Mutations in the agouti (ASIP), the extension (MCIR), and the brown (TYRP1) loci and their association to coat color phenotypes in horses (Equus caballus)

Abstract

Coat color genetics, when successfully adapted and applied to different mammalian species, provides a good demonstration of the powerful concept of comparative genetics. Using cross-species techniques, we have cloned, sequenced, and characterized equine melanocortin-1-receptor (MC1R) and agouti-signaling-protein (ASIP), and completed a partial sequence of tyrosinase-related protein 1 (TYRP1).
The coding sequences and parts of the flanking regions of those genes were systematically analyzed in 40 horses and mutations typed in a total of 120 horses. Our panel represented 22 different horse breeds, including 11 different coat colors of Equus caballus. The comparison of a 1721-bp genomic fragment of MC1R among the 11 coat color phenotypes revealed no sequence difference apart from the known chestnut allele (C901T). In particular, no dominant black (E
D) mutation was found.
In a 4994-bp genomic fragment covering the three putative exons, two introns and parts of the 5′- and 3′-UTRs of ASIP, two intronic base substitutions (SNP-A845G and C2374A), a point mutation in the 3′-UTRs (A4734G), and an 11-bp deletion in exon 2 (ADEx2) were detected. The deletion was found to be homozygous and completely associated with horse recessive black coat color (A
a
/A
a
) in 24 black horses out of 9 different breeds from our panel. The frameshift initiated by ADEx2 is believed to alter the regular coding sequence, acting as a loss-of-function ASIP mutation. In TYRP1 a base substitution was detected in exon 2 (C189T), causing a threonine to methionine change of yet unknown function, and an SNP (A1188G) was found in intron 2.

Full text

Mutations in the agouti (ASIP), the extension (MC1R), and the brown
(TYRP1) loci and their association to coat color phenotypes in horses
(Equus caballus)
Stefan Rieder,
1
Sead Taourit,
1
Denis Mariat,
1
Bertrand Langlois,
2
Ge´rard Gue´rin
1
1
Laboratoire de Ge´ne´tique biochimique et de Cytoge´ne´tique, De´partement de Ge´ne´tique animale, INRA Centre de Recherche de Jouy, 78352
Jouy-en-Josas cedex, France
2
Station de Ge´ne´tique quantitative et applique´e, De´partement de Ge´ne´tique animale, INRA Centre de Recherche de Jouy, 78352
Jouy-en-Josas cedex, France
Received: 22 November 2000 / Accepted: 07 February 2001
Abstract. Coat color genetics, when successfully adapted and ap-
plied to different mammalian species, provides a good demonstra-
tion of the powerful concept of comparative genetics. Using cross-
species techniques, we have cloned, sequenced, and characterized
equine melanocortin-1-receptor (MC1R) and agouti-signaling-
protein (ASIP), and completed a partial sequence of tyrosinase-
related protein 1 (TYRP1).
The coding sequences and parts of the flanking regions of
those genes were systematically analyzed in 40 horses and muta-
tions typed in a total of 120 horses. Our panel represented 22
different horse breeds, including 11 different coat colors of Equus
caballus. The comparison of a 1721-bp genomic fragment of
MC1R among the 11 coat color phenotypes revealed no sequence
difference apart from the known chestnut allele (C901T). In par-
ticular, no dominant black (E
D
) mutation was found.
In a 4994-bp genomic fragment covering the three putative
exons, two introns and parts of the 5⬘- and 3⬘-UTRs of ASIP, two
intronic base substitutions (SNP-A845G and C2374A), a point
mutation in the 3⬘-UTRs (A4734G), and an 11-bp deletion in exon
2 (ADEx2) were detected. The deletion was found to be homozy-
gous and completely associated with horse recessive black coat
color (A
a
/A
a
) in 24 black horses out of 9 different breeds from our
panel. The frameshift initiated by ADEx2 is believed to alter the
regular coding sequence, acting as a loss-of-function ASIP muta-
tion. In TYRP1 a base substitution was detected in exon 2 (C189T),
causing a threonine to methionine change of yet unknown func-
tion, and an SNP (A1188G) was found in intron 2.
Introduction
Mammalian coat and skin color seems to be determined by a small
number of genes shared among different species (Jackson et al.
1994; Barsh 1996; Newton et al. 2000). These genes can be clas-
sified into two main groups: those acting on the melanocyte—its
development, differentiation, proliferation, and migration; and
those acting directly on pigment synthesis. Variation in coat and
skin colors is, therefore, likely to be understood as the effect of
modified genes causing changes to either the melanocyte or the
pigment synthesis or its combinations (detailed in Searl 1968;
Eberle 1988).
Melanocortin-1-receptor (MC1R), encoded by the Extension
(E) locus, and its peptide antagonist agouti-signaling-protein
(ASIP), encoded by the Agouti (A) locus, control the relative
amounts of melanin pigments in mammals (Lu et al. 1994; Sir-
acusa, 1994). ASIP acts as an antagonist of MC1R by nullifying
the action of ␣-melanocyte-stimulating hormone (␣-MSH). Loss-
of-function of MC1R results in yellow pigment (pheomelanin),
whereas gain-of-function of MC1R or loss-of-function of ASIP
seems to result in the production of black pigment—eumelanin
(reviewed in Barsh 1996).
Tyrosinase-related protein 1 (TYRP1) coded by the Brown lo-
cus is believed to be a melanosomal membrane protein. Its enzy-
matic function is thought to represent 5,6-dihydroxyindole-2-
carboxylic acid (DHICA) oxidase (Kwon 1993; Jackson et al.
1994; Sturm et al. 1995; Lee et al. 1996). Apart from the original
brown mouse mutation (Zdarsky et al. 1990), alterations in TYRP1
are known to be involved in progressive greying of mice (Johnson
and Jackson 1992; Javerzat and Jackson 1998). In the horse, re-
duced levels of TYRP1 mRNA were found in grey horses com-
pared with solid colored horses (Rieder et al., 2000). TYRP1 is
believed to be involved in the synthesis of an intermediate “choco-
late” melanin, represented in horses of a dark chestnut, liver chest-
nut, silver or seal brown phenotype.
The successful molecular definition of coat color mutations in
different mammals (Jackson 1994; Klungland et al. 1995; Joerg et
al. 1996; Marklund et al. 1996, 1999; Moller et al. 1996; Vage et
al. 1997, 1999; Kijas et al. 1998; Rana et al. 1999; Newton et al.
2000) and the homology among involved genes enhances the gen-
eral concept of comparative genetics between species (Rudolph et
al. 1992; Hayes 1995; Raudsepp et al. 1996; Caetano et al. 1999;
Santschi et al. 1998; Godard et al. 2000), and its application to
color determination in particular.
In Equus caballus, one can roughly distinguish between the
black, bay, chestnut, and chocolate coat color “families” (detailed
in Wagoner 1978; Evans et al. 1990; Adalsteinsson and Thorkels-
son 1991; Sponenberg 1996).
Horse breeds usually display a huge variety of distinct coat
color patterns. Nevertheless, some of them are known for their
particular coat color, indicating homozygozity for this character.
Me´rens and Friesian horses, for example, are thought to be all
black, except for a low frequency of the chestnut allele (E
e
), re-
sulting occasionally in chestnut-colored horses when homozygous.
Solid black is quite a rare coat color in most horse breeds and
seems to be essentially recessive (A
a
/A
a
), although some authors
mention cases of dominant inheritance—E
D
(Dreux 1966; Sponen-
berg and Weise 1997). The mutation leading to the chestnut allele
(E
e
) is a single base substitution in MC1R (Marklund et al. 1996).
In the present study, we report for the first time the complete
coding sequence and the genomic structure of equine MC1R, ASIP,
and TYRP1 loci. We provide molecular evidence for a recessive
segregation of horse black coat color (A
a
) and show that black
horses are homozygous for a deletion in the Agouti locus. We
Correspondence to: G. Guérin; E-mail: guerin@jouy.inra.fr
Mammalian Genome 12, 450–455 (2001).
DOI: 10.1007/s003350020017
© Springer-Verlag New York Inc. 2001
Incorporating
Mouse Genome

reveal mutations in the Extension, the Agouti, and the Brown loci,
and discuss effects of those mutations on bay, dark bay, chestnut,
and dark chestnut phenotypes in horses.
Materials and methods
BAC library and screening.
The INRA horse BAC library (Godard et
al. 1998) served as a primary genetic source to screen for clones containing
MC1R, ASIP and TYRP1 sequences. Screening, clone verification, and
DNA preparation (mini-prep) were performed as described previously
(Godard et al. 2000).
Informative horse coat color panel—breeds and DNA extrac-
tion. Blood or hair samples from 120 horses were collected, and DNA was
extracted according to standard protocols. The panel includes horses of a
total of 22 different breeds representing a range of 11 distinct coat colors
(Table 1). Each horse was either personally known to the authors or in-
formative photos were at their disposal from the breeder or the breeding
organizations. The three BAC clones were included in the panel and served
as sources to establish reference sequences (GenBank accession numbers
AF288357, AF288358, and AF288359, respectively).
A restricted basic working panel (40 animals) included selected horses
of particular coat colors, taking breed and pedigree information into ac-
count. The working panel was used to find sequence differences in the
candidate genes of potential association with coat color phenotypes. The
French national studs (Haras Nationaux; SIRE Pompadour) provided us
further with stud-book information of large half-sib families from their
stallions, segregating for the reported colors. Samples were taken from
private breeding operations and organizations (Association du Cheval de
Castillon; Association Française du Poney Connemara; Association du
Cheval Frison, Haras National Suisse Avenches).
Cross-species PCR amplification. A first primer pair was designed
from either already existing equine sequence data (MC1R—accession num-
ber X98012; unpublished bovine sequence data from INRA, Limoges; and
TYRP1—accession number AF076781) or from bovine and human Gen-
Bank sequence data (ASIP—accession numbers X99691 and L37019).
These primers were used to screen the library and to obtain primary horse
gene sequence fragments. A PCR-walking strategy was then applied by
using equine gene-specific primers, combined with a primer based on
conserved mammalian sequence data. An overview of relevant primers and
their relative position on the different gene sequences is given in Table 3.
To complete the 5⬘-and3⬘-ends of the three loci, the BAC clones were
digested with Sau3AI and subcloned into a pGEM4z dephosphorylated
vector (Promega, Lyons, France). PCR amplification was carried out on
ligation products by using an equine gene-specific primer combined with
the “universal” and “reverse” cloning-vector primers.
PCRs were performed on PTC 100 MJ-Research thermocyclers by
using GoldStar Taq-polymerase from Eurogentec (Seraing, Belgium) or an
Expand High Fidelity PCR system from Boehringer (Ingelheim, Germany).
Cycling followed standard protocols and manufacturer’s instructions
(Table 3).
Sequencing and mutation analysis. PCR fragments were purified with
columns (Qiagen or Millipore), and direct sequencing was performed with
an ABI 377 sequencer (Perkin-Elmer) by using a dye-terminator sequenc-
ing reaction kit. Equine MC1R, ASIP, and TYRP1 sequences visualized
with the “Sequence Analysis” software package (Perkin-Elmer) were
aligned and compared among horses with GCG (Devereux et al. 1984) in
order to detect mutations. Potential mutations were then confirmed by
repeated sequencing of both strands. Later, extended typing of all muta-
tions was either processed with a detection kit from Perkin-Elmer accord-
ing to the manufacturer’s instructions (ABI Prism SnaPshot ddNTP primer
extension kit: Aln1-845G, Aln2-C2374A, AU3-A4734G, ADEx2, TEx2-
C189T, Tln2-A1188G, and MC1R-C901T) or partially performed as PCR-
RFLP (MC1R-C901T with Taql according to Marklund et al. 1996; TEx2-
C189T with RsrII and Tln2-A1188G with NspI). The deletion in ASIP exon
2 (ADEx2) was usually analyzed by a simple PCR amplification and elec-
trophoresis on a 4% agarose gel (for primers see Table 3).
Results
Clones for MC1R, ASIP, and TYRP1 were isolated from the INRA
horse BAC library as reported in Godard et al. (1998, 2000). The
correct content of the clones was confirmed by sequencing of
relevant gene fragments and alignment to GenBank data. A pre-
liminary total sequence of the three genes, based on the BAC
clones, was then established and characterized.
An MC1R fragment of 1721 bp, including the protein coding
sequence (954 bp) and parts of the 5⬘- and 3⬘-UTRs, was system-
atically sequenced and compared among 40 horses of the working
panel (Fig. 1, Table 1). Apart from the chestnut mutation at posi-
tion C901T (Marklund et al. 1996), no other mutation in equine
MC1R was observed. Interestingly, no gain-of-function MC1R mu-
tation, namely, dominant black (E
D
), was detected. A C1140T
Table 1. Horse panel including phenotype information of 120 individual horses and clones from the INRA horse BAC-library. The 40 horses from our restricted working panel
are indicated with an asterisk. Parentheses mark horses of more than one known color phenotype (e.g., black turned grey).
Breed Bay
Dark
Bay Black
Black
& Tan Chestnut
Dark
Chestnut Buckskin Dun Grey Roan White Total
Anglo-Arabian 4 1 1 2 8
Akhal Teke 1* 1
Arabian 1 2 3 (1) 1* 7
Breton 11
Camargue (1) (1) (2) 4/3* 4
Castillon 4* 2* 6* 12
Connemara 1 1* 2
Fjord 1* 1
Franches Montagnes 4* 1* 5
Friesian 6/1* 6
Haflinger 1* 1
Mérens 5* 5
Percheron 5 5
Poney Franc¸ais de Selle 1 1
Poney Suisse de Selle 1* 1
Pura Rac¸a Espan˜ola (1) 2* 2
Przewalski 1* 1
Thouroughbred 6 9 1 16
Selle Franc¸ais 19/2* 3/1* 5 4 31
Trotteur Franc¸ais 2 3 1 1 1 8
Welsh-A (1) 1* 1
Welsh Cob 1* 1
BAC-clone (Poney Franc¸ais) “1” “1”
Total 42 (1) 16 24 (2) 7 16 (4) 9 1 3 7 1 1 120
S. Rieder et al.: MC1R, ASIP, TYRP1 loci and horse coat color phenotypes 451

point mutation, observed only in the BAC clone, remains to be
confirmed on genomic horse DNA.
A 4994-bp sequence of equine ASIP, including the three pu-
tative exons, two introns and parts of the 5⬘- and 3⬘-UTRs, was
established (Fig. 1). Equine-specific primer pairs were set to am-
plify and to sequence systematically the three agouti exons, as well
as parts of the intronic flanking regions. Four mutations, three
SNPs (single nucleotide polymorphism), and a deletion were de-
tected. The first SNP was located in intron 1, 3 bp after exon 1
(A845G, SNP Aln1). A second SNP was detected in intron 2
(C2374A, SNP Aln2), and a third SNP was found in the 3⬘-UTRs,
(A4734G), exactly 50 bp after the regular stop codon—SNP AU3
(Fig. 1). In addition to these SNPs, a deletion of 11 bp in exon 2
(ADEx2) was detected. The position of ADEx2 may vary by 4 bp
owing to the repetitive structure in this part of the gene. We con-
sider it to be between position 2174–2184 on genomic DNA level
or at position 191–201, with regard to the start codon, if only
exonic sequences are taken into account.
The 11-bp deletion in ASIP exon 2 (ADEx2) alters the amino
acid sequence and is believed to extend the regular termination
signal by 210 bp to 612 bp. The frameshift initiated by the deletion
results in a novel modified agouti-signaling-protein. ADEx2 was
completely associated with horse recessive black coat color (A
a
/
A
a
) in all horses typed so far.
In the deleted sequence, SNP-AU3 theoretically becomes part
of the extended exon 3. However, this G-to-A substitution does not
change the amino acid sequence and, therefore, remains a silent
mutation with yet unknown function.
The three agouti SNPs were typed in the horse panel to test for
linkage disequilibrium with the DISLAMB program (Terwilliger
1995) and for haplotype analysis (Schibler et al. 2000). Only one
coat color phenotype (black) and one SNP (AU3; ∼2554bp from
the deletion; Fig. 1) were in disequilibrium (results not shown).
In addition to the TYRP1 gene sequence reported by Rieder et
al. (2000), we completed the coding sequence (1626 bp) and se-
quenced also parts of the 5⬘- and 3⬘-UTRs, as well as intron 2. A
new total fragment of 3327 bp was established (Fig. 1). Intron-
exon junctions were determined according to the human TYRP1
gene structure (Sturm et al. 1995).
Two SNPs were found in equine TYRP1: one in putative exon
2 (C189T) and one in intron 2 (A1188G). The base substitution in
exon 2 results in an amino acid change from threonine to methi-
onine with yet unknown effect. None of the two mutations showed
any obvious association with the coat color phenotypes taken into
account in this study (Table 2).
Discussion
A functional melanocortin-1-receptor (E) is fundamental for eu-
melanin expression. Gain-of-function mutations MC1R (E
D
)or
loss-of-function mutations in the MC1R antagonist ASIP (A
a
) are
believed to enhance this process, resulting in black coat color
phenotypes.
From our panel of 120 horses, only 24 from nine different
breeds were considered to be of a solid black phenotype (Table 1).
Depending on the breed and according to studbook information,
the parents of those 24 black horses were carriers of all basic color
types (black, bay, chestnut). The typing of the 24 solid blacks
subsequently revealed that all were homozygous for the 11-bp
deletion in agouti exon 2 (ADEx2). Apart from one chestnut and
two greys (which were born black), none of the remaining typed 96
non-black horses was found to be homozygous for ADEx2. Thus,
horse black coat color clearly follows a recessive mode of inher-
itance in all horses tested in the present study.
In addition, information taken from a small horse family
helped to confirm the epistatic relationship among grey, chestnut,
bay, and black, such that bay and black are not expressed in the
Fig. 1. Structure of horse MC1R, ASIP, and TYRP1 gene: length, exon-intron junctions and relative position of mutation sites are indicated. Coding portions
of the exons are given in black boxes; introns and UTRs are indicated as lines (relative exon-intron size on figure does not reflect real proportions).
S. Rieder et al.: MC1R, ASIP, TYRP1 loci and horse coat color phenotypes452

presence of chestnut and that grey is always expressed. We typed
a grey Camargue stallion (born bay—E
E
/E
e
− A/A
a
) and a grey
Camargue mare (born chestnut—E
e
/E
e
− A/A
a
). The two had a
male foal, all black at birth. The foal was found heterozygous at
the MC1R locus (E
E
/E
e
) and homozygous at the ASIP locus (A
a
/
A
a
). A full-sister of this black-born foal was chestnut born (E
e
/E
e
)
and did not carry the A
a
-allele at the agouti locus (A/A). Within 2
years time the foals turned grey like their parents.
Loss of the antagonistic agouti protein function inducing an
increased eumelanin synthesis (similar to what was shown by Bult-
man et al. 1992 for the mouse, or by Vage et al. 1997 for the
Standard Silver fox) would be a possible explanation of the role of
the ADEx2 mutation. The data strongly suggest that ADEx2 is the
causal horse recessive black allele (A
a
).
In the absence of a functional proof of the ADEx2 mutation
(e.g., cDNA synthesis, Northern Hybridization), we tried to deter-
mine the equine gene structure of ASIP in the 4994-bp genomic
fragment with three different “exon-trapping” softwares (www.in-
fobiogen.fr; www.genethon.fr). Intron-exon junctions were easily
recognized for putative exons 1 and 2 of both the regular and the
mutated genomic ASIP sequence (4994 bp/4983 bp). Putative exon
3 was only recognized correctly in its “regular and mutated (ex-
tended) form” by “Genie Predictions”. In addition, the total regular
coding sequence derived from the 4994-bp genomic equine ASIP
Table 2. Distribution of genotypes of intraexonic mutations in the MC1R, ASIP, and TYRP1 loci, among different horse
coat colors. Parentheses indicate horses with more than one known color phenotype (e.g., black turned grey). BAC
clones were found E/-; A/- and C/- for the above listed mutations.
Genotype Bay
Dark
Bay Black
Black
& Tan Chestnut
Dark
Chestnut Buckskin Dun Grey Roan White Total
MC1R
E/E 7 9 14 7 – – – 3 1 – – 41
E/E
e
35 (1) 7 10 (2) – – – 1 – 3 – 1 54
E
e
/E
e
–––– 16(4)9 – –31– 25
Total 42 (1) 16 24 (2) 7 16 (4) 9 1 3 7 1 1 120
ASIP
A/A 33 9 – 1 8 (2) 7 – 2 3 – – 61
A/A
a
9 (1) 7 – 6 7 (2) 2 1 1 2 1 1 34
A
a
/A
a
– – 24 (2) – 1 – – – 2 – – 25
Total 42 (1) 16 24 (2) 7 16 (4) 9 1 3 7 1 1 120
TYRP1
(Ex2)
C/C 36 (1) 16 22 (2) 7 13 (4) 7 1 3 7 1 – 106
C/T 62–32––––114
T/T –––– – – – –––––
Total 42 (1) 16 24 (2) 7 16 (4) 9 1 3 7 1 1 120
Table 3. List of primers used in this study. Fragment length is given only for final test products; all other fragment sizes
depend on particular primer combinations. Annealing temperature was set for all primer pairs between 58° and 60°C,
and extension times were usually at 30s for all fragments below 1 kbp; others according to the Taq-polymerase
manufacturer’s instructions.
Primer name Sequence (5⬘–3⬘)
Fragment
length (bp)
Relative position
on sequence
MC1R:
M5p-F1 GTTCCTGGAGGAGGATTAGAAG >–22bp
M5p-F5 ATGAGCTGAGTGGGACGCCTG 597–617
M5p-R1 CATCAGGAATGGACACTTCCAG 759–780
TestMe-F CCTGGAAGTGTCCATTCCTGATG
|
445 758–780
TestMe-R GTAGTAAGCGATGAAGAGGGTGC 1180–1202
M3p-R1 CTGATGTCACCACCTCCCTGTGC 1644–1666
TestSNPMe-F CTTCATCTGCTGCCTGGCCGTGT 888–900
ASIP:
AE1-F1 CTAGGGTCTTCTAGGGCCACTGAC 360–384
AE1-F2 CCCTTGCCCACCTGCCTGACTG 632–653
AE1-R GAGCAAGGAGCTCTGGCCTATG 946–967
AE2-F1 GTCAGCAGCCAGGCTAATGAGAAC 1930–1953
AE2-R CAGCAAACATCAGCTCCCTGAG 2385–2406
TestADEx2-F CTTTTGTCTCTCTTTGAAGCATTG
|
102 2125–2148
TestADEx2-R GAGAAGTCCAAGGCCTACCTTG 2205–2226
AE3-F1 CATAGTCCAAAGAGCTCCCAGG 4425–4446
AE3-R1 AGTACTAGGCAGTCACGCCCGCTA 4764–4787
AE3-R2 GATACAGCGCGTGCGCAGTCCG 4970–4991
TestSNPAln1-R TGAGGCCCCAGGCCAGGCTACT 846–867
TestSNPADEx2-R GAAGATCTCTTCTTCTTTTCTGCT 2181–2204
TestSNPAln2-F CTGGCCTGGAGCCCTGAACCAGA 2351–2373
TestSNPAU3-R TGCGAAGGGCCCTCAGGGTCTC 4735–4756
TYRP1:
TEx2F1 GCTGCAAACCAGAGCCTTGTCC
|
476 −12bp
TEx2R1 GCTTTGAGTCTCTTGCAGGACTG 442–464
Tln2F1 TTCTCAGGGCACAACTGTGGG 344–364
Tln2R1 CCCAAGGAAGGTCTTCTTGACTG 1752–1774
Tln2F2 TGCTGACTCACGAAGACACTTC
|
469 832–853
Tln2R2 CTTACTGTGGATTCTATGATCCTG 1277–1300
TestSNPTEx2-F GAATCCTCTGTCTGGGCCTGGGA 166–188
TestSNPTln2-F CTTAACCACTATGTTTACCACAT 1165–1187
S. Rieder et al.: MC1R, ASIP, TYRP1 loci and horse coat color phenotypes 453

fragment shares a nucleic acid similarity of 88.6%, 86%, 83.1%,
and 87.1% and an amino acid similarity of 84.2%, 80.3%, 79.4%
and 84% with bovine, human, mouse, and fox agouti sequences,
respectively (X99691, X99692, U12770, U12774, U12775,
L06451, L06941, Y09877). These data show that the equine ASIP
gene structure is most probably the same as those of other mam-
malian species.
More extended sequence information, especially of the ASIP
5⬘- and 3⬘-UTRs, compared within characteristic horse color phe-
notypes, might reveal additional mutations not detected in this
study so far (e.g., wild-type, black and tan).
It was quite surprising not to find any equine MC1R polymor-
phism, even in parts of its 5⬘- and 3⬘-UTRs. In contrast to what has
been observed in other mammalian species, we have thus far been
unable to detect a gain-of-function receptor mutation in the horse
MC1R (E
D
). Hence, additional MC1R sequence information might
help to answer the question whether such a horse dominant black
allele exists. Therefore, further studies should include horses with
a well-documented dominant black coat color inheritance. The
recently reported MC1R-allele “ea” (Wagner and Reissmann,
2000) was not observed in our panel.
We could not find any association between the agouti A
a
-allele
status (A/A
a
versus A/A) and “dark” shaded horses (Table 2). From
the 120 horses typed, 34 were heterozygote carriers of the A
a
-
allele. From those, 9 were considered normal bay and 7 dark bay,
as well as 7 normal chestnut and 2 dark chestnut. One normal
chestnut was found homozygous for the A
a
-allele. A loss-of-
function MC1R mutation is expected to be epistatic to a loss-of-
function ASIP allele. Thus, the A
a
/A
a
homozygous chestnut horse
appears to be the same as the original recessive yellow (extension)
mutation of mouse MC1R, which arose on a C57BL6 nonagouti
background (Robbins et al. 1993).
A statistically significant tendency (⌾
2
⳱9.1; p < 0.01) of
lighter bay shades carrying the E
E
/E
e
genotype (35 of 42 bay
horses) and darker bay shades carrying the E
E
/E
E
genotype (9 of
16 dark bay horses) was found in our panel. Thus, lighter bay
shades would be at least partially explained by a dosage effect of
an average 50% less working melanocortin-1-receptor function
due to the E
e
-allele (Table 2). However, this result might be biased
by the structure of our horse panel and presently unknown genetic
variation.
It is known that TYRP1 acts only on the eumelanic pathway.
An association between TYRP1 alleles and the reported chocolate
(“dark chestnut, liver chestnut, silver, seal brown”) coat color fam-
ily would, therefore, be restricted to a non-chestnut background of
the individual horse. Yet, all horses studied with a putative choco-
late phenotype were of chestnut background (i.e., E
e
/E
e
homozy-
gous, Table 2). Therefore, a gene different from TYRP1 must be
involved in the chocolate phenotypes in addition to MC1R.
To conclude, this study makes a general contribution to coat
color genetics and supports the aim to define equine coat colors on
a molecular level. The study demonstrates that, although major
coat color genes seem to remain conserved in different species,
mutations in such genes associated with particular coat colors
might be quite diverse. Moreover, particular coat colors, even if
phenotypically similar in various species, might have completely
different genetic sources.
Acknowledgments. The authors thank the numerous private horse owners,
breeders, Haras Nationaux, and associations for providing blood and hair
samples of their horses for this study. We also appreciate the contributions
of J.C. Me´riaux (GIE LABOGENA, Jouy) for some of the DNA samples;
D. Vaiman (LGBC, INRA Jouy) for scientific discussions and an intro-
duction into haplotype analysis; L. Schibler (LGBC, INRA Jouy) for tech-
nical advice; and R. Julien (Unite´ associe´e INRA, Universite´ de Limoges)
for providing unpublished bovine sequence data. This study was supported
by a grant from the Haras Nationaux. S. Rieder benefited from a one-year
postdoctoral position from INRA, De´partement de Ge´ne´tique animale.
References
Adalsteinsson S, Thorkelsson F (1991) Islenski hesturinn, Litaafbrigdi
(The Icelandic Horse and its Colours). Fe´lagsbokbandid-Bokfell hf;
Islandsmyndir hf.
Barsh GS (1996) The genetics of pigmentation: from fancy genes to com-
plex traits. Trends Genet 12, 299–305
Bultman SJ, Michaud EJ, Woychik RP (1992) Molecular characterization
of the mouse agouti locus. Cell 71, 1195–1204
Caetano AR, Shiue YL, Lyons LA, O’Brien SJ, Laughlin TF et al. (1999)
A comparative gene map of the horse (Equus caballus). Genome Res 9,
1239–1249
Devereux J, Haeberli P, Smithies O (1984) A comprehensive set of se-
quence analysis programs for the VAX. Nucleic Acids Res 1, 387–395
Dreux Ph (1966) Contribution a` l’e´tudeduge`ne E chez le cheval domes-
tique. Extrait Ann Ge´ne´t 9, 168–170
Eberle AN (1988) The Melanotropins. (Basel, Switzerland: Verlag Karger)
Evans WJ, Borton A, Hintz H, Van Vleck LD (1990) The Horse, 2nd ed.
(New York, NY, USA: W.H. Freeman and Co.)
Godard S, Schibler L, Oustry A, Cribiu EP, Gue´rin G (1998) Construction
of a horse BAC library and cytogenetical assignment of 20 type I and
type II markers. Mamm Genome 9, 633–637
Godard S, Vaiman A, Schibler L, Mariat D, Vaiman D et al. (2000)
Cytogenetic localization of 44 new type I sequences in the horse. Mamm
Genome 11, 1093–1097
Hayes H (1995) Chromosome painting with human chromosome-specific
DNA libraries reveals the extent and distribution of conserved segments
in bovine chromosomes. Cytogenet Cell Genet 71, 168–174
Jackson IJ (1994) Molecular and developmental genetics of mouse coat
color. Annu Rev Genet 28, 189–217
Jackson IJ, Budd P, Horn JM, Johnson R, Raymond S, Steel K (1994)
Genetics and molecular biology of mouse pigmentation. Pigment Cell
Res 7, 73–80
Javerzat S, Jackson IJ (1998) White-based brown (Tyrp1
B-w
) is a dominant
mutation causing reduced hair pigmentation owing to a chromosomal
inversion. Mamm Genome 9, 469–471
Joerg H, Fries HR, Meijerink E, Stranzinger GF (1996) Red coat color in
Holstein cattle is associated with a deletion in the MSHR gene. Mamm
Genome 7, 317–318
Johnson R, Jackson IJ (1992) Light is a dominant mouse mutation resulting
in premature cell death. Nat Genet 1, 226–229
Kijas JMH, Wales R, To¨rnsten A, Chardon P, Moller M, Anderson L
(1998) Melanocortin receptor 1 (MC1R) mutations and coat color in
pigs. Genetics 150, 1177–1185
Klungland H, Vage DI, Gomez-Raya L, Adalsteinsson S, Lien S (1995)
The role of melanocyte-stimulating hormone (MSH) receptor in bovine
coat color determination. Mamm Genome 6, 636–639
Kwon BS (1993) Pigmentation genes: the tyrosinase gene family and the
pmel 17 gene family. T J Investig Dermatol 100, 134S–140S
Lee ZH, Hou L, Moellmann G, Kuklinska E, Antol K et al. (1996) Char-
acterization and subcellular localization of human Pmel 17/silver, a 100-
kDa (Pre)melanosomal membrane protein associated with 5,6,-
dihydroxyindole-2-carboxylic acid (DHICA) converting activity. T J
Investig Dermatol 106, 605–610
Lu D, Willard D, Patel IR, Kadwell S, Overton L et al. (1994) Agouti
protein is an antagonist of the melanocyte-stimulating-hormone recep-
tor. Nature 371, 799–802
Marklund S, Moller MJ, Sandberg K, Andersson L (1996) A missense
mutation in the gene for melanocyte-stimulating hormone receptor
(MC1R) is associated with the chestnut coat color in horses. Mamm
Genome 7, 895–899
Marklund S, Moller M, Sandberg K, Anderson L (1999) Close association
between sequence polymorphism in the KIT gene and the roan coat color
in horses. Mamm Genome 10, 283–288
Moller MJ, Chaudhary R, Hellme´n E, Ho¨yheim B, Chowdhary B, Ander-
son L (1996) Pigs with the dominant white coat color phenotype carry a
duplication of the KIT gene encoding the mast/stem cell growth factor
receptor. Mamm Genome 7, 822–830
Newton JM, Wilkie AL, He L, Jordan SA, Metallinos DL et al. (2000)
Melanocortin 1 receptor variation in the domestic dog. Mamm Genome
11, 24–30
Rana BK, Hewett-Emmett D, Jin L, Chang BHJ, Sambuughin N et al.
(1999) High polymorphism at the human melanocortin 1 receptor locus.
Genetics 151, 1547–1557
Raudsepp T, Fro¨nicke L, Scherthan H, Gustavsson I, Chowdhary BP
S. Rieder et al.: MC1R, ASIP, TYRP1 loci and horse coat color phenotypes454

(1996) Zoo-FISH delineates conserved chromosomal segments in horse
and man. Chromosome Res 4, 1–8
Rieder S, Stricker Ch, Joerg H, Dummer R, Stranzinger G (2000) A com-
parative genetic approach for the investigation of aging grey horse mela-
noma. J Anim Breed Genet 117, 73–82
Robbins LS, Nadeau JH, Johnson KR, Kelly MA, Roselli-Rehfuss L et al.
(1993) Pigmentation phenotypes of variant extension locus alleles result
from point mutations that alter MSH receptor function. Cell 72, 827–834
Rudolph JA, Spie SJ, Byrns G, Rojas CV, Bernoco D, Hoffman EP (1992)
Periodic paralysis in Quarter Horses: a sodium channel mutation dis-
seminated by selective breeding. Nat Genet 2, 144–147
Santschi EM, Purdy AK, Valberg SJ, Vrotsos PD, Kaese H, Mickelson JR
(1998) Endothelin receptor B polymorphism associated with lethal white
foal syndrome in horses. Mamm Genome 9, 306–309
Schibler L, Cribiu EP, Oustry-Vaiman A, Furet JP, Vaiman D (2000) Fine
mapping suggests that the goat polled intersex syndrome and the human
blepharophimosis ptosis epicanthus syndrome map to a 100-kb homolo-
gous region. Genome Res 10, 311–318
Searle AG (1968) Comparative Genetics of Coat Colour in Mammals.
(London: Logos Press)
Siracusa LD (1994) The agouti gene: turned on to yellow. Trends Genet 10,
423–428
Sponenberg DP (1996) Equine color genetics. (Ames, Iowa USA: Iowa
State University Press)
Sponenberg DP, Weise MC (1997) Dominant black in horses. Genet Sel
Evol 29, 403–408
Sturm RA, O’Sullivan BJ, Box NF, Smith AG, Smit SE et al. (1995) Chro-
mosomal structure of the human TYRP1 and TYRP2 loci and comparison
of the tyrosinase-related protein gene family. Genomics 29, 24–34
Terwilliger JD (1995) A powerful likelihood method for the analysis of
linkage disequilibrium between trait loci and one or more polymorphic
marker loci. Am J Hum Genet 56, 777–787
Vage DI, Lu DS, Klungland H, Lien S, Adalsteinson S, Cone RD (1997)
A non-epistatic interaction of agouti and extension in the fox, Vulpes
vulpes. Nat Genet 15, 311–315
Vage DI, Klungland H, Lu D, Cone RD (1999) Molecular and pharmaco-
logical characterization of dominant black coat color in sheep. Mamm
Genome 10, 39–43
Wagner HJ, Reissmann M (2000) New polymorphism detected in the horse
MC1R gene. Anim Genet 31, 289–290
Wagoner DM (1978) Equine Genetics and Selection Procedures. (Tyler,
USA: Equine Research Incorporation)
Zdarsky E, Favor J, Jackson IJ (1990) The molecular basis of brown, an old
mouse mutation, and of a revertant to wild-type. Genetics 126, 443–449
S. Rieder et al.: MC1R, ASIP, TYRP1 loci and horse coat color phenotypes 455