Content uploaded by Denis Tourvieille de Labrouhe
Author content
All content in this area was uploaded by Denis Tourvieille de Labrouhe on Apr 05, 2016
Content may be subject to copyright.
Theor Appl Genet (2002) 104:592–600 © Springer-Verlag 2002
Abstract Resistance of sunflower to the obligate para-
site Plasmopara halstedii is conferred by specific domi-
nant genes, denoted Pl. The Pl6 locus confers resistance
to all races of P. halstedii except one, and must contain
at least 11 tightly linked genes each giving resistance to
different downy mildew races. Specific primers were
designed and used to amplify 13 markers covering a ge-
netic distance of about 3 cM centred on the Pl6 locus.
Cloning and sequence analysis of these 13 markers indi-
cate that Pl6 contains conserved genes belonging to the
TIR-NBS-LRR class of plant resistance genes.
Keywords Disease resistance · Helianthus annuus ·
Plasmopara halstedii · Molecular markers ·
Toll-Interleukin-1 Receptor (TIR) · Nucleotide binding
site (NBS)
Introduction
Downy mildew caused by Plasmopara halstedii is one of
the most important diseases of cultivated sunflower
(Helianthus annuus L). Genetic studies of resistance to
this parasite have shown that major dominant genes, de-
noted Pl, control resistance to different races of P. hal-
stedii. So far, ten Pl genes have been described; Miller
and Gulya (1991) made crosses with wild Helianthus
and described three Pl genes denoted Pl6, Pl7 and Pl8.
Pl6 was obtained from wild H. annuus, whereas Pl7
came from Helianthus praecox and Pl8 from Helianthus
argophyllus. One of the most striking features of these
genes was that each one of them conferred resistance to
all races of P. halstedii known at that time, suggesting
that either they conferred some non-race-specific, com-
plete resistance, or that these “genes” were in fact com-
plex loci containing several linked Pl genes giving resis-
tance to individual races.
Artificial infection of 150 F3 progenies of a cross be-
tween a sunflower line containing Pl6 and a susceptible
line, by five different P. halstedii races, showed that the
Pl6 locus could be split into at least two genetically dis-
tinct regions, one giving resistance to races 100 and 300
and a second giving resistance to races 700, 703 and 710
(Vear et al. 1997). This was the first report of the cluster-
ing of P. halstedii resistance genes in sunflower. The Pl6
locus may however contain at least 11 functional Pl
genes since the sunflower lines which contain this locus
are resistant to 11 races of downy mildew.
In recent years, many different disease-resistance
genes (R-genes) have been cloned from plants and they
confer resistance to fungal, viral, bacterial, insect and
nematode pathogens. These genes contain conserved do-
mains that can account for many of the predicted func-
tions of R-genes. Five classes of R-genes are now recog-
nised (Ellis and Jones 1998; Martin 1999; Meyers et al.
1999): intracellular protein kinases; receptor-like protein
kinases with an extracellular leucine-rich repeat (LRR)
domain; intracellular LRR proteins with a nucleotide
binding site (NBS) and a leucine zipper (LZ) motif; in-
tracellular NBS-LRR proteins with a region with similar-
ity to the Toll and interleukin-1 receptor (TIR) proteins;
and LRR proteins that code for membrane-bound extra-
cellular proteins. Despite these significant insights into
R-gene structure, much remains to be elucidated about
the molecular mechanisms by which R-proteins re-
cognise pathogens and transduce this information in the
plant cell to initiate defence responses.
In sunflower, Gentzbittel et al. (1998) used degener-
ate primers designed from the conserved nucleotide
binding domains of N from tobacco (Whitham et al.
Communicated by M.A. Saghai Maroof
M.F. Bouzidi · S. Badaoui · F. Cambon · P. Nicolas
S. Mouzeyar (
✉
)
UMR 1095 INRA-UBP “Amélioration et santé des plantes”,
Université Blaise Pascal.
24, Avenue des Landais 63177 Aubière Cedex, France
e-mail: Said.MOUZEYAR@ovgv.univ-bpclermont.fr
Fax: (+33)-4-73-40-79-14
F. Vear · D.T. de Labrouhe
INRA 234, avenue du Brézet 63039 Clermont Ferrand Cedex 02,
France
M.F. Bouzidi · S. Badaoui · F. Cambon · F. Vear
D. Tourvielle De Labrouhe · P. Nicolas · S. Mouzeyar
Molecular analysis of a major locus for resistance to downy mildew
in sunflower with specific PCR-based markers
Received: 9 April 2001 / Accepted: 10 August 2001
1994), RPS2 from Arabidopsis thaliana (Mindrinos et al.
1994) and L6 from flax (Lawrence et al. 1995). The re-
sulting amplification products were shown to be mem-
bers of a multigene family. One clone was sequenced
and mapped close to the Pl6 cluster for resistance to
downy mildew. Sequence analysis of this resistance-gene
analog (RGA) showed considerable homology with the
nucleotide binding domains of previously cloned resis-
tance genes in other species.
In this paper, we report further analysis of the com-
plexity of the Pl6 locus. In order to obtain more molecu-
lar markers suitable for positional cloning of Pl genes,
specific primers designed for the N-terminal region of a
sunflower RGA sequence were used. Thirteen specific
markers [sequence-tagged sites (STSs)] for the Pl6 locus
were cloned, sequenced, and mapped to a genetic dis-
tance of 3 cM. Evolutionary relationships between these
sequences are discussed.
Materials and methods
Plant material and disease evaluation
The USDA sunflower line HA335 contains the Pl6 locus (Miller
and Gulya 1991) and is resistant to all major races of P. halstedii.
The sunflower line H52 (from ARS, South Africa) is susceptible to
all known races of P. halstedii. These lines were crossed and a seg-
regating population of 142 F2 individuals was obtained. The corre-
sponding F3 families were then tested for resistance to five races of
P. halstedii, making it possible to classify the F2 plants as homozy-
gous resistant, homozygous susceptible or heterozygous (Vear et al.
1997). Young leaf tissue from the F
2
plants was collected and DNA
was isolated by freeze-drying followed by CTAB extraction, as de-
scribed by Saghai Maroof et al. (1984). DNA from 12 homozygous
susceptible or resistant lines of the F
2
population were pooled to
form bulk-susceptible and bulk-resistant samples.
Development of PCR-based specific markers or STSs
In order to detect and develop PCR-markers, we chose to proceed
by two stages: initially we obtained cDNA sequences by RACE-
PCR; in a second stage, we used these sequences as templates for
designing specific primers for cloning genomic sequences. This
methodology is summarised in Fig. 1.
5′ and 3′ rapid amplification of cDNA ends (RACE) of RGA
in sunflower
RNA was extracted from sunflower line HA335 using the method
described by Bogorad et al. (1983), and the polyA with the PolyA-
Tract mRNA Isolation System (Promega). Based on the sequence
of the 627 bp-length RGA product (HA-NBSR3, accession num-
ber U96642) obtained with degenerate primers (Gentzbittel et al.
1998), 5′ and 3′ ends of the cDNA were obtained using the “Mara-
thon cDNA amplification kit” (Clontech, Ozyme France). The am-
plified products were cloned into pGEM-T Easy vector (Promega)
and sequenced by Genome Express (Grenoble, France).
Amplification of full-length genomic RGA
To clone genomic fragments with homology to plant resistance
genes, we used specific primers from 5′(5′GGTAATGGCTGTT-
GAATTTATGGAGC3′, containing ATG, the initiation codon) and
3′ (5′TGTTGCCCATGGACCATTGATCC3′) portions of one 5′
and one 3′ RACE-PCR product, and amplified several genomic
sequences. The PCR amplifications were carried out with 50 ng of
sunflower DNA in the presence of 0.2 mM of each dNTP, 1 U of
Taq DNA polymerase (Advantage 2, Clontech), 1×Taq polymerase
buffer and 0.5 µM of each primer. PCR was carried out in a 2400
Perkin-Elmer thermocycler under the following conditions: 35 cy-
cles for 10 s at 94°C, 30 s at 58°C (primer annealing), and 1 min
30 s at 72°C (primer extension). PCR products were separated
using standard TAE agarose gel electrophoresis.
Amplification and cloning of polymorphic PCR fragments (STSs)
Primer pairs were designed (see Fig. 1) and tested for polymor-
phism using the bulked segregant analysis method as described by
Michelmore et al. (1991). Three specific primer pairs were select-
ed using sunflower RGAs, obtained as described in Table 1. These
primers are all located at the 5′ end of these RGAs. The DNA
fragments were amplified by polymerase chain reaction (PCR),
using the 22–27-mer primers at a concentration of 0.5 µM. Ampli-
fication was performed as described above. PCR was carried out
under the following conditions: 33 cycles for 10 s at 94°C, 30 s at
60°C, and 1 min 30 s at 72°C. Each amplified fragment was indi-
vidually excised and purified from the gel using the GFX PCR
purification system (Amersham-Pharmacia-Biotech, France). The
purified fragments were cloned and sequenced.
Sequencing and sequence analysis
For each STS and for the full-length genomic fragment, one clone
was chosen randomly and sequenced using the Dye-Terminator
method (Genome Express, France). Both strands were sequenced
and gaps were filled by primer walking. Each region of these
clones was sequenced between two and five times. Sequences
were subjected to data bank analysis using the BLAST algorithms
(Altschul et al. 1997). Identification of the domain structure of the
proteins was performed using the Pfam database (Bateman et al.
2000). Protein sequences were predicted using the Genscan pro-
gram (Burge and Karlin 1997) and hand checked, then aligned
with CLUSTALX computer software (Thompson et al. 1997).
Alignments were shaded using the Genedoc software (Nicholas
et al. 1997). A distance tree was obtained with CLUSTALX using
the neighbor-joining (NJ) method. The CLUSTALX default op-
tions were used in the initial alignment.
Reverse transcriptase-PCR (RT-PCR) analysis of the expression
of the STSs
To check whether the cloned STSs are parts of genes with poten-
tial transcriptional activity, accumulation of the transcripts was
monitored using RT-PCR. The RNA was extracted both from H52
and HA335 healthy 12-day old hypocotyls. Five micrograms of to-
tal RNA were subjected to 3 units of DnaseI in the presence of
Rnasine. Five microliters of Dnase-treated RNA were primed with
an 18-mer oligodT and the first cDNA strand was synthesized us-
ing 200 units of reverse transcriptase (Superscript RT, Gibco-BRL,
France). Because the level of the expression of these STSs was not
known, several dilutions of the cDNA were used as templates in
PCR, together with the three primer pairs described above, using
the same PCR conditions as for the amplification of the STSs.
RT-PCR products were separated using standard TAE agarose-gel
electrophoresis.
Mapping the STSs
Marker orders and genetic distances were calculated with MAP-
MAKER 3.0 b software (Lander et al. 1987), to construct a map of
the Pl6 region, using a LOD value threshold of 3.0 and a maxi-
mum recombination fraction of 50. Each STS was scored as a
593
594
dominant marker (either present or absent) and the 13 STSs were
mapped using 142 F2 individuals segregating for resistance to five
races of downy mildew (Vear et al. 1997). The closest polymor-
phic RFLP marker, S124E1–2, was used to assign the STS to link-
age group 1. Since the disease evaluations were made on F
3
fami-
lies, the resistance genes were scored as co-dominant markers.
A subset of markers consisting of the co-dominant markers
(S124E1–2 and the downy mildew resistance genes) and two
dominant markers from each parent was used to construct a core
map of the Pl6 region. The TRY command was employed to map
the remaining markers. The best order was confirmed using the
RIPPLE command of the software.
Results
Development of the STSs
Cloning of the 5′ and 3′ ends of RGA
The sequence of one partial RGA product obtained with
degenerate primers (Gentzbittel et al. 1998) was used as a
template to isolate the remaining 5′ and 3′ portions of the
gene. The two longest clones were selected and the sin-
gle-pass sequenced. Subsequent analysis and comparison
with other plant resistance genes, such as the N gene of
tobacco (Whitham et al. 1994), suggest that the 5′ clone
(1,162-bp long, sequence not shown) contains one puta-
tive initiation codon ATG at position 15 and a 5′UTR
consisting of 14 nucleotides. No attempt was made to ob-
tain other RACE-PCR products containing larger 5′UTR
sequences. The second clone, or the 3′ clone (1,839-bp
long, sequence not shown) corresponding to the 3′ region,
contains one putative TAA stop codon and a polyA tail.
The two clones overlap over 61 bases and entirely cover
the partial genomic clone obtained by Gentzbittel et al.
(1998). However, the overlapping segment contains four
mismatches indicating that the two clones may be part of
different genes. In addition, numerous mismatches with
the clone HA-NBSR3 (Gentzbittel et al. 1998) were de-
tected, which may be due to the fact that this clone was
obtained from RHA266, a sunflower line different from
those used in this study.
Amplification of full-length genomic RGA
Using PCR and specific primers from the 5′ and 3′ por-
tions of the RACE-PCR products, we amplified several
genomic sequences (Fig. 1). The primers were homolo-
gous to the putative initiation and stop codons, and am-
plified bands ranging in size from 3.5 to 4.1 kb. The
longest one (4,187 bp, accession number AF316405)
was entirely sequenced. This RGA contains five exons
and four introns (within the TIR domain, prior to the
NBS domain, prior to the LRR and within the LRR do-
main). The predicted protein structure of this RGA ge-
nomic clone, determined using the Pfam database, is 770
amino-acids long and shares complete signature domains
with some plant R-genes: TIR, NBS and LRR domains.
The combination of these domains places this sunflower
RGA in the tobacco N (Whitham et al. 1994), flax L6
(Lawrence et al. 1995), and A. thaliana RPP1 (Botella
et al. 1998) family of R-genes.
Amplification and cloning of polymorphic PCR
fragments (STSs)
Only three pairs of specific primers (Table 1) were tested
and found to amplify polymorphic fragments between
the susceptible sunflower line H52 and the resistant line
HA335. Bulked segregant analysis (Michelmore et al.
1991) was used to detect markers potentially linked to
Table 1 Sequence of forward and reverse primers used to amplify 13 STSs linked to the Pl6 locus. Their locations within the sunflower
RGA accession number AF316405 are also indicated
Primer pair Forward primer sequences Reverse primer sequences
HaP1 5′GGTAATGGCTGTTGAATTTATGGAGC3′ 5′AGCATGATCCGGCTAGAGCCTTCTA3′
Nucleotides 1 to 27 Nucleotides 2,162 to 2,137
HaP2 5′GTCTACTACATGGTTTCCGTTTTC3′ 5′TGCTTCTTCCTTCTATCTCACTC3′
Nucleotides 104 to 127 Nucleotides 2,067 to 2,045
HaP3 5′GTTTGTGGATCATCTCTATGCG3′ 5′TGCTTCTTCCTTCTATCTCACTC3′
Nucleotides 693 to 714 Nucleotides 2,067 to 2,045
Fig. 1 Methodology used to develop STS markers. 5′ and 3′ rapid
amplification of cDNA ends (RACE) of partial RGA (627-bp,
accession number U96642) were obtained. These sequences were
used as templates for designing specific primers indicated with
arrows to amplify the genomic clones and STS markers
595
five P. halstedii resistance genes (Fig. 2). Amplification
with the primer pair HaP1 gave two major polymorphic
bands between the two parents and the bulks (Fig. 2A);
these bands were purified, cloned and sequenced; two
additional bands were detected, one which was not poly-
morphic (about 2,100-bp long) was not cloned, and a
faint band (1,610-bp large and denoted Ha-NBS15)
was cloned and sequenced and shows homology with
the NL25 sequence from potato (Hehl et al. 1999)
(BLASTX p-value 6e-40). However, because it was
faint, this band was not mapped. The primer pair HaP2
gave eight polymorphic bands between the two parents
and the bulks (Fig. 2B); all the bands except the largest
one (about 2,500 bp in the resistant parent) were puri-
fied, cloned and sequenced. The primer pair HaP3 gave
four polymorphic bands between the two parents and the
bulks (Fig. 2C); each amplified fragment was purified,
cloned and sequenced. The size of each fragment is
listed in Table 2.
Sequence analysis
Homology searches in gene databases using the BLAST
suite (Altschul et al. 1997) indicate that the 13 STSs are
all homologous to the TIR-NBS region of the TIR-NBS-
LRR class of plant R-genes. The sequences showing the
lowest p-value (i.e. the highest scores) when the
BLASTX program was used, were NL25 (accession
number, AJ009719) (p-value range: 1e-33 to 9e-43 ) and
NL27 (accession number, AJ009720) (p-value range:
2e-33 to 5e-44) clones from potato (Hehl et al. 1999),
the N gene (accession number, U15605) (p-value range:
8e-33 to 1e-36) for resistance to TMV in tobacco
(Whitham et al. 1994), the L6 gene (accession number,
U27081) (p-value range: 1e-31 to 4e-35) for resistance
to flax rust (Lawrence et al. 1995) and the RPP1 gene
(accession number, AF098962) (p-value range: 2e-29 to
1e-34) for resistance to downy mildew in A. thaliana
(Botella et al. 1998). Analysis of the complete genomic
RGA revealed that this sequence is homologous with
the tobacco resistance gene N with a BLASTX p-value
of 5e-64. The 5′ RACE clone shares homology with
the TIR-NBS part of the NL27 cDNA clone from
potato with a BLASTX p-value 5 e-51. The 3′ RACE
clone shares homology with the C-terminal region of
the N gene from tobacco with a BLASTX p-value of
5e-51.
Comparison of the 13 STSs
Due to the position of the primers used in this study, it
was expected that amplification using different primer
pairs would give different product sizes. The 13 STSs
were trimmed so that only the most-internal and com-
mon parts corresponding to the position of the HaP3
primer pair were retained for sequence comparisons and
alignments. Alignment of deduced amino acids of the in-
ternal and common sequence of the 13 STSs show that
Fig. 2A–C STS amplification patterns. P
S
susceptible parent (H52
line), B
S
susceptible bulk; B
R
resistant bulk and P
R
resistant parent
(HA335 line). Lane M 1-kb DNA ladder (Life Technologies).
Primer combinations are as follows: A STS amplification patterns
with HaP1 primers, B STS amplification patterns with HaP2
primers and C STS amplification patterns with HaP3 primers. The
polymorphic fragments are listed on the right. Ha-NBS/S the
sequence originating from the susceptible parent; Ha-NBS/R the
sequence originating from the resistant parent. The bulk B
R
in-
cluded one F2 plant recombined for the marker Ha-NBS1/S and
one for Ha-NBS12/S
these sequences are conserved but not identical. They
were compared with sunflower RGA (full-length genom-
ic RGA), two R-genes (N and L6) and one RGA from
potato (NL27). The similarities were especially close
with one NBS motif (kinase 1a or the P-loop) and the
conserved domains TIR-2 and TIR-3 within the N-termi-
nal region (Fig. 3) (Meyers et al. 1999). This overall
similarity, and the existence of the P-loop, TIR-2 and
TIR-3 motifs, indicate that the STSs and the full-length
genomic sunflower RGA belong to the TIR-NBS-LRR
596
Table 2 Origins and sizes of
13 STS markers within the Pl6
locus
STS codes Primer pairs Parent PCR product sizes Accession numbers
Ha-NBS 1 HaP1 Susceptible 1,901 bp AF316406
Ha-NBS 2 HaP1 Resistant 1,484 bp AF316407
Ha-NBS 3 HaP2 Susceptible 1,694 bp AF316408
Ha-NBS 4 HaP2 Susceptible 1,979 bp AF316409
Ha-NBS 5 HaP2 Resistant 1,763 bp AF316410
Ha-NBS 6 HaP2 Susceptible 1,700 bp AF316411
Ha-NBS 7 HaP2 Resistant 1,589 bp AF316412
Ha-NBS 8 HaP2 Resistant 1,414 bp AF316413
Ha-NBS 9 HaP2 Resistant 1,260 bp AF316414
Ha-NBS 11 HaP3 Resistant 1,811 bp AF316415
Ha-NBS 12 HaP3 Susceptible 1,406 bp AF316416
Ha-NBS 13 HaP3 Resistant 1,119 bp AF316417
Ha-NBS 14 HaP3 Resistant 988 bp AF316418
Fig. 3 Partial alignment of deduced amino-acid sequences of 13
STSs, sun-RGA (full-length genomic sunflower RGA) and of two
R-genes, tobacco N (accession number, U15605) and flax L6 (ac-
cession number, U27081), and one clone (NL27) from potato (ac-
cession number, AJ009720) The computer program CLUSTALX
was used in alignment analysis. Alignments were shaded using the
Genedoc software. The kinase1a (P-loop), TIR-2 and TIR-3 do-
mains are boxed
597
resistance-gene superfamily. The percent amino-acid se-
quence identities of these 13 STSs compared with previ-
ously cloned plant R-genes, or R-gene analogs, are listed
in Table 3. The identities between the 13 STSs and the
full-length sunflower RGA ranged from 57 to 98%, ex-
Table 3 Percent amino-acid sequence identities of 13 STSs compared with sunflower RGA (Sun) and three R-genes (N, NL27 and L6).
Values were calculated using the CLUSTALX program with a gap opening penalty=10 and a gap extension penalty=0.05
N NL27 8/R 13/R 2/R 9/R 1/S 6/S Sun/R 3/S 5/R 4/S 12/S 7/R 14/R 11/R
NL27 65
8/R 43 44
13/R 424482
2/R 39 40 70 71
9/R 44 46 78 79 79
1/S 43 44 81 83 75 87
6/S 42 44 81 82 74 86 98
Sun/R 42 44 81 83 73 85 96 96
3/S 35 37 64 67 57 70 81 80 80
5/R 37 39 64 67 60 70 78 77 79 77
4/S 42 43 79 81 73 84 93 93 92 77 75
12/S 41 43 78 81 72 82 92 92 91 78 76 96
7/R 39 44 69 71 75 76 76 76 78 62 65 75 73
14/R 3338596165656666686466656586
11/R 22 24 38 40 40 38 39 39 40 25 28 40 38 46 33
L6 33 36 37 37 39 41 40 39 41 32 34 39 38 38 32 22
Fig. 4 Phylogenetic tree based
on partial alignment of deduced
amino-acid sequences of 13 STS
markers, sunflower RGA and of
two R-genes (N and L6) and one
RGA (NL27). The tree was
constructed using the neighbor-
joining method provided in
CLUSTALX. Ha-NBS/S stands
for sequences originating from
the susceptible parent H52;
Ha-NBS/R stands for sequences
originating from the resistant
parent HA335
cept for Ha-NBS11 which showed a percent identity of
less than 46%. Twelve STSs and the full-length sunflow-
er RGA were also similar to the N gene of tobacco, the
NL27 sequence of potato and the L6 gene of flax (aver-
age identity was 40.1%, 42.3% and 37.4% respectively).
598
In contrast, Ha-NBS11 showed less similarity with the
N gene (22%), the NL27 clone (24%) and the L6 gene
(22%). Phylogenetic analysis was also performed to
evaluate further relationships between sunflower RGAs
and plant R-genes. The deduced amino-acid sequences
of the 13 STSs, Sun-RGA and three plant R-genes were
aligned and a neighbor-joining tree was generated from
the alignment. Several iterations were performed and
gave trees similar to that in Fig. 4. The majority of the
nodes were found in at least 70% of 1,000 replicates in
bootstrap analysis. Three major clusters were detected.
The first contained all the STSs cloned from the suscep-
tible parent, together with Ha-NBS5/R and the full-
length RGA (Sun-RGA/R) from the resistant parent. The
second cluster contained several STSs from the resistant
parent and the resistance genes L6 of flax, N of tobacco
and NL27 of potato. The third cluster contained only two
STSs, Ha-NBS7/R and Ha-NBS14/R, from the resistant
parent.
RT-PCR analysis of the expression of the STSs
Among the three primer pairs tested, the HaP3 primer
pair gave a faint band at approximately 700 bp when the
cDNA from Ha335 was used as a template. The specific-
ity of the amplification was confirmed by Southern blot-
ting and hybridization with the 5′-RACE product. No
additional bands were observed, even when the priming
temperature was decreased to 55°C and the cycling num-
ber increased up to 40. The other primer pairs (HaP1 and
HaP2) failed to amplify any detectable band even when
the PCR products were subjected to Southern hybridiza-
tion with the STSs as radioactively marked probes (data
not shown).
Mapping of the STS markers
For the linkage group assignment of the STSs, the use in
this study of the co-dominant RFLP marker S124E1–2,
the closest polymorphic RFLP marker available
(Gentzbittel et al. 1999), clearly demonstrated that all
the 13 STSs map to the distal region of linkage group 1
of the RFLP composite map developed by Gentzbittel
et al. (1999). Subsequent mapping of the STSs showed
that they are tightly linked and lie within the Pl6 locus
containing the genes giving resistance to races 100, 300,
700, 703 and 710 of P. halstedii. Thus the Pl6 locus may
contain several copies of R-genes of the TIR-NBS-LRR
class. The STS markers are clustered within a genetic
distance of about 3 cM. Markers originating from the
susceptible parent form two groups close to the
S017H3–3 locus, and those originating from the resis-
tant parent form three groups close to the S124E1–2 lo-
cus (Fig. 5). In addition, only one STS (Ha-NBS2/R)
completely co-segregates with the Pl genes conferring
resistance to races 100 and 300.
Discussion
The Pl6 locus contains sequences belonging
to the TIR-NBS-LRR class
Since the initial cloning of some plant resistance genes,
several research groups have demonstrated that PCR-am-
plification of conserved disease-resistance motifs can be
used to identify disease-resistance loci (Kanazin et al.
1996; Leister et al. 1996; Yu et al. 1996; Hayes and
Saghai Maroof 2000). However, difficulty remains in
identifying the functional resistance genes; there are
often sequences that show great similarity to resistance
genes but do not code for a functional product. Degener-
ate PCR was used to detect a major locus for resistance
to downy mildew in sunflower (Gentzbittel et al. 1998).
To clone Pl genes conferring resistance to P. halstedii,
we needed to develop additional markers tightly linked
to these genes. This is possible using either techniques
such as AFLP or targeted strategies such as the modified
AFLP method described by Hayes and Saghai Maroof
(2000). In the present study, we targeted the resistance
loci using PCR and specific primers in two ways: first,
we cloned and sequenced a full-length RGA using
RACE-PCR and specific primers; then we used Bulked
Segregant Analysis (Michelmore et al. 1991) and specif-
ic primers derived from one complete RGA cloned from
sunflower (accession number, AF316405). Thirteen
Fig. 5 Genetic map of the Pl6 locus of the sunflower showing the
localisation of 13 STS sequences. Pl1 and Pl2 correspond to genes
conferring resistance to P. halstedii races 100 and 300 (formerly
races 1 and 2). race700, race703 and race710, correspond to un-
characterised Pl genes conferring resistance to P. halstedii races
700, 703 and 710 respectively (formerly races C, B and A).
S017H3–3 and S124E1–2 are the closest RFLP markers described
in Gentzbittel et al. (1999)
sequence-tagged-sites or STSs (accession numbers, see
Table 2) within the Pl6 locus were then developed.
Sequencing of the full-length sunflower RGA identi-
fied complete signature domains of plant R-genes: TIR,
NBS, LRR. The combination of these domains placed
this sunflower RGA in the L6 (Lawrence et al. 1995),
N (Whitham et al. 1994), and RPP1 (Botella et al. 1998)
family of plant resistance genes. The cloned STS se-
quences showed 22–48% amino-acid identity with
cloned R-genes (N and L6). The 13 STSs differed signif-
icantly with percent identities varying between 57 and
98%, except in the case of Ha-NBS11 which showed
lower percent identities with the other STSs, varying
from 25 to 46%. The variability observed was due both
to substitutions and to insertions-deletions (Fig. 3). For
example, Ha-NBS2/R shows a deletion consisting of
16 amino-acids. Ha-NBS7/R and Ha-NBS14/R show a
25 amino-acid deletion at the same position (Fig. 3)
which may account for their grouping in the phylogenet-
ic analysis and suggests that they may have arisen from
the same mutational event. Sequence comparison of the
13 STSs showed that they contain some highly con-
served domains, in agreement with the finding of Noël et
al. (1999), who showed that the predicted proteins of the
12 non-truncated members of the RPP5 family in A. tha-
liana share a high level of sequence conservation within
the TIR and the NBS domains. These authors concluded
that this is consistent with the TIR domain being in-
volved as a part of the effector portion of the protein, and
the NBS being a conserved pocket for the binding of
ATP or GTP.
The Pl6 locus may contain functional and non-functional
TIR-NBS-LRR sequences
The preliminary studies on the expression of the STSs
showed that either these STSs belong to nonfunctional
genes, or that the level of transcription of these genes is
very low and was not detected by traditional RT-PCR
methods. Another possibility is that these STSs belong to
R-genes which are induced by infection. For example,
Xa1 mRNA was detected from rice leaves at 5 days after
inoculation of both compatible and incompatible strains
of Xanthomonas oryzae pv orysae, but was not detected
in intact leaves (Yoshimura et al. 1998). With the primer
HaP3, the fragment obtained of approximately 700 bases
may correspond to the Ha-NBS11 STS from which two
introns (399 bp and 615 bp) had been removed. How-
ever, these results are preliminary and require other
investigations, in particular the production of complete
cDNA.
The Pl6 locus may span several megabases
In this study, the 13 STS markers were all mapped to the
Pl6 resistance locus on linkage group 1 of the RFLP map
described by Gentzbittel et al. (1999), indicating that
either this subfamily of sequences is highly clustered
and/or that the primers used are highly specific to this
region. Recently, a second major locus for resistance
to downy mildew in sunflower has been detected (Bert
et al. 2001) and we are trying different primer combina-
tions to test whether this second locus contains TIR-
NBS-LRR sequences. In addition, the genetic mapping
of the 13 STSs appears to support the phylogenetic anal-
ysis, with the “susceptible” STSs clustered in one region
while the “resistant” STSs are clustered in another re-
gion of the locus (Fig 4).
These STS markers were located within a genetic dis-
tance of about 3 cM, which suggests that either the Pl6
locus exhibits a high degree of recombination and/or that
it is very large and complex. It is possible that this re-
combination distance reflects a physical organisation of
a cluster probably extending over several hundreds of
kilobases, even some megabases. Many plant resistance
genes appear to be organised as complex clusters. Only a
few clusters of resistance genes have been sequenced.
The complete sequencing of the RPP5 cluster in Arab-
idopsis, the Cf-4/9 and Pto clusters in tomato, and partial
sequencing of the Dm3 cluster in lettuce revealed highly
duplicated regions containing more than 24 resistance-
gene homologs (Michelmore 2000). The Dm3 locus of
lettuce is one example in which numerous related copies
of resistance gene homologues are spread over several
megabases of one chromosome (Meyers et al. 1998a, b).
It will be interesting to develop a physical map of the
Pl6 locus and to see whether it is as complex as the Dm3
locus in lettuce.
The STSs should facilitate marker-assisted selection
Numerous molecular markers closely linked to resistance
genes have been recently developed in many crops; for
example, near the Xa21 gene in rice (Williams et al.
1996), the N gene homologs in potato (Hehl et al. 1999),
the Rsv1 gene in soybean (Hayes and Saghai Maroof,
2000), or the Rph7.g locus in barley (Brunner et al.
2000). In sunflower, the availability of 13 specific PCR-
based markers for the Pl6 locus should facilitate the se-
lection and introgression of these resistance genes into
new varieties. In our laboratory, the primer pair HaP1
has been used successfully for the introgression of the
Pl6 locus into a completely susceptible line (unpublished
results). When the STSs were used as probes in Southern
analysis, they all gave complex patterns. In addition, the
first three primer pairs used in this study gave polymor-
phism not only between the two parents but also between
a set of 24 different sunflower lines (unpublished re-
sults). Together, these results suggest that there is a
potential to develop other molecular markers for the Pl6
locus using other primer pairs specific, for example, to
the LRR domain.
Acknowledgements This study was supported by PROMOSOL,
CETIOM and a grant “Contrat de Plan Etat-Région Semences et
Plants”.
599
Martin GB (1999) Functional analysis of plant disease resistance
genes and their downstream effectors. Curr Opin Plant Biol
2:273–279
Meyers BC, Chin DB, Shen KA, Sivaramakrishnan S, Lavelle
DO, Zhang Z, Michelmore RW (1998a) The major resistance
gene cluster in lettuce is highly duplicated and spans several
megabases. Plant Cell 10: 1817–1832
Meyers BC, Shen KA, Rohani P, Gaut BS and Michelmore RW
(1998b) Receptor-like genes in the major resistance locus of
lettuce are subject to divergent selection. Plant Cell 10:1833–
1846
Meyers BC, Dickerman AW, Michelmore RW, Sivaramakrishnan
S, Sobral BW, Young ND (1999) Plant disease resistance
genes encode members of an ancient and diverse protein fami-
ly within the nucleotide-binding superfamily. Plant J 20:317–
332
Michelmore RW (2000) Genomic approaches to plant disease
resistance. Curr Opin Plant Biol 3:125–131
Michelmore RW, Paran I, Kesseli RV (1991) Identification of
markers linked to disease-resistance genes by bulked segre-
gant analysis: a rapid method to detect markers in specific
genomes. Proc Natl Acad Sci USA 88:9828–32
Miller JF, Gulya TJ (1991) Inheritance of resistance to race 4 of
downy mildew derived from interspecific crosses in sun-
flower. Crop Sci 31:40–43
Mindrinos M, Katagiri F, Yu GL, Ausubel FM (1994) The A. thali-
ana disease resistance gene RPS2 encodes a protein containing
a nucleotide binding site and leucine-rich repeats. Cell 78:
1089–1099
Nicholas KB, Nicholas HB, Deerfield, DW (1997) EMBnet News
4:14
Noël L, Moores TL, van der Biezen EA, Parniske, Daniels MJ,
Parker JE, Jones JDG (1999) Pronounced intraspecific haplo-
type divergence at the RPP5 complex disease resistance locus
of Arabidopsis. Plant Cell 11:2099–2112
Saghai Maroof MA, Soliman KM, Jorgensen RA, Allard RW
(1984) Ribosomal DNA spacer-length polymorphisms in bar-
ley: Mendelian inheritance, chromosomal location, and popu-
lation dynamics. Proc Natl Acad Sci USA 81:8014–8018
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgens
DG (1997) The CLUSTAL-X windows interface: flexible
strategies for multiple sequence alignment aided by quality
analysis tools. Nucleic Acids Res 25:4876–4882
Vear F, Gentzbittel L, Philippon J, Mouzeyar S, Mestries E,
Roeckel-Drevet P, Tourvieille De Labrouhe D, Nicolas P
(1997) The genetics of resistance to five races of downy mil-
dew (Plasmopara halstedii) in sunflower (Helianthus annuus).
Theor Appl Genet 95:584–589
Whitham S, Dinesh-Kumar SP, Choi D, Hehl R, Corr C, Baker B
(1994) The product of tobacco mosaic virus resistance gene N:
similarity to Toll and the interleukin-1 receptor. Cell 78:1101–
1115
Williams CE, Wang B, Holsten TE, Scambray J, de Assis Goes da
Silva F, Ronald PC (1996) Markers for selection of the rice
Xa21 disease resistance gene. Theor Appl Genet 93:1119–
1122
Yoshimura S, Yamanouchi U, Katayose Y, Toki S, Wang ZX,
Kono I, Kurata N, Yano M, Iwata N, Sasaki T (1998) Ex-
pression of Xa1, a bacterial blight-resistance gene in rice, is
induced by bacterial inoculation. Proc Natl Acad Sci USA
95:1663–1668
Yu YG, Buss GR, Maroof MA (1996) Isolation of a superfamily
of candidate disease-resistance genes in soybean based on a
conserved nucleotide-binding site. Proc Natl Acad Sci USA
93: 11751–11756
600
References
Altschul SF, Madden TL, Shaffer AA, Zhang J, Zhang Z, Miller,
W, Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new
generation of protein database search programs. Nucleic Acids
Res 25:3389–3402
Bateman A, Birney E, Durbin R, Eddy SR, Howe KL, Sonnhammer
EL (2000) The Pfam protein families database. Nucleic Acids
Res 28:263–266
Bert PF, Tourvieille de Labrouhe D, Philippon J, Mouzeyar S,
Jouan I, Nicolas P, Vear F (2001) Identification of a second
group of genes controlling resistance to downy mildew
(Plasmopara halstedii) in sunflower (Helianthus annuus L).
Theor Appl Genet (in press)
Bogorad L, Gubbins EJ, Krebbers E, Larrinua IM, Mulligan BJ,
Muskavitch KMT, Orr EA, Rodermel SR, Schantz R,
Steinmetz AA, de Vos G, Ye YK (1983) Cloning and physical
mapping of maize plastid genes. Methods Enzymol 97:524–
554
Botella MA, Parker JE, Frost LN, Bittner-Eddy PD, Beynon JL,
Daniels MJ, Holub EB, Jones JDG (1998) Three genes of the
Arabidopsis RPP1 complex resistance locus recognize distinct
Peronospora parasitica avirulence determinants. Plant Cell
10:1847–1860
Brunner S, Keller B, Feuillet C (2000) Molecular mapping of the
Rph7.g leaf rust resistance gene in barley (Hordeum vulgare
L.). Theor Appl Genet 101:783–788
Burge C, Karlin S (1997) Prediction of complete gene structures
in human genomic DNA. J Mol Biol 268:78–94
Ellis JG, Jones D (1998) Structure and function of proteins con-
trolling strain-specific pathogen resistance in plants. Curr
Opin Plant Biol 1:288–293
Gentzbittel L, Mouzeyar S, Badaoui S, Mestrie E, Vear F,
Tourvieille de Labrouhe D, Nicolas P (1998) Cloning and
molecular markers for disease resistance in sunflower, Helian-
thus annuus L. Theor Appl Genet 96:519–525
Gentzbittel L, Mestries E, Mouzeyar S, Mazeyrat F, Badaoui S,
Vear F, Tourvieille de Labrouhe D, Nicolas P (1999) A com-
posite map of expressed sequences and phenotypic traits of the
sunflower (Helianthus annuus L.) genome. Theor Appl Genet
99:218–234
Hayes AJ, Saghai Marrof MA (2000) Targeted resistance gene
mapping in soybean using modified AFLPs. Theor Appl Genet
100:1279–1283
Hehl R, Faurie E, Hesselbach J, Salamini F, Whitham S, Baker B,
Gebhardt C (1999) TMV resistance gene N homologues
are linked to Synchytrium endobioticum resistance in potato.
Theor Appl Genet 98:379–386
Kanazin V, Marek LF, Shoemaker RC (1996) Resistance gene ana-
logs are conserved and clustered in soybean. Proc Natl Acad
Sci USA 93:11746–11750
Lander ES, Green P, Abrahamson J, Barlow A, Daly MJ, Lincoln
SE, Newburg L (1987) MAPMAKER: an interactive comput-
er package for constructing primary genetic linkage maps
of experimental and natural populations. Genomics 1:174–
181
Lawrence GJ, Finnegan EJ, Ayliffe MA, Ellis JG (1995) The L6
gene for flax rust resistance is related to the Arabidopsis bac-
terial resistance gene RPS2 and the tobacco viral resistance
gene N. Plant Cell 7:1195–1206
Leister D, Ballvora A, Salamini F, Gephardt C (1996) A PCR-
based approach for isolating pathogen resistance genes from
potato with potential for wide application in plants. Nature
Genet 14:421–428
