Bethea et al., 1998), global ischemia (Clemens et
al., 1998), or toxic concentrations of glutamate (Kaltschmidt et
al., 1995; Grilli et al., 1996). On the other hand, inhibition of
NF-
␬
B activity results in inactivation of caspases (Gill and Win-
debank, 2000). IL-10 blocked the glutamate-mediated NF-
␬
B
DNA binding activity, shown previously to be causally involved in
glutamate-mediated cell death (Kaltschmidt et al., 1995; Grilli et
al., 1996). Thus, we provided additional support that the neuro-
protective mechanism of this cytokine relies on its ability to
interfere with the cellular mechanism involved in apoptosis. In-
terestingly, the suppression of N F-
␬
B DNA binding activity plays
a role in the anti-inflammatory effect of IL -10 also in non-
neuronal cells (Schottelius et al., 1999). Therefore, we speculate
that IL-10, by reducing or preventing the activity of caspase-3 and
NF-
␬
B evoked by EAA, reestablishes the physiological basal
ratio of proapoptotic/antiapoptotic proteins that, in turn, may
render neurons less vulnerable to apoptosis.
Our results might be of crucial neurological significance be-
cause effective therapies against post-trauma secondary injury in
humans are still scarce. The findings reported here provide strong
support to the belief that IL-10 may have a therapeutic signifi-
cance for neurodegenerative diseases by blocking EAA-mediated
excitotoxicity. However, we cannot definitively rule out the exis-
tence of other mechanisms that could account for the neuropro-
tective effect of IL-10. For example, the anti-inflammatory prop-
erties of IL-10 and its ability to decrease the synthesis of TN F-
␣
,
IL-1
␤
(Bogdan et al., 1992; Wang et al., 1994; Kline et al., 1995;
Di Santo et al., 1997; Bethea et al., 1999, Sawada et al., 1999), or
other cytokines such as FGF2 (Zocchi et al., 1997) or macro-
phage inflammatory protein-1
␣
(Berkman et al., 1995), may also
help to reduce apoptosis. However, when we examined anti-
inflammatory neuroprotective compounds, such as methylpred-
nisolone, we did not observed neuronal protection against gluta-
mate (our unpublished observations). Moreover, astrocytes and
microglia are mostly the primary sources of proinflammatory
cytokines. Our neuronal cultures contain only few non-neuronal
cells (at the most 5%), thus, most likely do not contain toxic
concentration of inflammatory cytokines. In conclusion, we pro-
pose that the neuroprotective effects of IL-10 against EAA-
mediated excitotoxicity is, at least in cerebellar granule cells,
primary because of the ability of IL-10 to inhibit the activity of
proapoptotic proteins and in particular caspase-3.
REFERENCES
Anegawa NJ, Lynch DR, Verdoorn TA, Pritchett DB (1995) Transfec-
tion of N-methyl-D-aspartate receptors in a nonneuronal cell line leads
to cell death. J Neurochem 64:2004 –2012.
Ankarcrona M, Dypbukt JM, Bonfoco E, Zhivotovsky B, Orrenius S,
Lipton SA, Nicotera P (1995) Glutamate-induced neuronal death: a
succession of necrosis or apoptosis depending on mitochondrial f unc-
tion. Neuron 15:961–973.
Baeuerle PA, Baltimore D (1996) NF-
␬
B: ten years after. Cell 87:13–20.
Berkman N, John M, Roesems G, Jose PJ, Barnes PJ, Chung KF (1995)
Inhibition of macrophage inflammatory protein-1
␣
expression by IL-
10. J Immunol 155:4412– 4418.
Bethea JR, Castro M, Keane RW, Dietrich WD, Yezeirski RP (1998)
Traumatic spinal cord injury induces nuclear factor-kB activation.
J Neurosci 18:3251–3260.
Bethea JR, Nagashima H, Acosta MC, Briceno C, Gomez F, Marcillo A E,
Loor K, Green J, Dietrich D (1999) Systemically administered
interleukin-10 reduces tumor necrosis factor alpha production and
significantly improves f unctional recovery following traumatic spinal
cord injury in rats. J Neurotrauma 16:851–863.
Bettmann B, Henderson CE (1998) Neuronal cell death. Neuron
20:633–647.
Bogdan C, Paik J, Vodovotz Y, Nathan C (1992) Contrasting mecha-
nisms for suppression of macrophages cytokine release by transforming
growth factor–
␤
and interleukin-10. J Biol Chem 267:23301–23308.
Bonfoco E, Krainc D, Ankarcrona M, Nicotera P, Lipton SA (1995)
Apoptosis and necrosis: two distinct events induced respectively by
mild and intense insults with NMDA or nitric oxide/superoxide in
cortical cell culture. Proc Natl Acad Sci USA 92:7162–7166.
Brandoli C, Sanna A, De Bernardi MA, Follesa P, Brooker G, Mocchetti
I (1998) Brain-derived neurotrophic factor and basic fibroblast growth
factor downregulate NMDA receptor function in cerebellar granule
cells. J Neurosci 18:7953–7961.
Cheng B, Furukawa K, O’Keefe JA, Goodman Y, K ihiko M, Fabian T,
Mattson MP (1995) Basic fibroblast growth factor selectively increases
AMPA-receptor subunit GluR1 protein level and differentially modu-
lates Ca
2⫹
responses to AMPA and NMDA in hippocampal neurons.
J Neurochem 65:2525–2536.
Cheng Y, Deshmukh M, D’Costa A, Demaro JA, Gidday J, Shah A, Sun
Y, Jacquin MF, Johnson EM, Holtzman DM (1998) Caspase inhibitor
affords neuroprotection with delayed administration in a rat model of
neonatal hypoxic ischemic brain injury. J Clin Invest 101:1992–1999.
Choi DW (1988) Glutamate neurotoxicity and diseases of the nervous
system. Neuron 1:623–634.
Clemens JA, Stephenson DT, Yin T, Smaltstig B, Panetta JA, Little SP
(1998) Drug-induced neuroprotection from global ischemia is associ-
Figure 10. Inhibition of caspases prevents glutamate-mediated excitotox-
icity. Cerebellar granule cells were exposed to glutamate ( glut; 300
␮
M),
IL-10 (50 ng/ml), or DEV DK (100
␮
M) alone or in combination. IL-10
and DEVDK were added 10 min before glutamate. Cell survival was
measured 14 hr after by TUNEL assay. Data are the mean ⫾SEM of
three independent preparations (n⫽6 each group). *p⬍0.005 versus
control; **p⬍0.005 versus glutamate (ANOVA and Dunnett’s test).
Bachis et al. •IL-10 and Glutamate Toxicity J. Neurosci., May 1, 2001, 21(9):3104–3112 3111

ated with prevention of persistent but not transient activation of nuclear
factor-kB in rats. Stroke 29:677–682.
Colangelo AM, Johnson P, Mocchetti I (1998)
␤
-Adrenergic receptor-
induced activation of Nerve Growth Factor gene transcription in rat
cerebral cortex involves CCAAT/Enhancer binding protein
␦
. Proc
Natl Acad Sci USA 95:10920–10925.
Corsi L, JinHong L, Krueger KE, Wang YH, Wolfe BB, Vicini S (1998)
Up-regulation of NR2B subunit of NMDA receptors in cerebellar
granule neurons by Ca
2⫹
calmodulin kinase inhibitor KN93. J Neuro-
chem 70:1–9.
Courtney MJ, Akeman KEO, Coffey ET (1997) Neurotrophins protect
cultured cerebellar granule neurons against the early phase of cell
death by a two-component mechanism. J Neurosci 17:4201–4211.
De Bernardi MA, Rabin SJ, Colangelo AM, Brooker G, Mocchetti I
(1996) TrkA mediates the nerve growth factor-induced intracellular
calcium accumulation. J Biol Chem 271:6092– 6098.
Di Santo E, Adami M, Bertorelli R, Ghezzi P (1997) Systemic interleu-
kin 10 administration inhibits brain tumor necrosis factor production in
mice. Eur J Pharmacol 336:197–202.
Du Y, Bales KR, Dodel RC, Hamilton-Byrf E, Horn JW, Czilli DL,
Simmons LK, Binhui N, Paul SM (1997) Activation of a caspase
3-related cysteine protease is required for glutamate-mediated apopto-
sis of cultured cerebellar granule neurons. Proc Natl Acad Sci USA
94:11657–11662.
Fernandez-Sanchez MT, Novelli A (1993) Basic fibroblast growth factor
protects cerebellar neurons in primary cultures from NMDA and
non-NMDA receptor-mediated neurotoxicity. F EBS Lett 335:124–131.
Feuerstein GZ, Wang XK, Barone FC (1998) Inflammatory mediators
and brain injury. In: The role of cytokine and chemokines in stroke and
CNS diseases (Ginsberg M, Bogouslasky J, eds), pp 507–531. Oxford:
Blackwell Science.
Garthwaite G, Hajos F, Garthwaite J (1986) Ionic requirements for
neurotoxic effects of excitatory amino acid analogues in rat cerebellar
slices. Neuroscience 18:437– 447.
Gill JS, Windebank AJ (2000) Ceramide initiates NF-kB mediated
caspase activation in neuronal apoptosis. Neurobiol Dis 7:448 – 461.
Grilli M, Pizzi M, Memo M, Spano P (1996) Neuroprotection by aspirin
and sodium salicylate through blockade of NF-kB activation. Science
274:1383–1385.
Grilli M, Barbieri I, Basudev H, Brusa R, C asati C, Lozza G, Ongini E
(2000) Interleukin-10 modulates neuronal threshold of vulnerability to
ischemic damage. Eur J Neurosci 12:1– 8.
Grynkiewicz G, Poenie M, Tsien RY (1985) A new generation of C a
2⫹
indicators with greatly improved fluorescence properties. J Biol Chem
260:3440–3450.
Hahn JS, Aizenman E, Lipton S (1988) Central mammalian neurons
normally resistant to glutamate toxicity are made sensitive by elevated
Ca
2⫹
: toxicity is blocked by N-methyl-D-aspartate antagonist, M K801.
Proc Natl Acad Sci USA 85:6556–6560.
Hara H, Friedlander RM, Gagliardini V, Ayata C, Fink K, Huang Z,
Shimizu-Sasamata M, Yuan J, Moskowitz MA (1997) Inhibition of
interleukin-1 beta converting enzyme family of proteases reduces isch-
emic and excitotoxic neuronal damage. Proc Natl Acad Sci USA
94:2007–2012.
Kaltschmidt C, Kaltschmidt B, Baeuerle PA (1995) Stimulation of iono-
tropic glutamate receptors activates transcription factor NF-kB in pri-
mary neurons. Proc Natl Acad Sci USA 92:9618 –9622.
Kline JN, Fisher PA, Monick MM, Hunninghake GW (1995) Regula-
tion of interleukin-1 receptor antagonist by Th1 and Th2 cytokines.
Am J Physiol 269:92–98.
Knoblach SM, Faden AI (1998) Interleukin-10 improves outcome and
alters proinflammatory cytokine expression after experimental trau-
matic brain injury. Exp Neurol 153:143–151.
Lindholm D, Dechant G, Heisenberg CP, Thoenen H (1993) Brain
derived neurotrophic factor is a survival factor for cultured rat cere-
bellar granule neurons and protects against glutamate-induced neuro-
toxicity. Eur J Neurosci 5:1455–1464.
Liu X Z, Xu XM, Hu R, Du C, Z hang S, McDonald JW, Dong HX, Wu YJ,
Fan GS, Jacquin MF, Hsu CY, Choi DW (1997) Neuronal and glial
apoptosis after traumatic spinal cord injury. J Neurosci 17:5395–5406.
MacDermott AB, Mayer ML, Westbrook GL, Smith SJ, Barker JL (1986)
NMDA-receptor activation increases cytoplasmic calcium concentra-
tions in cultured spinal cord neurons. Nature 321:519 –522.
Marini AM, Spiga G, Mocchetti I (1997) Toward the development of
strategies to prevent ischemic neuronal injury. Ann NY Acad Sci
825:209–219.
Marini AM, Rabin SJ, Lipski R, Mocchetti I (1998) Activity-dependent
release of BDNF underlies the neuroprotective effect of NMDA. J Biol
Chem 273:29394 –29399.
Mattson MP, Murrain M, Guthrie PB, Kater SB (1989) Fibroblast growth
factor and glutamate: opposing roles in the generation and degeneration
of hippocampal neuroarchitecture. J Neurosci 9:3728–3732.
Miller TM, Moulder K L, Knudson M, Creedon DJ, Deshmukh M,
Korsmeyer SJ, Johnson EM (1997) Bax deletion further orders the
cell death pathway in cerebellar granule cells and suggests a caspase-
independent pathway to cell death. J C ell Biol 139:205–217.
Mocchetti I, Wrathall JR (1995) Neurotrophic factors in central nervous
system trauma. J Neurotrauma 12:853–870.
Moran J, Itoh T, Reddy UR, Chen M, Almeri ES, Pleasure D (1999)
Caspase-3 expression by cerebellar granule neurons is regulated by
calcium and cyclic AMP. J Neurochem 73:568 –577.
Murase K, Ryu PD, Randic M (1989) E xcitatory and inhibitory amino
acids and peptide-induced responses in acutely isolated rat spinal dorsal
horn neurons. Neurosci Lett 103:56 – 63.
Namura S, Zhu J, Fink K, Endres M, Srinivasan A, Tomaselli KJ, Yuan
J, Moskowitz MA (1998) Activation and cleavage of caspase-3 in
apoptosis induced by experimental cerebral ischemia. J Neurosci
18:3659–3668.
O’Neill LAJ, Kaltschmidt C (1997) NFkB: a crucial transcription factor
for glial and neuronal cell f unction. Trends Neurosci 20:252–257.
Qiu Z, Sweeney DD, Netzeband JG, Gruol DL (1998) Chronic
interleukin-6 alters NMDA receptor-mediated membrane responses
and enhances neurotoxicity in developing CNS neurons. J Neurosci
18:10445–10456.
Resink A, Hack N, Boer GJ, Bala´zs R (1994) Growth conditions differ-
entially modulate the vulnerability of developing cerebellar granule
cells to excitatory amino acids. Brain Res 655:222–232.
Rothman SM, Olney JW (1986) Glutamate and the pathophysiology of
hypoxic-ischemic brain damage. Ann Neurol 19:105–111.
Sawada M, Suzumura A, Hosoya H, Marunouchi T, Nagatsu T (1999)
Interleukin-10 inhibits both production of cytokines and expression of
cytokine receptors in microglia. J Neurochem 72:1466 –1471.
Schottelius AJG, Mayo M, Sartor BR, Baldwin AS Jr (1999)
Interleukin-10 signaling blocks inhibitor of kB kinase activity and
nuclear factor kB DNA binding. J Biol Chem 45:31868–31874.
Schramm M, Eimerl S, Costa E (1990) Serum and depolarizing agents
cause acute neurotoxicity in cultured cerebellar granule cells: role of
glutamate receptor responsive to N-methyl-D-aspartate. Proc Natl Acad
Sci USA 87:1193–1197.
Spera PA, Ellison JA, Feuerstein GZ, Barone FC (1998) IL-10 reduces
rat brain injury following focal stroke. Neurosci Lett 251:189–192.
Tenneti L, Lipton SA (2000) Involvement of activated caspase-3like pro-
teases in N-methyl-D-aspartate-induced apoptosis in cerebrocortical
neurons. J Neurochem 74:134–142.
Wang P, Wu P, Siegel MI, Egan RW, Billah MM (1994) IL-10 inhibits
transcription of cytokine genes in human peripheral blood mononu-
clear cells. J Immunol 153:811– 816.
Wielock T (1985) Hypoglycemia-induced neuronal damage prevented
by a N-methyl-D-aspartate antagonists. Science 230:681– 683.
Williams K (1993) Ifenprodil discriminates subtypes of N-methyl-D-
aspartate receptors: selectivity and mechanism at recombinant hetero-
meric receptors. Mol Pharmacol 44:851– 859.
Yakovlev AG, Knoblach SM, Fan Lei, Fox GB, Goodnight R, Faden AI
(1997) Activation of CPP32-like caspases contributes to neuronal ap-
optosis and neurological dysfunction after traumatic brain injury.
J Neurosci 17:7415–7424.
Zocchi C, Spiga G, Rabin SJ, Grekova M, Richert J, Chernyshev O,
Colton C, Mocchetti I (1997) Biological activity of interleukin-10 in
the central nervous system. Neurochem Int 30:433– 439.
3112 J. Neurosci., May 1, 2001, 21(9):3104–3112 Bachis et al. •IL-10 and Glutamate Toxicity