CaT1 Contributes to the Stores-operated Calcium Current in Jurkat T-lymphocytes

Abstract

T-lymphocyte activation requires sustained Ca(2+) signaling dependent upon capacitative Ca(2+) entry (CCE). The protein(s) that forms the stores-operated Ca(2+) channel (SOCC) responsible for CCE has long been sought but has not been definitively identified. Members of the TRPV family (transient receptor potential superfamily-vanilloid receptor subfamily) of channel genes have been proposed to encode SOCCs responsible for CCE in non-excitable cells. Here we present evidence that a member of the TRPV group, CaT1, is involved in generating I(CRAC), the CCE current that is necessary for T-cell activation. CaT1 is expressed in Jurkat T-lymphocytes. When overexpressed in Jurkat cells, CaT1 produces a Ca(2+) entry current that mimics the endogenous I(CRAC) in its dependence on external Ca(2+), inactivation by elevated concentration of internal Ca(2+), and pharmacological block by capsaicin. Overexpressed CaT1 is partially regulated by the release of internal Ca(2+) stores via thapsigargin or receptor-mediated generation of inositol 1,4,5-trisphosphate. A pore-region mutant of CaT1, TRIA-CaT1, fails to carry Ca(2+) currents and associates with co-expressed wild type CaT1 to functionally suppress permeation of Ca(2+) ions. Expression of the TRIA-CaT1 mutant in Jurkat cells results in suppression of the endogenous I(CRAC). Taken together these results indicate that CaT1 is the channel protein that contributes to T-lymphocyte SOCCs either alone or as a subunit in a heterogeneous channel complex.

Full text

CaT1 Contributes to the Stores-operated Calcium Current in Jurkat
T-lymphocytes*
Received for publication, June 12, 2002, and in revised form, September 27, 2002
Published, JBC Papers in Press, October 1, 2002, DOI 10.1074/jbc.M205870200
Jie Cui‡, Jin-Song Bian, Anna Kagan, and Thomas V. McDonald§
From the Departments of Medicine and Molecular Pharmacology, Albert Einstein College of Medicine,
Bronx, New York 10461
T-lymphocyte activation requires sustained Ca
2ⴙ
sig-
naling dependent upon capacitative Ca
2ⴙ
entry (CCE).
The protein(s) that forms the stores-operated Ca
2ⴙ
chan-
nel (SOCC) responsible for CCE has long been sought
but has not been definitively identified. Members of the
TRPV family (transient receptor potential superfamily-
vanilloid receptor subfamily) of channel genes have
been proposed to encode SOCCs responsible for CCE in
non-excitable cells. Here we present evidence that a
member of the TRPV group, CaT1, is involved in gener-
ating I
CRAC
, the CCE current that is necessary for T-cell
activation. CaT1 is expressed in Jurkat T-lymphocytes.
When overexpressed in Jurkat cells, CaT1 produces a
Ca
2ⴙ
entry current that mimics the endogenous I
CRAC
in
its dependence on external Ca
2ⴙ
, inactivation by ele-
vated concentration of internal Ca
2ⴙ
, and pharmacolog-
ical block by capsaicin. Overexpressed CaT1 is partially
regulated by the release of internal Ca
2ⴙ
stores via thap-
sigargin or receptor-mediated generation of inositol
1,4,5-trisphosphate. A pore-region mutant of CaT1,
TRIA-CaT1, fails to carry Ca
2ⴙ
currents and associates
with co-expressed wild type CaT1 to functionally sup-
press permeation of Ca
2ⴙ
ions. Expression of the TRIA-
CaT1 mutant in Jurkat cells results in suppression of
the endogenous I
CRAC
. Taken together these results in-
dicate that CaT1 is the channel protein that contributes
to T-lymphocyte SOCCs either alone or as a subunit in a
heterogeneous channel complex.
Capacitative calcium entry (CCE)
1
via stores-operated cal-
cium channels (SOCCs) is a basic mechanism for sustained
Ca
2⫹
signaling in a variety of cells (1–3). CCE is activated by
depletion of Ca
2⫹
from internal Ca
2⫹
storage sites (endoplas-
mic reticulum (ER)) after activation of G-protein-coupled recep-
tors or tyrosine kinase-based receptors, that stimulate phos-
pholipase C
␤
or
␥
. Phospholipase C subsequently hydrolyzes
membrane phospholipids to release inositol 1,4,5-trisphos-
phate (IP
3
) that binds to the IP
3
receptor located on the Ca
2⫹
storage sites stimulating rapid release of Ca
2⫹
to the cyto-
plasm. When the concentration of Ca
2⫹
declines in the lumen of
the ER, a signal is transmitted to SOCCs on the cell surface
persuading them to open and allow external Ca
2⫹
ions to enter
the cell (4). The ionic current carried by Ca
2⫹
entering through
SOCCs in several cell types has been termed the Ca
2⫹
release-
activated current (I
CRAC
) (5) or the depletion-activated current
(6).
The electrophysiological properties of the I
CRAC
have been
studied in a variety of cell lines (7). There are several defining
features of the I
CRAC
as follows: high selectivity for Ca
2⫹
; a very
small single channel conductance in the presence of divalent
cations; large Na
⫹
permeability in the absence of divalent
cations; [Ca
2⫹
]
i
-dependent inactivation; and permeation or
block by divalent cations (5, 6, 8 –14).
One cell type where I
CRAC
has been well studied and where
the biological function is well established is the T-lymphocyte
(2). The biophysical properties, pharmacology, and regulation
of I
CRAC
in the T-lymphocyte model cell, Jurkat cell, have been
investigated by several groups (6, 8 –11, 13, 15–17). In Jurkat
cells, I
CRAC
is induced by stores-depletion via stimulation of the
T-cell antigen receptor. The role of I
CRAC
in T-lymphocytes is to
sustain calcium signaling and oscillation after immune activa-
tion. The sustained calcium signal leads to proliferation and a
program of altered gene expression by allowing translocation of
the transcription factor NFAT to the nucleus at a critical point
in T-lymphocyte activation (18 –20).
The identity of I
CRAC
proteins, however, has lagged behind
advances in physiology due to lack of high affinity ligands or
blockers and because most commonly used systems for heter-
ologous expression exhibit some endogenous CCE. Until re-
cently the best candidates for I
CRAC
have been proteins of the
TRP family (21, 22). Members in TRPC subfamily had been
shown to gate in response to the state of Ca
2⫹
stores (22–25);
however, in each case complete recapitulation of classical I
CRAC
was lacking (26). Two newer members of the TRPV group (27),
ECaC1 and CaT1, have been described with characteristics
similar to endogenous I
CRAC
(28 –30). Clapham and co-workers
(31) performed an in depth electrophysiological analysis of
heterologously expressed CaT1 that gave further support for it
as a credible molecular candidate for I
CRAC
. A report from
Nilius and co-workers (32), however, provided evidence that
the pore property of CaT1 differed from endogenous I
CRAC
in
RBL cells. More recently, it was reported that despite the
difference in permeation properties of CRAC and CaT1, CaT1
was capable of forming store-depletion activated conductances
when heterologously expressed in RBL mast cells (33).
Clapham and co-workers (31) reported that they detected CaT1
by RT-PCR in Jurkat cells (31). In this study we further de-
* This work was supported by a Cancer Research Institute Clinical
Investigator award (to T. V. M.). The costs of publication of this article
were defrayed in part by the payment of page charges. This article must
therefore be hereby marked “advertisement” in accordance with 18
U.S.C. Section 1734 solely to indicate this fact.
‡ Present address: Center for Molecular Cardiology, Dept. of Medi-
cine, Columbia University College of Physicians and Surgeons, New
York, NY 10032.
§ To whom correspondence should be addressed: Depts. of Medicine
and Molecular Pharmacology, Albert Einstein College of Medicine, 1300
Morris Park Ave., Bronx, NY 10461. Tel.: 718-430-3370; Fax: 718-430-
8989; E-mail: mcdonald@aecom.yu.edu.
1
The abbreviations used are: CCE, capacitative calcium entry;
SOCC, stores-operated calcium channel; I
CRAC
, calcium release-acti-
vated calcium current; TG, thapsigargin; IP
3
, inositol 1,4,5-trisphos-
phate; ER, endoplasmic reticulum; GAPDH, glyceraldehyde-3-phos-
phate dehydrogenase; PBS, phosphate-buffered saline; CHO, Chinese
hamster ovary; RT, reverse transcriptase; DVF, divalent-free; GFP,
green fluorescent protein.
THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 277, No. 49, Issue of December 6, pp. 47175–47183, 2002
© 2002 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A.
This paper is available on line at http://www.jbc.org 47175
by guest on February 9, 2017http://www.jbc.org/Downloaded from

scribe the expression of CaT1 in Jurkat cells and provide evi-
dence for its functional contribution to T-lymphocyte I
CRAC
.
MATERIALS AND METHODS
Cloning of CaT1 from Human Placenta—The human CaT1 was
cloned by RT-PCR using total RNA from human adult placenta (Strat-
agene). The forward primer for PCR begins at the start codon of CaT1
cDNA (5⬘- GGGAATTCATGGGTTTGTCACTGCCC), and the reverse
primer starts with the stop codon of CaT1 (5⬘-CCGCTCGAGTCA-
GATCTGATATTCCCAGC). PCR primers introduced unique EcoRI and
XhoI sites that were used for subcloning products into the expression
vector pCMV-Tag3A (Stratagene) that provides an N-terminal c-Myc
epitope tag and into the vector p3xFLAG (Sigma) to provide an N-
terminal FLAG epitope. TRIA-CaT1 was constructed by an overlap
extension PCR strategy (34). The mutated KpnI/XhoI fragment was
subcloned into myc-CaT1 vector described as above. All PCR fragments
were verified by DNA sequence analyses.
Northern Analysis—Northern blot was carried out using the North-
ernMax system (Ambion). 10
␮
g of total RNA from Jurkat cells was
electrophoresed in formaldehyde-agarose gel and transferred to nylon
membrane. The membrane was probed with
32
P-labeled CaT1 cDNA
fragment (1392–1719), hybridized at 42 °C overnight, washed with low
stringency buffer 2 times for 5 min at room temperature, and then
washed with high stringency buffer 2 times for 15 min at 65 °C. Auto-
radiography was performed at ⫺80 °C for 3 days.
RT-PCR and Real Time PCR—The expression of CaT1 mRNA in
Jurkat cells, HEK cells, CHO cells, spleen, and placenta was investi-
gated by RT-PCR. cDNA was constructed from the total RNA of pla-
centa and the cell lines using CaT1-specific primers. Primers for CaT1-
(1907–2178) are as follows: forward, 5⬘-GGCAAGATCTCAACCGGCC-
AGC, and reverse 5⬘- CCGCTCGAGTCAGATCTGATATTCCCAGC;
primers for CaT1-(861–1130) are as follows: forward, 5⬘-GGATGAGC-
AGTCCCTGCTGG, and reverse, 5⬘-GATATCGTCCTTAGGGGTCATG.
ECaC1 primers are as follows: forward, 5⬘-GGGTTGAGAACCACAAT-
GATC, and reverse, 5⬘-GGTAGACCTCCTCTCCATCCC. GAPDH prim-
ers are as follows: forward, 5⬘-TCACCATCTTCCAGGAGCG, and re-
verse, 5⬘-CTGCTTCACCACCTTCTTGA. After an initial step for 5 min
at 94 °C, amplification was performed for 5 cycles at 94 °C for 45 s;
43 °C for 1 min; 72 °C for 1.5 min followed by 30 cycles at 94 °C for 45 s;
48 °C for 1 min, and 72 °C for 1.5 min. Samples were analyzed on a 1.2%
ethidium bromide-stained agarose gel.
Quantitative detection of CaT1 in Jurkat cell was carried out by real
time PCR using iCycler Thermal Cycler (Bio-Rad). PCRs were per-
formed using gene-specific primers in 15-
␮
l volumes. 7.5
␮
l of SYBR
Green PCR Master Mix (Applied Biosystems), 1.5
␮
lof5
␮
MCaT1
primers (forward, 5⬘-GGATGAGCAGTCCCTGCTG; reverse, 5⬘-
GTACGGCCGCCCGTACCG), and 4.5
␮
l of 1:10 diluted first-strand
cDNA were well mixed into the 96-well 200-
␮
l Thin Wall PCR Plates
(Bio-Rad). Data were analyzed by iCycler
TM
optical system interface
(version 2.3). All the samples were triplicates and were repeated twice.
GAPDH primers were used as internal control to normalize the expres-
sion of genes. The gene expression was presented as fold change com-
pared with the control sample.
Cell Culture and Transfection—CHO cells were maintained in Ham’s
F-12 media supplemented with 10% fetal calf serum and penicillin/
streptomycin at 37 °C under 5% CO
2
. Gene transfer was performed
using 5
␮
g of Qiagen Midiprep purified plasmid cDNA. Cells were
electroporated in a 2-mm gap cuvette using BTX ECM 620 setting at
200 V, 72 ohms, and 1800 microfarads in 400
␮
l of cytomix media (35).
Cells were studied 24 –72 h after transfection. A plasmid containing the
cDNA for GFP was combined with CaT1 plasmids (in a ratio of 1:5
GFP/CaT1) for identification of transfected cells as described previously
(34). In co-transfection experiments, current amplitudes were normal-
ized each day to a group of cells transfected with CaT1 alone to control
for day-to-day variations in transfection efficiency.
Jurkat cells were maintained in RPMI 1640 media supplemented
with 10% fetal calf serum and antibiotics at 37 °C, 5% CO
2
.2⫻10
7
cells
in cytomix media were co-transfected by electroporation at 175 V, 72
ohms, and 1800 microfarads. 4 h after transfection, 1
␮
g/ml PHA-P and
50 ng/ml phorbol 12-myristate 13-acetate were added to enhance ex-
pression of introduced genes.
Electrophysiology—Whole cell patch clamp membrane currents were
recorded as described previously (8, 36). The external solution con-
tained 2 mMCaCl
2
, 145 mMNaCl, 10 mMCsCl, 1 mMMgCl
2
,10mM
glucose, and 10 mMHEPES (pH 7.4, osmolality, 320 mM). When we
needed external solutions that were nominally Ca
2⫹
-free, we substi-
tuted MgCl
2
for CaCl
2
. Completely divalent-free (DVF) solution con-
tained 115 mMNaCl, 10 mMHEPES, pH 7.4, 10 mMsodium EDTA, and
10 mMglucose. Pipette solution contained 140 mMCs-aspartate, 2 mM
Mg-ATP, 1 mMMgCl
2
,10mMEGTA, and 10 mMCs-HEPES (pH 7.2,
osmolality, 290 nM). All experiments and solutions were performed at
room temperature. Voltage clamp protocols using a holding potential of
0 mV and successive steps from ⫺120 to 50 mV (in 20-mV increments)
for 350 ms were used to generate current-voltage relationships. Voltage
clamp ramps were generated from a holding potential of 0 mV and
ramped between ⫺100 and 50 mV over 300 ms.
Immunoblot Analysis—CHO or HEK cells were transiently trans-
fected with 1
␮
g of cDNA plasmids using LipofectAMINE 2000 (Invitro-
gen) according to the manufacturer’s instruction. Cells were harvested
24 h after transfection for Western blot analysis. Proteins were sepa-
rated by SDS-PAGE on a 10% gel. Anti-Myc A-14 polyclonal antibody
was used for detection of myc-tagged CaT1 proteins.
For co-association of wild type and mutant CaT1 cells were deter-
gent-lysed in NDET (150 mMNaCl, 25 mMTris-HCl, pH 7.5, 5 mM
EDTA, 1% Nonidet P-40, 0.4% deoxycholic acid, EDTA-free protease
inhibitor mixture tablets (Roche Molecular Biochemicals)). Cell lysates
were incubated with 30
␮
l of rabbit polyclonal anti-Myc antibody and
protein G-agarose. Precipitated proteins were then eluted with SDS-
PAGE sample buffer, separated by SDS-PAGE, and transferred to
nitrocellulose for immunoblotting with appropriate antibodies.
Immunofluorescence—HEK293 were transiently transfected with
wild type CaT1 or TRIA-CaT1. 48 h after transfection, culture media
were removed, and cells were fixed with 4% paraformaldehyde for 20
min, rinsed once with PBS, and permeabilized with 0.3% Triton X-100
in PBS for 10 min. After washing with PBS, cells were blocked with 5%
bovine serum albumin in PBS for 30 min. Cells were incubated with
anti-Myc 9E10 monoclonal antibody in PBS containing 0.1% Nonidet
P-40 for1hatroom temperature. A goat anti-mouse Alexa Fluor
FIG.1.Expression of CaT1 transcript in Jurkat cells. A, North-
ern analysis of CaT1 in Jurkat cells. A single band of ⬃3kbwas
detected in Jurkat total RNA using a probe spanning the conserved pore
region and sixth transmembrane segment of CaT1. B, RT-PCR exami-
nation of CaT1 in Jurkat cells using specific probe sets for CaT1 and
ECaC1. The amplified GAPDH fragment verifies the integrity and
loading of the cDNA samples. C, comparison of mRNA abundance of
CaT1 in Jurkat cells and placenta by quantitative PCR. The relative
abundance was calculated by normalizing the cDNA copy with the
internal control GAPDH in each sample. Data shown are mean values
in two different experiments normalized with cDNA copy in placenta. D,
quantitative PCR of CaT1 from placenta and Jurkat cell RNA.
CaT1 Is Necessary for T-cell I
CRAC
47176
by guest on February 9, 2017http://www.jbc.org/Downloaded from

488-conjugated secondary antibody was added at 1:500 dilution for 1 h
in the dark. Images were captured using confocal microscopy (Bio-Rad,
Radiance 2000) and analyzed by Adobe Photoshop.
Measurement of [Ca
2⫹
]
i
—8⫻10
5
Jurkat cells were co-transfected
with 2
␮
g of cDNA plasmids and 0.5
␮
g of GFP using LipofectAMINE
2000 in 24-well plate. 24 h after transfection, cells were loaded at 37 °C
for 15 min with 2
␮
Mfura-2/AM-ester in culture medium and subse-
quently washed with Ca
2⫹
-free external solution twice. Fura-loaded
cells were allowed to adhere to a poly-L-lysine-coated glass coverslip
chamber on the stage of an inverted microscope (Nikon, Tokyo, Japan)
equipped with a 40⫻Fluor objective (NA 1.3). Cells were alternately
illuminated at 340 and 380 nm (Lambda DG-4, Sutter Instrument Co.),
and the fluorescence emissions at
␭
⬎480 nm were captured with
Quantix CCD camera (Photometrics, Ltd.) and digitized and analyzed
using an Axon Imaging Workbench system (Axon Instruments). All
experiments were conducted at room temperature.
Reagents and Antibodies—Thapsigargin and SKF 96365 were pur-
chased from Calbiochem. Fura-2/AM and goat anti-mouse Alex Fluor
488 were from Molecular Probes (Eugene, OR). Anti-Myc A-14 was from
Santa Cruz Biotechnology (Santa Cruz, CA). All reagents for Northern
analysis were purchased from Ambion Inc. (Austin, TX). Other reagents
were from Sigma.
Statistical Analysis—In all experiments, the data are expressed as
the mean ⫾S.E. In the case of significance (p⬍0.05), Student’sttest
was used to compare individual groups.
RESULTS
Expression of CaT1 Transcripts in Jurkat T-lymphocytes—
Human CaT1 cDNA was first cloned from small intestine, and
strong expression was found in placenta, kidney, pancreas, and
prostate (37, 38). Although CaT1 mRNA was not initially de-
tected in spleen or thymus by Northern analysis in original
studies (29, 37), it was reported later that CaT1 was present in
Jurkat T-lymphocytes by RT-PCR (31). To investigate CaT1
expression in Jurkat cells, we performed Northern analysis
using total RNA from Jurkat cells and an ⬃300-bp fragment of
CaT1 cDNA as a probe. A clear ⬃3-kb band was detected,
corresponding to the size of CaT1 cDNA of 2902 bp (Fig. 1A).
The probe we used for Northern analysis, however, was highly
conserved in CaT1 and another TRPV family member ECaC1.
To distinguish specific expression of CaT1 in Jurkat cell, we
carried out RT-PCR using specific primer sets for CaT1 and
ECaC1, respectively. Two pairs of specific primer for CaT1
were selected. Total RNA from human placenta was used as
positive control. As shown in Fig. 1B, expected PCR products
were amplified in Jurkat cell, spleen cDNA library, and pla-
centa using both specific primer sets for CaT1. In addition,
FIG.2.Heterologous expression CaT1 in CHO cells. Whole cell current in mock-transfected CHO cell (A) or CaT1-transfected CHO cells (B).
Families of current responses to membrane voltage steps are shown on the left. The time course for development of inward Ca
2⫹
current after
establishing whole cell configuration at time ⫽0 and responses to TG-induced store depletion and cycling between 0 and 2 mMexternal Ca
2⫹
are
shown on the right. Inset shows voltage-ramp I-V curves at positions marked in time course plots. C, summary data for current densities at
positions marked in Aand B. Current densities derived from CaT1-transfected CHO cells are significantly larger (p⬍0.05) than that in control
CHO cells and showed a partial enhancement due to Ca
2⫹
stores-depletion.
CaT1 Is Necessary for T-cell I
CRAC
47177
by guest on February 9, 2017http://www.jbc.org/Downloaded from

ECaC1 transcripts were also detected in placenta and Jurkat
cells but with less robust amplification (Fig. 1B). RT-PCR frag-
ments were verified by nucleotide sequence to confirm the
specificity of the amplified CaT1 and ECaC1 signals. We were
not able to detect CaT1 expression by RT-PCR from either HEK
or CHO cells (Fig. 1C).
To estimate the level of CaT1 mRNA in Jurkat cells, we
quantified the relative mRNA expression of CaT1 in Jurkat cell
and placenta by real time PCR using CaT1-specific primers.
mRNA abundance was calculated and normalized by the abun-
dance of internal control GAPDH from Jurkat cell and pla-
centa, respectively. Our results indicate that the mRNA abun-
dance in Jurkat cell is about 40-fold lower than that in placenta
(Fig. 1D).
Biophysical Characterization of CaT1 Overexpression in
CHO Cell and Jurkat Cell—We heterologously expressed Myc-
tagged CaT1 cDNA in CHO cells to determine the biophysical
properties of our cloned channel. Although only a small back-
ground current was detected in mock-transfected cells (Fig.
2A), we observed a large inwardly rectifying current in CaT1-
transfected CHO cells (Fig. 2B). As reported previously (31, 33,
39) for CaT1 in heterologous expression systems, upon estab-
lishing the whole cell configuration with 10 mMEGTA inter-
nally, a large inward Ca
2⫹
current was spontaneously acti-
vated and then subsequently inactivated (Fig. 2B). Direct
Ca
2⫹
-store depletion can be obtained with thapsigargin (TG), a
specific inhibitor of smooth endoplasmic reticulum calcium
ATPase pumps resulting in a relatively rapid depletion of in-
tracellular Ca
2⫹
store independent from membrane receptor
activation or generation of IP
3
(6, 9, 40). When we depleted
intracellular Ca
2⫹
stores with 1
␮
MTG, we observed a modest
enhancement in inward current density (from 4.0 ⫾0.49 to
4.6 ⫾0.55 pA/pF) (Fig. 2C). By switching to a nominally Ca
2⫹
-
free external medium the Ca
2⫹
current nearly disappeared.
Re-introduction of 2 mMCa
2⫹
in the bath solution elicited a
dramatic increase in CaT1 current that was even larger than
that after break in (Fig. 2, Band C). Our results confirm that
the behavior of CaT1 current in response to thapsigargin-in-
duced store depletion in CHO cells is qualitatively similar to
I
CRAC
observed in other cell lines. We observed comparable
results when we transfected CaT1 into HEK cells (data not
shown).
To examine the possible role of CaT1 in I
CRAC
, we overex-
pressed CaT1 cDNA within a cellular context containing
FIG.3. Overexpression CaT1 in Jurkat cell enhances I
CRAC
.A, families of currents in response to voltage steps showing steady-state
currents after Ca
2⫹
stores release in mock-transfected Jurkat cell (left) and CaT1-overexpressing cell (right). B, summary current-voltage (I-V)
relationship between control and CaT1-expressed Jurkat cells. C, the time course in a mock-transfected Jurkat cell for development of inward Ca
2⫹
current after establishing whole cell configuration at time ⫽0 and responses to TG-induced store depletion and cycling between 0 and 2 mM
external Ca
2⫹
.(Inset shows voltage-ramp I-V curves from times indicated on time course.) D, time course for development of inward Ca
2⫹
current
in a Jurkat cell overexpressing CaT1. Upper trace is expanded to show maximal current. Lower trace of another cell is magnified to show TG
response. E, time course of a JHMI cell overexpressing CaT1 in response to CCh and cycling between 0 and 2 mMexternal Ca
2⫹
.F, histogram
showing summary data of inward Ca
2⫹
current densities after whole cell break in, after TG, with 0 mMexternal Ca
2⫹
, and after reintroduction of
2m
Mexternal Ca
2⫹
. (* indicates pⱕ0.05 by ttest versus control Jurkat cells.)
CaT1 Is Necessary for T-cell I
CRAC
47178
by guest on February 9, 2017http://www.jbc.org/Downloaded from

known I
CRAC
activity, the Jurkat T-cell. Overexpression of
CaT1 in Jurkat cells resulted in a markedly enhanced I
CRAC
-
like inward Ca
2⫹
current density compared with base line (Fig.
3, Aand B). The biophysical characteristics of CaT1 in Jurkat
cells were comparable with those in CHO cells and similar to
the endogenous Jurkat current. The current was dependent on
external Ca
2⫹
; both fast and slow Ca
2⫹
-dependent inactivation
was seen, and the channels were selective for Ca
2⫹
over Na
⫹
ions. In untransfected Jurkat cells thapsigargin is capable of
inducing store depletion and activation of I
CRAC
. In some un-
transfected cells, just establishing the whole cell patch clamp
configuration spontaneously activates endogenous I
CRAC
.In
CaT1-overexpressing Jurkat cells Ca
2⫹
entry currents were
usually stimulated spontaneously upon break in to the whole
cell mode and slowly relaxed to a partially inactivated state.
Addition of thapsigargin resulted in a modest enhancement of
the Ca
2⫹
entry current density (Fig. 3D) suggesting that the
CaT1 current is partially sensitive to the state of the Ca
2⫹
stores. The [Ca
2⫹
]
o
dependence of the CaT1 current was dem-
onstrated in its disappearance in a nominally Ca
2⫹
-free exter-
nal solution. When Ca
2⫹
was reintroduced after a period in
Ca
2⫹
-free solution, there was a very large enhancement of the
inward current beyond the initial values. This enhancement
was transient as the current inactivated again to a lesser
steady-state amplitude (Fig. 3D).
To examine a more physiological stimulation of CaT1, cur-
rent experiments were performed in CaT1-transfected JHM1
cells, a Jurkat derivative that stably express type 1 muscarinic
receptor (8, 41, 42). Upon stimulation of the muscarinic recep-
tor in these cells, phospholipase C was rapidly activated pro-
ducing IP
3
, diacylglycerol, Ca
2⫹
release, and subsequent sig-
naling similar to stimulation through the T-cell receptor (41,
42). When we applied 250
␮
Mcarbachol to CaT1-transfected
JHM1 cells, we observed an enhancement of the inward Ca
2⫹
current consistent with a partial Ca
2⫹
-stores regulation of the
CaT1 current (Fig. 3E).
Pharmacological Analysis of CaT1 Currents—To evaluate
whether CaT1 shares pharmacological features with endoge-
nous I
CRAC
, we tested the effect of a known SOC inhibitor SKF
96365 (43, 44) on CaT1. In Jurkat cells, the endogenous I
CRAC
FIG.4.Block of CaT1 current by capsaicin. A, time course of inward Ca
2⫹
current in an untransfected Jurkat cell (as in Fig. 3C) showing
current inhibition on application of SKF 96365. B, time course of inward Ca
2⫹
current in a CHO cell transfected with CaT1 showing no block of
current with SKF 96365. C, time course of inward Ca
2⫹
current in a Jurkat cell overexpressing CaT1 showing that 250
␮
Mcapsaicin blocked inward
current in a reversible fashion. D, time course of inward Ca
2⫹
current in a JHM1 cell overexpressing CaT1 showing reversible blocking of current
by capsaicin.
CaT1 Is Necessary for T-cell I
CRAC
47179
by guest on February 9, 2017http://www.jbc.org/Downloaded from

was inhibited by 50
␮
MSKF 96365 (Fig. 4A). SKF 96365,
however, had no effect on CaT1 expressed in CHO cells (Fig.
4B). Our result agreed with a previous report (45) that SKF
96365 was ineffective on ECaC1.
We next tested capsaicin on CaT1 activity. Capsaicin is a
member of the vanilloid family and activates the vanilloid
receptor, a member of the TRPV family (46, 47). At micromolar
concentrations, however, capsaicin blocks CCE in PC12 cells
(48) and the endogenous I
CRAC
in Jurkat cells (36). An analog of
capsaicin, capsazepine, that inhibits the activity of capsaicin on
the vanilloid receptor can partially block ECaC1 (45) and is
effective in blocking I
CRAC
in Jurkat cells (36). Capsaicin (250
␮
M, a concentration that completely blocks endogenous I
CRAC
in Jurkat cells (36)) was effective in reversibly blocking Ca
2⫹
entry currents in both Jurkat (Fig. 4C) and JHMI (Fig. 4D)
cells that were transfected with CaT1. The similar capsaicin
sensitivity of Jurkat I
CRAC
and CaT1 supports the hypothesis
that CaT1 contributes to the endogenous current in Jurkat
cells.
Construction and Expression of Dominant Negative CaT1
Mutant—To assess the contribution of CaT1 in Jurkat cell
I
CRAC
, we constructed a mutant CaT1 that would suppress
Ca
2⫹
entry currents by assembling with wild type CaT1 sub-
units to form non-conductive channels. We substituted three
alanines for residues 534 –536 (FEL) that are conserved in the
putative pore-lining region to create the mutant TRIA-CaT1
(Fig. 5A). Expression of TRIA-CaT1 alone in CHO cells pro-
duced a small non-selective cationic current that failed to pass
Ca
2⫹
ions and showed no regulation by Ca
2⫹
-store depletion
(Fig. 5B). Immunofluorescence analysis of Myc-tagged TRIA-
CaT1 showed a cellular distribution identical to wild type CaT1
(Fig. 5C). When expressed in HEK cells CaT1 and TRIA-CaT1
FIG.5.TRIA-CaT1 is a dominant negative CaT1 mutant. A, the predicted amino acid sequence spanning the pore region of CaT1. Arrows
indicate alanine substitutions in TRIA-CaT1. B, families of current traces during membrane voltage steps in a CHO cell transfected with
TRIA-CaT1 (top panel). Lower panel shows the magnitude of inward Ca
2⫹
current over time after establishing whole cell configuration and in
response to TG and cycling between 0 and 2 mMexternal Ca
2⫹
. TRIA-CaT1 produces a small, non-selective cation that does not support Ca
2⫹
flux.
C, localization of Myc-tagged wild type CaT1 (upper panels) and Myc-tagged TRIA-CaT1 (lower panels) by immunofluorescence. Confocal,
immunofluorescence images are shown in the right panels; bright field images for the respective fields are shown on the left. D, association of
FLAG-wild type-CaT1 and Myc-TRIA-CaT1 protein. Cells were transfected with GFP (control), FLAG-WT-CaT1, Myc-TRIA-CaT1, or both. Left
lanes show cell lysate (input), and right lanes show proteins immunoprecipitated (IP) with anti-Myc antibody. Upper gel shows immunoblot (IB)
with anti-Myc antibody, and lower panel shows the same samples immunoblotted with anti-FLAG. E, whole cell current examples from a CHO cell
transfected with wild type CaT1 (left top panel) or with CaT1 and an equal amount of TRIA-Cat1 (bottom panel). F, steady-state Ca
2⫹
current
density in CHO cells transfected with varying ratios of wild type CAT1 and TRIA-CAT1. Dotted line describes a binomial function for a completely
dominant mutant in a tetrameric assembly. G, summary maximal inward Ca
2⫹
current density in CHO cells transfected with CaT1 or CaT1 plus
TRIA-CaT1. Values measured as in Fig. 2, B–C, at base line, after TG, and cycling between 0 and 2 mMexternal Ca
2⫹
.
CaT1 Is Necessary for T-cell I
CRAC
47180
by guest on February 9, 2017http://www.jbc.org/Downloaded from

exhibited comparable staining patterns with evidence of sur-
face expression and staining in the Golgi and ER locations
typical of transiently transfected membrane proteins. Western
analysis of Myc-tagged CaT1 and TRIA-CaT1 showed similar
patterns with a major band near 80 kDa (predicted mass by
amino acid sequence is 83 kDa) and a higher molecular weight
band suggesting varied post-translational processing such as
glycosylation and/or phosphorylation (Fig. 5D). When differen-
tially tagged wild type and mutant constructs were co-trans-
fected, we could successfully detect co-immunoprecipitation in-
dicating the capability of TRIA-CaT1 to associate with wild
type CaT1 (Fig. 5D).
To examine the functional effect of TRIA-CaT1 on wild type
CaT1, we co-transfected equal amounts of each cDNA in CHO
cells. Cells co-transfected with TRIA-CaT1 and CaT1 yielded
aCa
2⫹
entry current smaller in magnitude than cells trans-
fected with wild type CaT1 alone (Fig. 5E). When we exam-
ined cells that were transfected with differing ratios of wild
type and mutant CaT1, we observed a dose-dependent sup-
pression that approached a nearly completely dominant neg-
ative effect for a tetrameric assembly (Fig. 5F). The reduction
in Ca
2⫹
-dependent current was seen at steady state and upon
cycling between 0 and 2 mMexternal Ca
2⫹
(Fig. 5G). Thus,
TRIA-CaT1 exerts dominant negative suppression on wild
type CaT1 function.
We then examined the ability of TRIA-CaT1 to alter the
endogenous I
CRAC
in Jurkat cells. When TRIA-CaT1 was over-
expressed in Jurkat cells the base-line current was similar to
that of mock-transfected cells (Fig. 6Acompared with Fig. 3A).
Compared with GFP-transfected Jurkat cells or untransfected
cells, those expressing TRIA-CaT1 showed markedly reduced
inward Ca
2⫹
current in response to thapsigargin (Fig. 6, Band
C). Moreover, the Ca
2⫹
current augmentation that normally
occurs after cycling from Ca
2⫹
-free to Ca
2⫹
-containing external
solutions (see Fig. 3C) was greatly blunted in Jurkat cells
transfected with TRIA-CaT1 (Fig. 6, Band C). I
CRAC
in Jurkat
cells can be converted to a large conductance nonspecific cation
current when external divalent species are reduced sufficiently
(8, 13). When we examined cells in divalent-free external media
(DVF), we observed a near-complete suppression in Jurkat
cells transfected with TRIA-CaT1 (Fig. 6D). To confirm that
overexpression of TRIA-CaT1 in Jurkat cells reduced endoge-
nous CCE, we examined Fura-2-loaded Jurkat cells that were
transfected with GFP, CaT1, TRIA-CaT1, or untransfected
(Fig. 6E). Thapsigargin was applied to cells in Ca
2⫹
-free exter-
nal solution to deplete the internal Ca
2⫹
stores, and then
Ca
2⫹
-containing solution (2 mM) was superfused to observe the
rate and extent of CCE. The extent of [Ca
2⫹
]
i
elevation in un-
transfected cells and GFP-transfected cells was comparable,
whereas cells transfected with CaT1 accumulated internal Ca
2⫹
faster and to a greater extent (Fig. 6E). Cells transfected with
TRIA-CaT1 have significantly slower Ca
2⫹
entry with less total
accumulation of Ca
2⫹
i
. Thus, TRIA-CaT1 expression was capable
of suppressing endogenous I
CRAC
and CCE in Jurkat cells.
FIG.6.TRIA-CaT1 suppresses endogenous I
CRAC
in Jurkat cells. A, whole cell current traces in a Jurkat cell transfected with TRIA-CAT1.
B, the time course for development of inward Ca
2⫹
current in a Jurkat cell transfected with TRIA-CaT1 after establishing whole cell configuration
and in response to TG and cycling between 0 and 2 mMexternal Ca
2⫹
.C, summary of inward Ca
2⫹
current density for TG-inducible current and
current induced by cycling between 0 and 2 mMexternal Ca
2⫹
(open bars, mock-transfected cells; black bars, TRIA-CaT1-transfected cells). D,
histogram showing summary data of inward current density before (open bars) and after (black bars) normal external solution was changed to a
divalent-free bath solution (DVF) in Jurkat cells expressing wild type CAT1 or TRIA-CaT1. (* indicates ttest, pvalue ⱕ0.05, wild type CaT1
compared with TRIA-CaT1 in DVF saline.) E, [Ca
2⫹
]
i
measured by 340:380 ratio of Fura-2 fluorescence in untransfected cells (solid black line),
GFP-transfected cells (broken gray line), CaT1-transfected cells (solid gray line), and TRIA-CaT1-transfected cells (broken black line). Cells are
initially in Ca
2⫹
-free media then are stimulated with TG. Subsequent addition of 2 mMexternal Ca
2⫹
shows rate and extent of Ca
2⫹
entry (F).
Summary of increase of 340:380 ratio of fura-2 fluorescence upon addition of 2 mMCa
2⫹
(n⫽4). (*, pⱕ0.05 by ttest versus wild type CAT1.)
CaT1 Is Necessary for T-cell I
CRAC
47181
by guest on February 9, 2017http://www.jbc.org/Downloaded from

DISCUSSION
In summary, the data presented here confirm and quantify
the expression of CaT1 mRNA in Jurkat T-lymphocytes and
provide pharmacological and functional evidence for the con-
tribution of CaT1 to the endogenous I
CRAC
. Despite the critical
role that CCE plays in T-lymphocyte activation, experimental
evidence suggests that resting T-cells express relatively few
active channels on the surface with the biophysical estimate at
⬃100 –400 SOCCs per Jurkat cell (13). Our demonstration that
CaT1 expression is lower in Jurkat cells than in placenta
corresponds with this estimate. The biological function of
SOCC in the two tissues is also compatible with the relative
abundance of the channels; in lymphocytes finely tuned Ca
2⫹
signaling only occurs briefly during immune responses and
effects a signal transduction program. In the placenta, how-
ever, CaT1 channels are likely required for nutrition with
constitutively active absorption of large amounts of Ca
2⫹
.
When we overexpress CaT1 in Jurkat cells, the resulting
current possessed characteristics of the endogenous I
CRAC
,
however with some differences. Of note, the current was usu-
ally spontaneously activated upon breaking into a whole cell
patch configuration. When high concentrations of Ca
2⫹
chela-
tors are present in the pipette solution, activation of CCE can
occur; however, we observed the same activation when pipette
solutions contained less chelator (from 10 to 0.5 mMEGTA,
data not shown). The CaT1-dependent current was only par-
tially responsive to Ca
2⫹
-stores depletion in transfected cells.
As discussed by Yue et al. (31) this may be due to mismatched
numbers of surface channels and the proteins involved in sens-
ing and transmitting the information of the state of Ca
2⫹
stores. It is possible that CCE is composed of a macromolecular
complex with a precise stoichiometry that may be disrupted or
uncoupled by forced overexpression of one element such as the
CaT1 subunit. The [Ca
2⫹
]
i
-dependent fast and slow inactiva-
tion of I
CRAC
(10, 11), however, appears intact in heterologously
expressed CaT1.
In assaying for molecular candidates responsible for I
CRAC
in
Jurkat cells, we also detected the expression of ECaC1, a mem-
ber of the TRPV family, ⬃75% amino acid homology to CaT1.
The electrophysiological properties reported for these two
channels are also similar (39). The sequence similarity between
CaT1 and ECaC1 is such that the probe we used for Northern
analysis may cross-react with ECaC1, which would be indis-
tinguishable from a CaT1 signal; however, primers used for
RT-PCR were CaT1-specific. Accordingly, we cannot exclude
the possibility that ECaC1 also contributes to I
CRAC
in Jurkat
lymphocytes. The suppression of endogenous I
CRAC
by mutant
TRIA-CaT1 would argue against a functional contribution by
ECaC1 unless CaT1 and ECaC1 are capable of forming het-
erotetrameric channels. We also detected and cloned another
member in the TRPV family, VRL1, from Jurkat T-cell RNA
(data not shown). Heterologous expression of VRL1 in CHO
cells, however, could not produce detectable current at base
line or upon thapsigargin treatment despite verified protein
expression (at room temperature). Considering that the VRL1
channel is activated by extremes of temperature or pH (46) and
that it normally supports a relatively non-selective cation cur-
rent, it seems unlikely that it is responsible for I
CRAC
in Jurkat.
As in the case of ECaC1, we cannot exclude the possibility that
VRL1 could also participate in a heterogeneous macromolecu-
lar complex that enables CCE.
The evidence supporting a role for CaT1 in lymphocyte CCE
includes its expression in cells, its biophysical similarity to the
endogenous current, its partial regulation by Ca
2⫹
stores, and
the pharmacological block by capsaicin. The most compelling
argument, however, comes from experiments with TRIA-CaT1,
the CaT1 mutant with an altered pore region that abolishes
Ca
2⫹
conductance. We interpret the ability of TRIA-CaT1 to
suppress current from wild type CaT1 as a specific co-assembly
of wild type and mutant subunits into tetramers that fail to
effectively pass Ca
2⫹
ions. That TRIA-CaT1 also suppresses
endogenous I
CRAC
in Jurkat cells is strong evidence that the
mutant is interacting with and dominating CaT1 that is re-
sponsible (at least in part) for the native current. That capsa-
icin blocks both CaT1 and I
CRAC
but SKF 96365 only blocks the
native current suggests that CaT1 might be the direct target of
capsaicin, whereas SKF 96365 might indirectly inhibit CCE via
the pathway between store-depletion and channel opening
(thus explaining the slower kinetics of SKF 96365 action (43)).
The reported discrepancy between pore conductance proper-
ties of I
CRAC
and CaT1 in RBL mast cells (32) may be due to one
of several possibilities. Different cell types and tissues may
express unique profiles of proteins to produce CCE, and as such
I
CRAC
in different cells may vary. This may be due to differen-
tial expression of channel subunits such as CaT1 or ECAC or
other members of the TRP family. Variation due to alternative
splicing is another possibility. Another very likely explanation
is that heterologous expression of channel subunits frequently
fail to completely recapitulate the endogenous phenotype be-
cause expression systems often lack additional subunits or
accessory proteins that are present in the native tissue. None-
theless, our results strongly point to CaT1 as a necessary
contributing protein in the production of T-lymphocyte CCE.
This provides a clear starting point for further identification of
all the proteins that are involved in generating the signal
cascade that begins with release of Ca
2⫹
stores and results in
sustained and complex Ca
2⫹
signaling.
Acknowledgments—We thank Dr. Wenjun Ju for assistance with real
time PCR and Danmei Qin in early experiments.
REFERENCES
1. Putney, J. W., Jr., and McKay, R. R. (1999) Bioessays 21, 38–46
2. Lewis, R. S. (2001) Annu. Rev. Immunol. 19, 497–521
3. Berridge, M. J. (1995) Biochem. J. 312, 1–11
4. Putney, J. W., Jr. (1990) Cell Calcium 11, 611–624
5. Hoth, M., and Penner, R. (1992) Nature 355, 353–356
6. Zweifach, A., and Lewis, R. S. (1993) Proc. Natl. Acad. Sci. U. S. A. 90,
6295–6299
7. Fasolato, C., Innocenti, B., and Pozzan, T. (1994) Trends Pharmacol. Sci. 15,
77–83
8. McDonald, T. V., Premack, B. A., and Gardner, P. (1993) J. Biol. Chem. 268,
3889 –3896
9. Premack, B. A., McDonald, T. V., and Gardner, P. (1994) J. Immunol. 152,
5226 –5240
10. Zweifach, A., and Lewis, R. S. (1995) J. Gen. Physiol. 105, 209–226
11. Zweifach, A., and Lewis, R. S. (1995) J. Biol. Chem. 270, 14445–14451
12. Parekh, A. B., and Penner, R. (1997) Physiol. Rev. 77, 901–930
13. Kerschbaum, H. H., and Cahalan, M. D. (1999) Science 283, 836–839
14. Fomina, A. F., Fanger, C. M., Kozak, J. A., and Cahalan, M. D. (2000) J. Cell
Biol. 150, 1435–1444
15. Lewis, R. S., and Cahalan, M. D. (1989) Cell Regul. 1, 99–112
16. Christian, E. P., Spence, K. T., Togo, J. A., Dargis, P. G., and Patel, J. (1996)
J. Membr. Biol. 150, 63–71
17. Fierro, L., Lund, P. E., and Parekh, A. B. (2000) Pfluegers Arch. 440, 580–587
18. Crabtree, G. R. (1999) Cell 96, 611–614
19. Dolmetsch, R. E., Xu, K., and Lewis, R. S. (1998) Nature 392, 933–936
20. Li, W.-H., Llopis, J., Whitney, M., Zlokarnik, G., and Tsien, R. Y. (1998) Nature
392, 936 –941
21. Birnbaumer, L., Zhu, X., Jiang, M., Boulay, G., Peyton, M., Vannier, B.,
Brown, D., Platano, D., Sadeghi, H., Stefani, E., and Birnbaumer, M. (1996)
Proc. Natl. Acad. Sci. U. S. A. 93, 15195–15202
22. Clapham, D. E., Runnels, L. W., and Strubing, C. (2001) Nat. Rev. Neurosci. 2,
387–396
23. Montell, C. (1997) Mol. Pharmacol. 52, 755–763
24. Putney, J. W., Jr. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 14669 –14671
25. Dutta, D. (2000) J. Biosci. 25, 397–404
26. Clapham, D. E. (1996) Neuron 16, 1069–1072
27. Montell, C. (2001) Science’s STKE http://www.stke.org/cgi/content/full/OC_
sigtrans; 2001/RE1
28. Hoenderop, J. G., van der Kemp, A. W., Hartog, A., van de Graaf, S. F., van Os,
C. H., Willems, P. H., and Bindels, R. J. (1999) J. Biol. Chem. 274,
8375–8378
29. Peng, J. B., Chen, X. Z., Berger, U. V., Vassilev, P. M., Tsukaguchi, H., Brown,
E. M., and Hediger, M. A. (1999) J. Biol. Chem. 274, 22739 –22746
30. Vennekens, R., Hoenderop, J. G., Prenen, J., Stuiver, M., Willems, P. H.,
CaT1 Is Necessary for T-cell I
CRAC
47182
by guest on February 9, 2017http://www.jbc.org/Downloaded from

Droogmans, G., Nilius, B., and Bindels, R. J. (2000) J. Biol. Chem. 275,
3963–3969
31. Yue, L., Peng, J. B., Hediger, M. A., and Clapham, D. E. (2001) Nature 410,
705–709
32. Voets, T., Prenen, J., Fleig, A., Vennekens, R., Watanabe, H., Hoenderop, J. G.,
Bindels, R. J., Droogmans, G., Penner, R., and Nilius, B. (2001) J. Biol.
Chem. 276, 47767–47770
33. Schindl, R., Kahr, H., Graz, I., Groschner, K., and Romanin, C. (2002) J. Biol.
Chem. 277, 26950 –26958
34. Cui, J., Kagan, A., Qin, D., Mathew, J., Melman, Y. F., and McDonald, T. V.
(2001) J. Biol. Chem. 276, 17244 –17251
35. Cui, J., Melman, Y., Palma, E., Fishman, G. I., and McDonald, T. V. (2000)
Curr. Biol. 10, 671–674
36. Fischer, B. S., Qin, D., Kim, K., and McDonald, T. V. (2001) J. Pharmacol. Exp.
Ther. 299, 238 –246
37. Peng, J. B., Chen, X. Z., Berger, U. V., Weremowicz, S., Morton, C. C., Vassilev,
P. M., Brown, E. M., and Hediger, M. A. (2000) Biochem. Biophys. Res.
Commun. 278, 326 –332
38. Peng, J. B., Brown, E. M., and Hediger, M. A. (2001) Genomics 76, 99–109
39. Hoenderop, J. G., Vennekens, R., Muller, D., Prenen, J., Droogmans, G.,
Bindels, R. J., and Nilius, B. (2001) J. Physiol. (Lond.)537, 747–761
40. Thastrup, O., Dawson, A. P., Scharff, O., Foder, B., Cullen, P. J., Drobak, B. K.,
Bjerrum, P. J., Christensen, S. B., and Hanley, M. R. (1989) Agents Actions
27, 17–23
41. Goldsmith, M. A., Desai, D. M., Schultz, T., and Weiss, A. (1989) J. Biol. Chem.
264, 17190 –17197
42. Desai, D. M., Goldsmith, M. A., and Weiss, A. (1990) Int. Immunol. 2, 615–620
43. Chung, S. C., McDonald, T. V., and Gardner, P. (1994) Br. J. Pharmacol. 113,
861–868
44. Wallace, P., Ayman, S., McFadzean, I., and Gibson, A. (1999) Naunyn-
Schmiedeberg’s Arch. Pharmacol. 360, 368 –375
45. Nilius, B., Prenen, J., Vennekens, R., Hoenderop, J. G., Bindels, R. J., and
Droogmans, G. (2001) Br. J. Pharmacol. 134, 453–462
46. Caterina, M. J., Rosen, T. A., Tominaga, M., Brake, A. J., and Julius, D. (1999)
Nature 398, 436 –441
47. Ichikawa, H., and Sugimoto, T. (2000) Neuroscience 101, 719–725
48. Choi, S. Y., and Kim, K. T. (1999) J. Pharmacol. Exp. Ther. 291, 107–114
CaT1 Is Necessary for T-cell I
CRAC
47183
by guest on February 9, 2017http://www.jbc.org/Downloaded from

Jie Cui, Jin-Song Bian, Anna Kagan and Thomas V. McDonald
CaT1 Contributes to the Stores-operated Calcium Current in Jurkat T-lymphocytes
doi: 10.1074/jbc.M205870200 originally published online October 1, 2002
2002, 277:47175-47183.J. Biol. Chem.
10.1074/jbc.M205870200Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted• When this article is cited•
to choose from all of JBC's e-mail alertsClick here
http://www.jbc.org/content/277/49/47175.full.html#ref-list-1
This article cites 47 references, 22 of which can be accessed free at
by guest on February 9, 2017http://www.jbc.org/Downloaded from