Yeast Diversity and Persistence in Botrytis-Affected Wine Fermentations

Abstract

Culture-dependent and -independent methods were used to examine the yeast diversity present in botrytis-affected (“botrytized”)
wine fermentations carried out at high (∼30°C) and ambient (∼20°C) temperatures. Fermentations at both temperatures possessed
similar populations of Saccharomyces, Hanseniaspora, Pichia, Metschnikowia, Kluyveromyces, and Candida species. However, higher populations of non-Saccharomyces yeasts persisted in ambient-temperature fermentations, with Candida and, to a lesser extent, Kluyveromyces species remaining long after the fermentation was dominated by Saccharomyces. In general, denaturing gradient gel electrophoresis profiles of yeast ribosomal DNA or rRNA amplified from the fermentation
samples correlated well with the plating data. The direct molecular methods also revealed a Hanseniaspora osmophila population not identified in the plating analysis. rRNA analysis also indicated a large population (>106 cells per ml) of a nonculturable Candida strain in the high-temperature fermentation. Monoculture analysis of the Candida isolate indicated an extreme fructophilic phenotype and correlated with an increased glucose/fructose ratio in fermentations
containing higher populations of Candida. Analysis of wine fermentation microbial ecology by using both culture-dependent and -independent methods reveals the complexity
of yeast interactions enriched during spontaneous fermentations.

Full text

APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Oct. 2002, p. 4884–4893 Vol. 68, No. 10
0099-2240/02/$04.00⫹0 DOI: 10.1128/AEM.68.10.4884–4893.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Yeast Diversity and Persistence in Botrytis-Affected
Wine Fermentations
David A. Mills,* Eric A. Johannsen, and Luca Cocolin†
Department of Viticulture and Enology, University of California, Davis, California 95616-8749
Received 11 February 2002/Accepted 25 June 2002
Culture-dependent and -independent methods were used to examine the yeast diversity present in botrytis-
affected (“botrytized”) wine fermentations carried out at high (⬃30°C) and ambient (⬃20°C) temperatures.
Fermentations at both temperatures possessed similar populations of Saccharomyces,Hanseniaspora,Pichia,
Metschnikowia,Kluyveromyces, and Candida species. However, higher populations of non-Saccharomyces yeasts
persisted in ambient-temperature fermentations, with Candida and, to a lesser extent, Kluyveromyces species
remaining long after the fermentation was dominated by Saccharomyces. In general, denaturing gradient gel
electrophoresis profiles of yeast ribosomal DNA or rRNA amplified from the fermentation samples correlated
well with the plating data. The direct molecular methods also revealed a Hanseniaspora osmophila population
not identified in the plating analysis. rRNA analysis also indicated a large population (>10
6
cells per ml) of
a nonculturable Candida strain in the high-temperature fermentation. Monoculture analysis of the Candida
isolate indicated an extreme fructophilic phenotype and correlated with an increased glucose/fructose ratio in
fermentations containing higher populations of Candida. Analysis of wine fermentation microbial ecology by
using both culture-dependent and -independent methods reveals the complexity of yeast interactions enriched
during spontaneous fermentations.
Numerous studies have examined the succession of yeasts
and bacteria that occurs during the fermentation of nonsterile
musts (15, 16). In general, yeasts predominate during the al-
coholic fermentation, where the low pH and nutritional con-
tent of the juice select for yeast growth. Several aspects of the
microbial ecology present in wine fermentations warrant in-
vestigation. Foremost is the fact that indigenous non-Saccha-
romyces yeasts and indigenous bacteria are potential causes of
stuck and sluggish wine fermentations (3). Winemakers often
increase this possibility by seeking to reduce the overall
amount of the sulfur dioxide (SO
2
) used in winemaking, which
is employed, in part, to eliminate indigenous microbial popu-
lations. In addition, there has been a renewed interest in de-
fining the microbial dynamics of spontaneous (uninoculated)
fermentations in order to better understand and control fer-
mentation behavior and its subsequent impact on wine flavor
(13). Recently several groups have examined various non-Sac-
charomyces yeasts as potential adjuncts (or alternatives) to
Saccharomyces cerevisiae in an effort to modify wine flavor and
improve product quality (23, 24, 36).
A diverse population of yeasts, including species of Hanse-
niaspora (anamorph Kloeckera), Metschnikowia,Candida,
Pichia, and Kluveromyces, are often present in the initial stages
of most wine fermentations (16). These non-Saccharomyces
yeasts typically grow for several days before the fermentation is
dominated by one or more S. cerevisiae strains and a concur-
rent increase in ethanol concentration occurs (4). Candida and
Hanseniaspora species have been shown to persist throughout
wine fermentations, albeit at a lower level than S. cerevisiae
strains (26, 27). Growth or persistence of individual yeast spe-
cies within wine fermentations is most likely determined by
differential sensitivities to temperature, ethanol, and sulfur
dioxide as well as a number of other factors (15). Lower fer-
mentation temperatures (between 10 and 20°C) have been
shown to encourage growth and/or persistence of Kloeckera
and Candida species (25), most likely due to increased ethanol
tolerance of these yeasts at lower temperatures (20). Recently,
Kloeckera and Candida were shown to possess growth rates
comparable to that of S. cerevisiae at lower temperatures
(10°C) (7).
Sweet white wines are commonly made from grapes infected
with Botrytis cinerea (noble rot). Infection of the grape with B.
cinerea results in concentration of grape sugar, which gives
must from botrytis-affected (“botrytized”) grapes a character-
istically high initial sugar content. Relatively few studies have
examined the microbial diversity within botrytis-affected wine
fermentations. Most have noticed a significant increase in
weakly fermentative yeast (such as Kloeckera and Candida spe-
cies) and acetic acid bacterial populations compared to those
in fermentations of non-botrytis-affected musts (12, 18, 28).
During the fermentation of botrytis-affected musts, the indig-
enous bacteria and non-Saccharomyces yeast populations de-
crease as Saccharomyces species dominate (18, 28). By their
nature sweet wines possess residual sugar, and thus fermenta-
tions are prematurely stopped, often by judicious use of SO
2
.
Recently the production of gluconic acid, 5-oxofructose, and
dihydroxyacetone by the acetic acid bacteria in botrytis-af-
fected musts was shown to reduce the effective concentration
of SO
2
, making these wines more difficult to stabilize against
further microbial growth (2).
Relatively few studies have employed direct (culture-inde-
pendent) methods for determination of viable yeast and bac-
* Corresponding author. Mailing address: Department of Viticul-
ture and Enology, University of California, Davis, One Shields Ave.,
Davis, CA 95616-8749. Phone: (530) 754-7821. Fax: (530) 752-0382.
E-mail: damills@ucdavis.edu.
† Present address: Department of Food Science, University of
Udine, 33100 Udine, Italy.
4884

terial populations. Most have developed PCR or probe tech-
niques to directly assay wine samples for specific bacterial or
yeast populations (21, 37, 38). Millet and Lonvaud-Funel (31)
employed epifluorescence to directly identify viable but non-
culturable bacterial populations in wine. Given that persistence
of metabolically active but nonculturable populations of yeasts
in wine fermentations may affect fermentation performance
(as well as final product flavor), a better understanding of these
populations is critical. We have previously developed methods
for direct analysis of yeasts present in wine fermentations by
using denaturing gradient gel electrophoresis (DGGE) of ri-
bosomal DNA (rDNA) amplicons (10, 11). In this work both
culture-dependent (plating) and culture-independent (PCR-
DGGE and reverse transcription-PCR [RT-PCR]–DGGE)
methods were employed in order to characterize the impact of
temperature on the yeast diversity in commercial sweet white
wine fermentations.
MATERIALS AND METHODS
Wine fermentations. Dolce wine fermentations (Dolce Winery, Oakville, Cal-
if.) were carried out with 1999 Napa Valley Semillon grape juice. Grapes were
spray inoculated with a stock B. cinerea strain (anamorph of Botryotinia fuckeli-
ana) approximately 35 days prior to harvest. Vino Super liquid pectinase (DSM
Food Specialties, Delft, The Netherlands) at 34 ml/ton and Color Pre (Scott
Labs, Petaluma, Calif.) at 73 ml/ton were added to the press pan. After pressing,
the juice was clarified with polyvinyl polypyrrolidone (International Specialty
Products, Wayne, N.J.) at 0.25 lb/1,000 gal and Bentonite (Great Western Chem-
icals, Bakersfield, Calif.) at 8 lb/1,000 gal. The juice was treated with 300 mg of
lysozyme (Scott Labs) per liter and potassium metabisulfite to achieve 94 mg of
SO
2
per liter. A total of 3.3 g of tartaric acid per liter was added to adjust the pH.
The pH and titratable acidity of the juice after pressing were 3.57 and 6.3 g/liter,
respectively. Dolce fermentations were carried out by indigenous yeasts in four
new French oak barrels (Seguin-Moreau Cooperage, Napa, Calif.). Two of the
barrels were held at ambient cellar temperature (approximately 18°C). Two
barrels were radiantly heated until the temperature of the fermenting juice
reached 28°C. Samples were aseptically removed from each barrel immediately
following batonage. One milliliter of each sample, in duplicate, was centrifuged
at 2,000 ⫻gfor 5 min, washed in 1 ml of 4°C water, recentrifuged at 2,000 ⫻g
for 5 min, and frozen at ⫺50°C for later PCR-DGGE analysis. Cell pellets used
for RT-PCR–DGGE analysis were immersed in 300 ␮l of RNAlater (Ambion
Inc., Austin, Tex.) prior to freezing. One milliliter of each sample was sterile
filtered through a 0.45-␮m-pore-size Millex-HV filter (Millipore S.A., Molsheim,
France) and frozen at ⫺50°C for later high-pressure liquid chromatography
(HPLC) analysis. Aseptic measurements of wine temperature, air temperature,
and densitometric soluble solids were performed daily on one barrel from each
treatment.
Monoculture fermentations of S. cerevisiae and Candida sp. strain EJ1 were
carried out in 250 ml of Chardonnay juice which was sterile filtered through a
0.45-␮m-pore-size Millex-HV filter. Fermentations were initiated with a 0.1%
inoculation. One-milliliter samples were removed daily, sterile filtered through a
0.45-␮m-pore-size Millex-HV filter, and frozen at ⫺20°C for later analysis.
Microbiological characterization. Samples were plated in duplicate on Waller-
stein laboratory nutrient agar (WLN) and lysine medium agar (LM) (Difco
Laboratories, Detroit, Mich.). Colony morphotypes were differentiated visually
as described previously (6) and counted. Several isolates (n⫽6 to 8) of each
colony morphotype were saved at 4°C for sequence analysis and to serve as
DGGE controls.
Nucleic acid extraction. For the DNA preparation, the cell pellet samples were
resuspended in 1 ml of an 8-g/liter NaCl solution and transferred to a micro-
centrifuge tube containing 0.3 g of 0.5-mm-diameter glass beads (BioSpec Prod-
ucts Inc., Bartlesville, Okla.). The cell-bead mixture was centrifuged at 11,600 ⫻
gfor 10 min at 4°C, and the supernatant was discarded. The cell-bead mixture
was resuspended in 300 ␮l of breaking buffer (2% Triton X-100, 1% sodium
dodecyl sulfate, 100 mM NaCl, 10 mM Tris [pH 8], 1 mM EDTA [pH 8]) and 300
␮l of phenol-chloroform-isoamyl alcohol (50:48:2). The cells were then homog-
enized in a bead beater instrument (Fast Prep; Bio 101, Vista, Calif.) three times
for 45 s each at a speed setting of 4.5. The mixture was then centrifuged at 11,600
⫻gfor 10 min at 4°C, and the aqueous phase was removed to another micro-
centrifuge tube. The DNA was then further purified by using the DNeasy Plant
minikit (Qiagen, Valencia, Calif.) according to the manufacturer’s instructions.
RNA was extracted by using the Concert Plant RNA reagent (Invitrogen,
Carlsbad, Calif.). The cell pellet was resuspended in 500 ␮l of the reagent and
vortexed at maximum speed for 30 s. After 5 min at room temperature, the
suspension was centrifuged at 11,600 ⫻gfor 2 min and the supernatant was
transferred to a new microcentrifuge tube. One hundred microliters of 5 M NaCl
and 300 ␮l of chloroform were added, vortexed, and centrifuged at 11,600 ⫻gfor
10 min at 4°C, and the aqueous phase was removed to another microcentrifuge
tube. RNA was precipitated with 500 ␮l of isopropanol and centrifugation at
11,600 ⫻gfor 10 min at 4°C. The RNA pellet was rinsed with 70% ice-cold
ethanol, dried under vacuum at room temperature, and resuspended in 50 ␮lof
RNase-free water. RNA samples were treated with RNase-free DNase (Roche
Diagnostics, Indianapolis, Ind.) at 37°C for a minimum of1htoremove coex-
tracted DNA.
PCR amplification. For colony morphotype identification, the D1-D2 region
of the 26S rRNA gene was amplified by PCR with primer NL1 (5⬘-CGCCCGC
CGCGCGCGGCGGGCGGGGCGGGGGCCATATCAATAAGCGGAGGA
AAAG-3⬘) (the GC clamp sequence is underlined) and the reverse primer NL4
(5⬘-GGTCCGTGTTTCAAGACGG-3⬘) (29). Colony PCR was performed in a
final volume of 100 ␮l containing 10 ␮lof10⫻PCR buffer (Promega Corp.,
Madison, Wis.); 1.5 mM MgCl
2
; 0.1 mM (each) dATP, dCTP, dGTP, and dTTP;
0.1 mM primers; 1.25 U of Taq DNA polymerase (Promega); and approximately
1 mg of whole yeast cells. The reactions were run for 30 cycles; denaturation was
at 95°C for 60 s, annealing was at 52°C for 45 s, and extension was at 72°C for
60 s. An initial 5-min denaturation at 95°C and a final 7-min extension at 72°C
were used. For DGGE analysis of fermentation samples, primers NL1 and LS2
(5⬘-ATTCCCAAACAACTCGACTC-3⬘) (10) were used for PCR amplification.
PCR was performed in a final volume of 50 ␮l containing 5 ␮l of PCR buffer; 2.0
mM MgCl
2
; 0.2 mM (each) dATP, dCTP, dGTP, and dTTP; 0.2 mM primers,
1.25 U of Taq DNA polymerase (Promega); and 2 ␮l of the extracted DNA
(approximately 20 ng). The reactions were run for 30 cycles; denaturation was at
95°C for 60 s, annealing was at 52°C for 45 s, and extension was at 72°C for 60 s.
An initial 5-min denaturation at 95°C and a final 7-min extension at 72°C were
used. RT-PCR was performed with RevertAid Moloney murine leukemia virus
reverse transcriptase (Promega). One microliter of total RNA (approximately 0.1
␮g) was mixed in 10 ␮l of DNase- and RNase-free sterile water containing 0.5 ␮g
of primer LS2 and incubated at 70°C for 5 min. Immediately after chilling in ice,
a mixture of 25 mM Tris-HCl (pH 8.3), 25 mM KCl, 2 mM MgCl
2
,5mM
dithiothreitol,a1mMconcentration of each deoxynucleoside triphosphate, and
20 U of RNase inhibitor (Roche) was transferred in the reaction tube. After 5
min at 37°C,1␮l of reverse transcriptase was added, followed by incubation at
42°C for 60 min and treatment at 70°C for 10 min to stop the reaction. Three
microliters of the synthesized cDNA was used for the PCR as described previ-
ously. Products were analyzed by standard agarose gel electrophoresis (1),
stained with 0.5 ␮g of ethidium bromide per ml, visualized under UV transillu-
mination, and photographed with a Multimage light cabinet (Alpha Innotech
Corporation, San Leandro, Calif.).
DGGE analysis. The DCode universal mutation detection system (Bio-Rad,
Hercules, Calif.) was used for sequence-specific separation of PCR products and
for the comparison of migrations of isolate PCR products. PCR samples were
applied directly onto 8% (wt/vol) polyacrylamide gels in a running buffer con-
taining 40 mM Tris-acetate–2mMNa
2
EDTA 䡠H
2
O (pH 8.5) (TAE) and a
denaturing gradient from 20 to 60% of urea and formamide. The electrophoresis
was performed at a constant voltage of 120 V for 6 h with a constant temperature
of 60°C. After electrophoresis, the gels were stained in 1.25⫻TAE containing
SYBR Gold (reconstituted according to the directions of the manufacturer
[Molecular Probes, Eugene, Oreg.]) and photographed under UV trans-
illumination. Bands of interest were excised directly from the gels by using a
sterile blade, mixed with 40 ␮l of water, and incubated overnight at 4°C. Two
microliters of this solution was used to reamplify the PCR product with the
NL1-LS2 primer pair (11).
RNA hybridization. A probe specifictoCandida sp. strain EJ1 was generated
by amplifying a portion of the D2 region of the 26S rDNA gene with the universal
primer NL1 (29) and a primer, C1 (5⬘-TACCGCATTTATCTTCCCCC-3⬘), in-
ternal to the 26S rRNA D1 loop of Candida sp. strain EJ1 (L. Cocolin and D. A.
Mills, submitted for publication). DNA was amplified in a 50-␮lfinal volume
containing 10 mM Tris-HCl (pH 8), 50 mM KCl, 1.5 mM MgCl
2
, 0.2 mM
deoxynucleoside triphosphates, 0.2 ␮M primers, 1.25 U of Taq polymerase (Pro-
mega), and 5 ␮l of extracted Candida sp. strain EJ1 DNA (about 10 to 50 ng of
total DNA). The PCR cycle parameters were 30 cycles of denaturation at 95°C
for 1 min, annealing at 60°C for 45 s, and extension at 72°C for 1 min. An initial
denaturation at 95°C for 5 min and a final extension at 72°C for 7 min were also
VOL. 68, 2002 YEAST ECOLOGY IN BOTRYTIZED WINE FERMENTATIONS 4885

used. The amplified product (156 bp) was labeled by incorporating digoxigenin-
UTP (Roche) into the PCR mixture as described by the manufacturer.
A total of 1 ␮g of RNA purified from select fermentation samples was applied
to Zeta-probe GT membranes (Bio-Rad) by using a BioDot slot blot apparatus
(Bio-Rad) as indicated by the manufacturer. Hybridization and detection were
performed by using a digoxigenin chemiluminescence kit (Roche) as indicated by
the manufacturer. Control RNA samples were purified from active cultures of S.
cerevisiae and Candida sp. strain EJ1.
Sequence analysis. The PCR products from the colony PCR of the isolates
were purified by using a Wizard PCR purification kit (Promega) and then sent to
a commercial sequencing facility (Davis Sequencing, Davis, Calif.) for sequenc-
ing. Reamplified DGGE bands were similarly purified and sequenced. Sequence
compilation and comparison were performed by use of Genetics Computer
Group sequence analysis software with the BLAST program.
HPLC analysis. The samples and standards were run on a Hewlett-Packard
1100 series instrument with a cation H guard column, two 30-cm Aminex HPX-
87H columns (Bio-Rad), and a Hewlett-Packard 1047A refractive index detector.
The column was eluted with 1.5 mM sulfuric acid at a flow rate of 0.6 ml/min and
a column temperature of 50°C. An external standard solution at three dilution
levels was used. The variabilities in the fructose and glucose assays were 2.1 and
2.2%, respectively.
Nucleotide sequence accession number. The partial 26S rDNA sequence of
Candida sp. strain EJ1 was deposited in GenBank under accession number
AY078348.
RESULTS
Fermentation characteristics. There were distinct differ-
ences in fermentation characteristics for the treatments at am-
bient and heated temperatures (Fig. 1 and 2, respectively). Day
0 represents the day that the wine was put into barrels. The
relatively small change in wine temperature (5°C) in the am-
bient-temperature treatment throughout the fermentation
contrasted with the large change in wine temperature (15°C) in
the heated treatment. The rates of sugar consumption, ethanol
production, and glycerol production were higher in the heated
fermentations than in the ambient-temperature fermentations
(Fig. 1 and 2). The average maximum rate of glucose and
fructose consumption was 41 g/liter/day for the heated treat-
ment versus 21 g/liter/day for the ambient-temperature treat-
ment. The average maximum rate of ethanol production in the
heated treatment was 19 g/liter/day, versus 8 g/liter/day in the
ambient-temperature treatment, and the average maximum
production rate of glycerol was 2.6 g/liter/day in the heated
treatment versus 0.7 g/liter/day in the ambient-temperature
treatment. Minimal differences in acetic acid formation were
noted between treatments. In contrast, the relative proportions
of glucose and fructose varied between the ambient-tempera-
ture and heated fermentations. At the beginning of both fer-
mentations, the glucose/fructose ratio was 0.92, and during the
maximum rate of fermentation, it approached 1.00. After 21
days, the glucose/fructose ratio in the ambient-temperature
barrels was an average of 0.91, while, in the heated barrels, it
was 0.71.
Yeast population dynamics. In both treatments, six distin-
guishable yeast isolates were identified on WLN medium (6).
Partial 26S rDNA sequence analysis (29) of representative
FIG. 1. Yeast, chemical, and temperature profiles for the Dolce
fermentation carried out at ambient temperature. Fermentations were
carried out in duplicate barrels, and a representative data set is shown.
FIG. 2. Yeast, chemical, and temperature profiles for the Dolce
fermentation carried out at high temperature. Fermentations were
carried out in duplicate barrels, and a representative data set is shown.
4886 MILLS ET AL. APPL.ENVIRON.MICROBIOL.

isolates indicates the six morphotypes to be S. cerevisiae,Han-
seniaspora uvarum,Pichia kluyveri,Metschnikowia pulcherrima,
Kluyveromyces thermotolerans, and a Candida strain (herein
called Candida sp. strain EJ1) which could not be assigned to
a known species. In the early stages of the fermentations WLN
medium was used for enumeration of the six morphotypes.
However, as the fermentation progressed, lower populations of
non-Saccharomyces species became increasingly difficult to
enumerate in the presence of a high population of Saccharo-
myces. Therefore, at later stages in the fermentation LM (30)
was also employed, starting at day 12 in the ambient-temper-
ature treatment and day 8 in the heated treatment. Only two
colony morphotypes were observed on LM at these latter
stages. Representative isolates were restreaked on WLN me-
dium. The resultant morphologies on WLN medium were
shown to be consistent with Candida sp. strain EJ1 and K.
thermotolerans isolates.
The CFU plating results indicate some common trends
among the two treatments. In all four barrels only six promi-
nent morphotypes were identified. Moreover, within each
treatment the six morphotypes reached the same approximate
maximum CFU population. Several prominent differences
were also observed in the plating results obtained for the two
treatments (Fig. 1 and 2). As expected, Saccharomyces popu-
lations reached a maximum density of 10
7
CFU per ml faster in
the heated treatment (5 days) than in the ambient-temperature
treatment (7 days). In addition, non-Saccharomyces yeasts per-
sisted far longer in the ambient-temperature barrel fermenta-
tions than in the heated barrel fermentations. In the ambient-
temperature treatment Candida populations remained quite
high, around 10
7
CFU per ml, for much of the fermentation
(21 days) and for nearly 18 days after establishment of an equal
population of Saccharomyces. A significant drop in the Can-
dida sp. was observed only near the end of the ambient-tem-
perature fermentation, as the ethanol concentration pro-
gressed above 100 g/liter. Like Candida,Kluyveromyces
populations persisted throughout the ambient-temperature
fermentation, although they did so at a lower level (fewer than
10
6
CFU/ml) and dropped consistently around 3 days after the
establishment of a dominant Saccharomyces population and as
the ethanol concentration progressed above 60 g/liter. Several
other non-Saccharomyces yeasts present in the initial stages of
the ambient-temperature fermentation did not persist
throughout the fermentation, including Pichia (present for ⬃6
days), Hanseniaspora (present for ⬃8 days), and Metschnikowia
(present for ⬃10 days) spp.
The heat treatment had a significant impact on the non-
Saccharomyces yeasts, with most populations becoming unde-
tectable on plating medium earlier than in the ambient-tem-
perature treatment. On WLN medium, the non-Saccharomyces
yeasts ceased to appear after approximately 7 days with Pichia
observed for only 2 days, Hanseniaspora for 5 days, Metschni-
kowia for 5 days, Candida for 6 days, and Kluyveromyces for 7
days. After day 7, significantly lower populations of Kluyvero-
myces and Candida were detected on LM throughout the re-
mainder of the fermentation. With the exception of Pichia,
which was eliminated earlier, the non-Saccharomyces popula-
tions in the heated fermentation rapidly decreased once a peak
temperature of 30°C was achieved and the ethanol concentra-
tion progressed above 50 g/liter.
PCR and RT-PCR–DGGE profiles. The results obtained
from DGGE analysis of the ambient- and high-temperature
fermentations are shown in Fig. 3 and 4, respectively. Both the
RT-PCR and PCR-DGGE profiles of the yeast populations
roughly mirror the CFU data. DGGE bands were identified by
comigration with PCR products generated from isolated
strains and by direct DNA sequencing of DGGE bands. Sev-
eral common trends were observed in the DGGE profiles.
First, the DGGE patterns clearly demonstrate the longer per-
sistence of non-Saccharomyces yeasts in the ambient-tempera-
ture fermentation than in the heated fermentation. Second, as
yeast populations fell below ⬃10
4
CFU/ml, the cognate DGGE
bands became faint or disappeared. This threshold is likely the
result of a larger quantity of Saccharomyces DNA in these
samples outcompeting the smaller amounts of template from
the non-Saccharomyces yeasts for amplification of the rDNA
(14).
Several populations of yeasts were readily observed in the
DGGE profiles from day 1, including H. uvarum,Hansenia-
spora osmophila,Candida sp. strain EJ1, and K. thermotolerans.
A band corresponding to M. pulcherrima was not seen in
DGGE gels even though the population was above 10
5
CFU/
ml. This is likely due to poor amplification of M. pulcherrima
DNA with the NL1-LS2 primer set (data not shown). In addi-
tion, no DGGE bands corresponding to Pichia species were
revealed, most likely due to the relatively low number of CFU
present. A band corresponding to H. osmophila was identified
even though H. osmophila was not revealed in the plating
analysis. Thus, the DGGE results indicated a mixed Hanse-
niaspora population consisting of a minimum of two species
that were not differentiated on the WLN medium.
As the fermentations progressed, a band corresponding to S.
cerevisiae became visible at day 3 of the heated-fermentation
profile (Fig. 4) and day 5 (Fig. 3) of the ambient-temperature
profile, corresponding to populations of Saccharomyces in each
fermentation of between 10
4
and 10
5
CFU/ml. PCR-DGGE
and RT-PCR–DGGE profiles clearly show Candida species
persisting throughout both fermentations. Candida popula-
tions identified within previous Dolce vintages appear as a
characteristic DGGE doublet (11). It remains to be deter-
mined if this doublet is the result of a PCR artifact or indicates
the presence of more than one strain of Candida within Dolce
fermentations. Unlike the situation with other non-Saccharo-
myces yeasts, Candida bands were visible in both RT-PCR and
PCR-DGGE profiles after CFU population levels had dropped
below 10
4
CFU/ml. This was particularly obvious in the heated
trial, where CFU populations of 10
2
to 10
3
CFU/ml resulted in
clear DGGE bands.
Both PCR-DGGE and RT-PCR–DGGE profiles indicate K.
thermotolerans populations persisting throughout the ambient-
temperature fermentation and nearly disappearing as the pop-
ulation fell below 10
4
CFU/ml. The cognate K. thermotolerans
DGGE bands in the heated fermentation disappeared rapidly
after the fermentation temperature reached 30°C and after the
population fell below 10
4
CFU/ml. Surprisingly, the PCR and
RT-PCR–DGGE results differed in persistence of Hansenia-
spora bands. In the ambient-temperature fermentation (Fig.
3), H. osmophila bands were present in the RT-PCR–DGGE
sample for 21 days, while the PCR-DGGE profile indicated
VOL. 68, 2002 YEAST ECOLOGY IN BOTRYTIZED WINE FERMENTATIONS 4887

only an H. osmophila band for 11 days. Similarly, in the high-
temperature fermentation (Fig. 4), the RT-PCR results failed
to reveal an H. uvarum population in the first 4 days of the
fermentation, whereas the PCR-DGGE profile clearly demon-
strated an H. uvarum presence.
A viable but nonculturable Candida population? One expla-
nation for the persistence of a visible DGGE band emanating
from a Candida population of below 10
4
CFU/ml was that a
higher population of viable but nonculturable cells existed. To
examine this, a specific probe was designed to the Candida sp.
strain EJ1 26S rDNA sequence and used semiquantitatively in
rRNA slot blot analysis. As seen in Fig. 5, RNA purified from
heated fermentation samples taken on days 12, 14, 15, and 45
revealed a strong presence of Candida sp. strain EJ1 rRNA at
a level higher than predicted by the CFU analysis. As a com-
parison, RNA isolated from 10
6
Candida sp. strain EJ1 cells
(determined by number of CFU) was probed, resulting in a less
intense signal. These results suggest that a metabolically active
population of Candida sp. strain EJ1 persists throughout the
Dolce fermentation at a substantially higher level than can be
revealed by plating analysis.
Candida sp. strain EJ1 is extremely fructophilic. Examina-
tion of the final fructose concentrations present in the heated
and ambient-temperature fermentations suggested that the
persistence of non-Saccharomyces yeasts, particularly a high
population of Candida sp. strain EJ1, resulted in a lowering of
the final fructose concentration and a higher glucose/fructose
ratio. Separate monoculture fermentations of the Candida sp.
strain EJ1 in sterile Chardonnay juice revealed an extremely
fructophilic phenotype (Fig. 6), in which no glucose was con-
sumed even after the fructose was completely exhausted. In
contrast, monoculture fermentations of the S. cerevisiae strain
FIG. 3. DGGE analysis of 26S rDNA (PCR) or rRNA (RT-PCR) products obtained directly from the samples taken from the Dolce
fermentation carried out at ambient temperature. Lane designations indicate the time of fermentation sampling (days). Bands marked with an
asterisk were excised, reamplified, sequenced, and identified by sequence analysis. Abbreviations: H.u., H. uvarum; H.o., H. osmophila; K.t., K.
thermotolerans; C., Candida sp. strain EJ1; S.c., S. cerevisiae.
4888 MILLS ET AL. APPL.ENVIRON.MICROBIOL.

isolated from the Dolce fermentations exhibited a clear gluco-
philic phenotype.
Yeast diversity in inoculated Dolce fermentations. Dolce
fermentations are also carried out with an S. cerevisiae starter
culture inoculum. Given the strong presence of non-Saccharo-
myces yeasts in the uninoculated fermentations carried out at
ambient temperatures, we predicted that a similar persistence
of non-Saccharomyces yeasts would exist in the inoculated fer-
mentations. Figure 7 shows a PCR-DGGE profile of select
samples taken from an inoculated barrel during the 1999 Dolce
fermentation. A strong DGGE band corresponding to Saccha-
romyces is visible early in the fermentation, as would be ex-
pected given the inoculation. DGGE bands corresponding to
Hanseniaspora,Kluveromyces, and Candida populations are
also observed until day 5, day 7, and day 12, respectively. The
persistence of Candida and Kluveromyces populations in inoc-
ulated Dolce fermentations mirrors the situation in uninocu-
lated fermentations, suggesting that a large initial population
of Saccharomyces does not dramatically alter the fundamental
yeast dynamics present within these fermentations.
DISCUSSION
The presence of non-Saccharomyces yeasts in wine fermen-
tations has been documented extensively (15, 35). The non-
Saccharomyces yeasts most often associated with wine fermen-
tations are Hanseniaspora and Candida species and, to a lesser
extent, Pichia,Kluveromyces, and Metschnikowia species,
among others (17). These yeasts may affect wine fermentations
both directly, through production of off-flavors, and indirectly
FIG. 4. DGGE analysis of 26S rDNA (PCR) or rRNA (RT-PCR) products obtained directly from the samples taken from the Dolce
fermentation carried out at high temperature. Lane designations indicate the time of fermentation sampling (days). Bands marked with an asterisk
were excised, reamplified, sequenced, and identified by sequence analysis. Abbreviations: H.u., H. uvarum; H.o., H. osmophila; K.t., K. thermo-
tolerans; C., Candida sp. strain EJ1; S.c., S. cerevisiae.
VOL. 68, 2002 YEAST ECOLOGY IN BOTRYTIZED WINE FERMENTATIONS 4889

by modulating the growth or metabolism of the dominant Sac-
charomyces population (4). Significant growth of non-Saccha-
romyces yeasts early in fermentations has been associated with
off-character production in wines and/or stuck and sluggish
fermentations (3).
Previous analysis of Dolce fermentations indicated a rich
diversity of yeasts present in the initial stages of the fermen-
tations (A. Heisey, personal communication). Prior PCR-
DGGE analysis revealed the persistence of a Candida popu-
lation throughout the fermentations (11). In this work both
direct molecular and indirect plating methods were employed
to characterize the diversity within ambient-temperature
(⬃20°C) and transiently heated (⬃30°C) Dolce fermentations.
In both trials similar arrays of yeast genera were observed.
Saccharomyces,Hanseniaspora,Pichia,Metschnikowia,
Kluyveromyces, and Candida species were present at similar
levels in the initial stages of both fermentations. While the
initial population size of Candida was high (10
6
to 10
7
CFU/
ml) for both fermentations, it was similar to those of non-
Saccharomyces yeast populations observed in other botrytis-
affected wine fermentations (18). As expected, Saccharomyces
dominated both ambient-temperature and heated fermenta-
tions. Moreover, Candida and Kluyveromyces populations grew
slightly and persisted at detectable levels throughout both fer-
mentations. C. stellata and K. thermotolerans have been ob-
FIG. 5. RNA slot blot with a Candida sp. strain EJ1-specific probe. (A) RNA samples extracted directly from samples taken from the Dolce
fermentation carried out at high temperature. Lane designations indicate the day of fermentation sampling and the S. cerevisiae RNA and blank
controls. One microgram of total RNA was blotted onto the membrane. (B) Serial dilutions of Candida sp. strain EJ1 RNA. Lane designations
indicate the amount of total RNA blotted onto the membrane. (C) Total RNA purified from serial dilutions of active Candida sp. strain EJ1 cells.
Lane designations indicate the total number of cells from which RNA was extracted.
FIG. 6. Glucose and fructose consumption curves for fermenta-
tions of S. cerevisiae and Candida sp. strain EJ1 in sterile Chardonnay
juice.
FIG. 7. DGGE analysis of 26S rDNA (PCR) products obtained
directly from the samples taken from the Dolce fermentation inocu-
lated with an S. cerevisiae starter culture. Lane designations indicate
the time of fermentation sampling (days). Abbreviations: H.u., H.
uvarum; K.t., K. thermotolerans; C., Candida sp. strain EJ1; S.c., S.
cerevisiae.
4890 MILLS ET AL. APPL.ENVIRON.MICROBIOL.

served to persist in a similar fashion in some Majorcan wine
fermentations (32). Given the strong persistence of the non-
Saccharomyces yeasts in the uninoculated Dolce fermentation,
it is not surprising to find a similar persistence within inocu-
lated fermentations (Fig. 7).
This work clearly demonstrates the impact that fermen-
tation temperature has on growth of non-Saccharomyces
yeasts. In the heated fermentations, most non-Saccharomy-
ces populations disappeared dramatically as assessed by
both direct molecular and CFU plating analyses. The most
obvious explanation for the decrease in non-Saccharomyces
yeasts in the heated trials is the combination of higher
temperatures and ethanol (5). Alternatively, the non-Sac-
charomyces yeasts might not have been able to adapt as
quickly to the more rapid increase in ethanol concentration
in the heated fermentations compared to a more gradual
ethanol production witnessed in the ambient-temperature
trial. Regardless, the detrimental effect of temperature and
ethanol is illustrated by a comparison of the persistence of
Candida populations in both trials. In the heated barrels the
Candida CFU population decreased dramatically as the
temperature of the fermenting juice reached ⬃30°C and as
the ethanol concentration rose above 50 g/liter. In the am-
bient-temperature trial, a high Candida CFU population
persisted for 21 days, during which the juice temperature
never rose significantly above 20°C. In that fermentation,
Candida species survived ethanol concentrations of approx-
imately 100 g/liter before a significant decline in the number
of CFU occurred. This result agrees with previous studies
that demonstrated an increased tolerance of ethanol by
Candida strains at lower fermentation temperatures (20).
Other studies on temperature effects on non-Saccharomyces
yeasts demonstrated no significant growth rate differences
between various strains of Kloeckera (Hanseniaspora), Can-
dida, and Saccharomyces species (7). However, during the
Dolce fermentations, none of the non-Saccharomyces yeast
populations, in either trial, increased in population size by
more than an order of magnitude (as determined by CFU
per milliliter). Thus, a transient temperature increase in the
heated fermentations may have affected non-Saccharomyces
yeast persistence rather than growth.
The extremely fructophilic nature of Candida sp. strain
EJ1 suggests an additional rationale for copersistence of a
Candida population with a larger Saccharomyces population
in Dolce fermentations. A fructophilic Candida population
would not have an impact on glucose levels consumed by a
glucophilic S. cerevisiae population and therefore would not
compete for substrate. An expected outcome of this appar-
ent neutralism is a greater total consumption of fructose.
This is evident in the ambient-temperature Dolce fermen-
tation, where persistence of a higher Candida population
correlated with consumption of additional fructose com-
pared to those in the heated fermentation (Fig. 1 and 2). As
the heated fermentation reached ethanol concentrations of
100 g/liter, the glucose/fructose ratio was approximately
0.71, while, at the same ethanol concentration, the ambient-
temperature fermentations exhibited a much closer glucose/
fructose ratio (⬃0.9). Ciani and Ferraro (8) demonstrated
that mixed fermentations containing C. stellata and Saccha-
romyces exhibited more complete utilization of sugars and
postulated that the cause was the preferential utilization of
fructose by highly fructophilic C. stellata species. Mainte-
nance of an optimum glucose/fructose ratio has been sug-
gested as a cause of reduced fermentative activity in Sac-
charomyces (19). By selectively consuming fructose in the
Dolce fermentation, the Candida population may act in a
commensal fashion, aiding the overall fermentative capacity
of S. cerevisiae by increasing the glucose/fructose ratio.
Whether or not this potential commensalism exists, the dif-
ferences in sugar utilization between Candida and Saccha-
romyces species illustrate a complementing aspect of indig-
enous yeasts that are enriched to populate uninoculated
wine fermentations.
Several groups have examined Candida species as potential
adjuncts for flavor modification of wine (8, 36). Others have
noted significant glycerol and acetic acid production by C.
stellata when examined in monoculture (9, 36). In this work,
the persistence of Candida populations in the ambient-temper-
ature fermentations did not coincide with increased glycerol
concentrations (Fig. 2 and 3). As both heated and ambient-
temperature fermentations reached ethanol concentrations of
100 g/liter, the glycerol concentration was around 16 g/liter.
Glycerol was produced more rapidly in heated fermentations;
however, that increase coincided with a similarly rapid produc-
tion of ethanol, suggesting that Saccharomyces was the produc-
ing microorganism. Neither heated nor ambient-temperature
fermentations exhibited a dramatic difference in acetic acid
concentrations.
Direct molecular methods are now a commonly used tool
for ecological analysis, revealing the tremendous diversity of
uncultured microorganisms in various habitats (33). To
date, however, relatively few studies have employed such
methods to characterize the microbial ecology of food and
wine fermentations (22). In this study, the use of PCR-
DGGE in combination with plating analysis revealed the
strengths and weaknesses of the two approaches. For exam-
ple, PCR-DGGE analysis revealed an additional Hansenias-
pora population, H. osmophila, in the Dolce fermentations
which went unnoticed in the CFU analysis. This omission
was likely due to a color morphology similar to that of H.
uvarum on WLN medium (both have green colonies). Inter-
estingly, RT-PCR–DGGE analysis suggests that an active H.
osmophila population of greater than ⬃10
4
cells per ml (the
approximate PCR-DGGE detection limit in the presence of
a higher Saccharomyces population [10]) was present
throughout most of the ambient-temperature fermentation.
RT-PCR–DGGE analysis did not detect an H. uvarum pop-
ulation, although a slight band could be detected in the
PCR-DGGE analysis. The lack of an observable H. uvarum
band in the RT-PCR–DGGE gel may be a result of a copy
number effect, whereby the increased amount of competing
yeast template rRNA in the RNA samples effectively
masked an observable H. uvarum band. Neither Hansenias-
pora population (H. osmophila or H. uvarum) was detected
by CFU analysis in the later stages of either the ambient-
temperature or heated fermentations, although a lower H.
osmophila population may have been obscured in the CFU
and DGGE analysis by the higher Candida population.
VOL. 68, 2002 YEAST ECOLOGY IN BOTRYTIZED WINE FERMENTATIONS 4891

Direct analysis also demonstrated the persistence of a
Candida population in the heated fermentation even though
CFU analysis indicated a population level below the PCR-
DGGE detection threshold. This contrasted with the situa-
tion with the Kluveromyces population, which disappeared
from the DGGE analysis at approximately the same time
that the population fell below 10
4
CFU per ml (compare Fig.
2 and 4). Specific detection of the Candida population by
RNA hybridization confirmed the existence of a Candida
population of greater than 10
6
cells per ml. Previously, Mil-
let and Lonvaud-Funel used direct epifluorescence micros-
copy on aging wines and observed a dramatically higher
bacterial population than was revealed by plating analysis
(31). This work suggests a similar situation with indigenous
yeasts in the Dolce fermentation. However, it remains to be
determined if the direct RNA analysis has revealed a met-
abolically active Candida population or a metabolically in-
active Candida population in which the cellular RNA was
protected from degradation (or both).
Certain deficiencies with PCR-DGGE methodology were
also revealed in this work. Detection of a Metschnikowia
population was not possible even though the CFU popula-
tion determined in the initial stages of either fermentation
appeared to be above the detection threshold for PCR-
DGGE. Amplification of the 26S rDNAs from Metschni-
kowia isolates obtained in this study often resulted in poor
yields (data not shown), which could have resulted in an
omission of Metschnikowia in DGGE profiles of fermenta-
tion samples. Previous analysis of an M. pulcherrima isolate
by DGGE indicated a single resolved band (10). However,
recent work by Pallman et al. (34) demonstrated a diverse
number of M. pulcherrima biotypes within a single commer-
cial wine fermentation. Thus, variability within the 26S
rRNA D1-D2 region may result in poor amplification of
Metschnikowia rDNA by the NL1-LS2 primer pair used in
this study.
ACKNOWLEDGMENTS
We acknowledge Julie Schrieber for assistance with the HPLC anal-
ysis and Dirk Hampson and Ashley Heisey for assistance with the
fermentations.
This work was funded in part by Dolce Winery, the American Vine-
yard Foundation, and the California Competitive Grants Program for
Research in Enology and Viticulture.
REFERENCES
1. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A.
Smith, and K. Struhl. 1995. Current protocols in molecular biology. Wiley,
New York, N.Y.
2. Barbe, J. C., G. de Revel, A. Joyeux, A. Bertrand, and A. Lonvaud-Funel.
2001. Role of botrytized grape micro-organisms in SO2 binding phenomena.
J. Appl. Microbiol. 90:34–42.
3. Bisson, L. F. 1999. Stuck and sluggish fermentations. Am. J. Enol. Vitic.
50:107–119.
4. Bisson, L. F., and R. E. Kunkee. 1993. Microbial interactions during wine
production, p. 37–68. In J. G. Zeikus and E. A. Johnson (ed.), Mixed cultures
in biotechnology. McGraw-Hill, New York, N.Y.
5. Casey, G. P., and W. M. Ingledew. 1986. Ethanol tolerance in yeasts. Crit.
Rev. Microbiol. 13:219–280.
6. Cavazza, A., M. S. Grando, and C. Zini. 1992. Rilevazione della flora mi-
crobica di mosti e vini. Vignevini 9:17–20.
7. Charoenchai, C., G. H. Fleet, and P. A. Henschke. 1998. Effects of temper-
ature, pH, and sugar concentration on the growth rates and cell biomass of
wine yeasts. Am. J. Enol. Vitic. 49:283–288.
8. Ciani, M., and L. Ferraro. 1998. Combined use of immobilized Candida
stellata cells and Saccharomyces cerevisiae to improve the quality of wines.
J. Appl. Microbiol. 85:247–254.
9. Ciani, M., L. Ferraro, and F. Fatichenti. 2000. Influence of glycerol produc-
tion on the aerobic and anaerobic growth of the wine yeast Candida stellata.
Enzyme Microb. Technol. 27:698–703.
10. Cocolin, L., L. F. Bisson, and D. A. Mills. 2000. Direct profiling of the yeast
dynamics in wine fermentations. FEMS Microbiol. Lett. 189:81–87.
11. Cocolin, L., A. Heisey, and D. A. Mills. 2001. Direct identification of the
indigenous yeasts in commercial wine fermentations. Am. J. Enol. Vitic.
52:49–53.
12. Doneche, B. J. 1993. Botrytized wines, p. 327–351. In G. H. Fleet (ed.), Wine
microbiology and biotechnology. Harwood Academic Publishers, Philadel-
phia, Pa.
13. Egli, C. M., W. D. Edinger, C. M. Mitrakul, and T. Henick-Kling. 1998.
Dynamics of indigenous and inoculated yeast populations and their effect on
the sensory character of Riesling and Chardonnay wines. J. Appl. Microbiol.
85:779–789.
14. Felske, A., A. D. L. Akkermans, and W. M. DeVos. 1998. Quantification of
16S rRNAs in complex bacterial communities by multiple competitive re-
verse transcription-PCR in temperature gradient gel electrophoresis finger-
prints. Appl. Environ. Microbiol. 64:4581–4587.
15. Fleet, G. H. 1997. Food fermentations—wine, p. 671–694. In M. P. Doyle,
L. R. Beuchat, and T. J. Montville (ed.), Food microbiology: fundamentals
and frontiers. ASM Press, Washington, D.C.
16. Fleet, G. H. 1998. The microbiology of alcoholic beverages, p. 217–262. In
B. J. B. Wood (ed.), Microbiology of fermented foods, 2nd ed., vol. 1. Blackie
Academic & Professional, New York, N.Y.
17. Fleet, G. H., and G. M. Heard. 1993. Yeasts—growth during fermentation, p.
27–54. In G. H. Fleet (ed.), Wine microbiology and biotechnology. Harwood
Academic Publishers, Philadelphia, Pa.
18. Fleet, G. H., S. Lafon-Lafourcade, and P. Ribereau-Gayon. 1984. Evolution
of yeasts and lactic acid bacteria during fermentation and storage of Bor-
deaux wines. Appl. Environ. Microbiol. 48:1034–1038.
19. Gafner, J., and M. Schultz. 1996. Impact of glucose-fructose ratio on stuck
fermentations: practical experiences to restart stuck fermentations. Vitic.
Enol. Sci. 51:214–218.
20. Gao, C., and G. H. Fleet. 1988. The effects of temperature and pH on the
ethanol tolerance of the wine yeasts, Saccharomyces cerevisiae,Candida stel-
lata and Kloeckera apiculata. J. Appl. Bacteriol. 65:405–410.
21. Gindreau, E., E. Walling, and A. Lonvaud-Funel. 2001. Direct polymerase
chain reaction detection of ropy Pediococcus damnosus strains in wine.
J. Appl. Microbiol. 90:535–542.
22. Giraffa, G., and E. Neviani. 2001. DNA-based, culture-independent strate-
gies for evaluating microbial communities in food-associated ecosystems. Int.
J. Food Microbiol. 67:19–34.
23. Hansen, E. H., P. Nissen, P. Sommer, J. C. Nielsen, and N. Arneborg. 2001.
The effect of oxygen on the survival of non-Saccharomyces yeasts during
mixed culture fermentations of grape juice with Saccharomyces cerevisiae.
J. Appl. Microbiol. 91:541–547.
24. Heard, G. 1999. Novel yeasts in winemaking—looking to the future. Food
Aust. 51:347–352.
25. Heard, G. M., and G. H. Fleet. 1988. The effects of temperature and pH on
the growth of yeast species during the fermentation of grape juice. J. Appl.
Bacteriol. 65:23–28.
26. Heard, G. M., and G. H. Fleet. 1985. Growth of natural yeast flora during
fermentation of inoculated wines. Appl. Environ. Microbiol. 50:727–728.
27. Heard, G. M., and G. H. Fleet. 1986. Occurrence and growth of yeast species
during the fermentation of some Australian wines. Food Technol. Aust.
38:22–25.
28. Joyeux, A., S. Lafon-Lafourcade, and P. Ribe´reau-Gayon. 1984. Evolution of
acetic acid bacteria during fermentation and storage of wine. Appl. Environ.
Microbiol. 48:153–156.
29. Kurtzman, C. P., and C. J. Robnett. 1998. Identification and phylogeny of
ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal
DNA partial sequences. Antonie Leeuwenhoek 73:331–371.
30. Martin, C., and K. Siebert. 1992. Evaluation of multinitrogen source media
for wild yeast detection in brewing culture yeast. Am. Soc. Brewing Chem. J.
50:134–138.
31. Millet, V., and A. Lonvaud-Funel. 2000. The viable but non-culturable
state of wine micro-organisms during storage. Lett. Appl. Microbiol.
30:136–141.
32. Mora, J., J. I. Barbas, and A. Mulet. 1990. Growth of yeast microflora during
the early stages of the fermentation in inoculated Majorcan musts. Micro-
biologia 6:65–70.
33. Pace, N. R. 1997. A molecular view of microbial diversity and the biosphere.
Science 276:734–740.
34. Pallman, C., J. B. Brown, T. L. Olineka, L. Cocolin, D. A. Mills, and L. F.
Bisson. 2001. Use of WL medium to profile native flora fermentations.
Am. J. Vitic. Enol. 52:198–203.
35. Pretorius, I. S., T. J. van der Westhuizen, and O. P. H. Augustyn. 1999. Yeast
4892 MILLS ET AL. APPL.ENVIRON.MICROBIOL.

biodiversity in vineyards and wineries and its importance to the South Afri-
can wine industry. S. Afr. J. Enol. Vitic. 20:61–74.
36. Soden, A., I. L. Francis, H. Oakey, and P. A. Henschke. 2000. Effects of
co-fermentation with Candida stellata and Saccharomyces cerevisiae on the
aroma and composition of Chardonnay wine. Aust. J. Grape Wine Res.
6:21–30.
37. Sohier, D., and A. Lonvaud-Funel. 1998. Rapid and sensitive in situ hybrid-
ization method for detecting and identifying lactic acid bacteria in wine.
Food Microbiol. 15:391–397.
38. Stender, H., C. Kurtzman, J. J. Hyldig-Nielsen, D. Sorensen, A. Broomer, K.
Oliveira, H. Perry-O’Keefe, A. Sage, B. Young, and J. Coull. 2001. Identifi-
cation of Dekkera bruxellensis (Brettanomyces) from wine by fluorescence in
situ hybridization using peptide nucleic acid probes. Appl. Environ. Micro-
biol. 67:938–941.
VOL. 68, 2002 YEAST ECOLOGY IN BOTRYTIZED WINE FERMENTATIONS 4893