Content uploaded by Osman Radwan
Author content
All content in this area was uploaded by Osman Radwan
Content may be subject to copyright.
Theor Appl Genet (2003) 106:1438–1446
DOI 10.1007/s00122-003-1196-1
O. Radwan · M.F. Bouzidi · F. Vear · J. Philippon ·
D. Tourvieille de Labrouhe · P. Nicolas · S. Mouzeyar
Identification of non-TIR-NBS-LRR markers linked to the
Pl5
/
Pl8
locus
for resistance to downy mildew in sunflower
Received: 23 July 2002 / Accepted: 11 November 2002 / Published online: 19 February 2003
Springer-Verlag2003
Abstract The resistance of sunflower, Helianthus annuus
L., to downy mildew, caused by Plasmopara halstedii,is
conferred by major genes denoted by Pl. Using degen-
erate and specific primers, 16 different resistance gene
analogs (RGAs) have been cloned and sequenced.
Sequence comparison and Southern-blot analysis distin-
guished six classes of RGA. Two of these classes
correspond to TIR-NBS-LRR sequences while the re-
maining four classes correspond to the non-TIR-NBS-
LRR type of resistance genes. The genetic mapping of
these RGAs on two segregating F2 populations showed
that the non-TIR-NBS-LRR RGAs are clustered and
linked to the Pl5/Pl8 locus for resistance to downy
mildew in sunflower. These and other results indicate that
different Pl loci conferring resistance to the same
pathogen races may contain different sequences.
Keywords Disease resistance · Helianthus annuus ·
Plasmopara halstedii · Non-Toll-Interleukin-1 Receptor
(non-TIR) · Nucleotide Binding Site (NBS) ·
Leucine-Rich Repeats (LRR)
Introduction
Downy mildew, caused by Plasmopara halstedii (Farl.)
Berl. & de Toni, is one of the main diseases causing
economic losses in cultivated sunflower (Helianthus
annuus L.). The resistance to this disease was first shown
by Vranceanu and Stoenescu (1970) to be controlled by
dominant major genes, denoted Pl, following a pattern
which agrees quite well with the gene-for-gene hypothesis
of Flor (1955). So far, ten Pl genes have been described
from both cultivated sunflower (Vranceanu and Stoenescu
1970) and wild Helianthus species (Miller and Gulya
1991; Vear et al. 2000).
Vear et al. (1997) showed that the Pl6 locus from wild
H. annuus (Miller and Gulya 1991) could be split into at
least two genetically distinct regions, one giving resis-
tance to races 100 and 300, and a second giving resistance
to races 700, 703 and 710. Further evidence for the
grouping of resistance genes came from the mapping of
the Pl6 gene by Roeckel-Drevet et al. (1996) in the same
area on the RFLP map (Gentzbittel et al. 1999) as Pl1
(Mouzeyar et al. 1995) and Pl2 (Vear et al. 1997). A
second region carrying downy mildew resistance genes
was reported by Bert et al. (2001), who mapped Pl5 (from
the Russian population Progress) on linkage group 6 and
found that its resistances to races 100, 703 and 710 did not
segregate with those controlled by Pl8 (from Helianthus
argophyllus, Miller and Gulya 1991).
In recent years, many different plant disease-resistant
genes (R-genes) have been cloned and sequenced, greatly
advancing our understanding of molecular genetic mech-
anisms underlying disease resistance in plants (Michel-
more 1995a, b; Staskawicz et al. 1995; Bent 1996;
Hammond-Kosack and Jones 1997; Parker and Coleman
1997; Martin 1999; Ellis et al. 2000).
To isolate R-gene analogs of different crop plants,
well-conserved regions of the NBS domains have been
used to design degenerate primers that amplify resistance
gene analogs (Kanazin et al. 1996; Leister et al. 1996; Yu
et al. 1996; Feuillet et al. 1997; Aarts et al. 1998; Collins
et al. 1998; Gentzbittel et al. 1998; Ohmori et al. 1998;
Shen et al. 1998; Speulman et al. 1998). Two groups of
NBS-LRR (nucleotide binding site-leucine-rich repeats)
resistance genes have been described in plants. The first
group, TIR-NBS-LRR, includes L6 from flax (Lawrence
et al. 1995), N from tobacco (Whitham et al. 1994) and
RPP5 from Arabidopsis thaliana (Parker et al. 1996).
Communicated by C. Mllers
O. Radwan · M. Bouzidi · P. Nicolas · S. Mouzeyar (
)
)
UMR 1095 INRA-UBP “Amlioration et Sant des Plantes”,
Universit Blaise Pascal,
24, Avenue des Landais, 63177 Aubire Cedex, France
e-mail: Said.MOUZEYAR@ovgv.univ-bpclermont.fr
Tel.: +33-4-73407911
Fax: +33-4-73407914
F. Vear · J. Philippon · D. T. de Labrouhe
UMR 1095 INRA-UBP “Amlioration et Sant des Plantes”,
INRA, 234, avenue du Brzet, 63039 Clermont Ferrand Cedex 02,
France
Genes belonging to this group code N-terminal domains
with Toll/interleukin-1 receptor (TIR) homology and are
absent from monocotyledons (Meyers et al. 1999). The
second group, non-TIR-NBS-LRR, includes RPM1 (Grant
et al. 1995) and RPS2 (Bent et al. 1994) from A. thaliana.
Genes belonging to this group lack the TIR domain and
are present in both monocotyledons and dicotyledons
(Meyers et al. 1999).
The NBS sequence of R genes are characterised by the
presence of up to seven conserved domains including the
P-loop, Kinase-2 and GLPL motifs (Meyers et al. 1999).
The presence of these conserved domains has facilitated
the cloning of RGAs from diverse species by PCR, using
degenerate oligonucleotide primers. Identification of
RGAs should help to generate markers for map-based
cloning of resistance genes.
In sunflower, Gentzbittel et al. (1998) used degenerate
primers designed from the conserved NBS domains of N
from tobacco (Whitham et al. 1994), RPS2 from A.
thaliana (Mindrinos et al. 1994) and L6 from flax
(Lawrence et al. 1995). The resulting amplification
products were shown to be members of a multigene
family. One clone was sequenced and mapped close to
Pl6. Sequence analysis of this RGA showed considerable
homology with the nucleotide-binding domains of previ-
ously cloned resistance genes in other species. Bouzidi et
al. (2002) found 13 STSs linked to the Pl6 locus on
linkage group 1 all belonging to the TIR-NBS-LRR
subclass and clustered within about 3 cM which contain
genes giving resistance to downy mildew races 100, 300,
700, 703 and 710. The same markers failed to detect other
resistance loci on other linkage groups.
Gedil et al. (2001a) used degenerate oligonucleotide
primers targeted to conserved NBS DNA sequence motifs
to amplify RGA fragments from sunflower genomic
DNA. PCR products were cloned, sequenced and assigned
to 11 groups. RFLP analysis mapped six RGA loci to
three linkage groups. Four of these RGAs were non-TIR-
NBS-LRR and the rest were TIR-NBS-LRR. In the same
study, one TIR-NBS-LRR RGA (Ha-4w2) was found
linked to the Pl1 gene giving resistance to P. halstedii
race 100. However, the other RGAs cloned, especially
those belonging to the non TIR-NBS-LRR subclass, were
not tested for linkage with other loci giving resistance to
P. halstedii. Therefore, it was interesting to test whether
RGA markers of the non-TIR-NBS-LRR subclass of plant
resistance genes could be linked to Pl loci which
segregate independently of Pl6.
For this purpose, degenerate and specific primers were
used to clone several non-TIR-NBS-LRR RGAs. Four of
these were selected and used as RFLP probes for genetic
mapping of two segregating F2 populations carrying Pl5
and Pl8.
Materials and methods
Sunflower genotypes
The two origins of downy mildew resistance that were studied were
INRA lines YSQ and QIR8. YSQ was developed from a cross
between a line resistant to race 710, provided by Dalgren and Co.
(USA), and a susceptible INRA line (DV). Previous results (Vear et
al. 2000) had shown that its resistance to races 100, 703 and 710 did
not segregate with the resistance gene denoted Pl5, in the line
XRQ, mapped on linkage group 6 by Bert et al. (2001). Since YSQ,
like XRQ, is resistant to all French downy mildew races and to a
Spanish isolate of race 330, but susceptible to an American isolate
of this race, it was considered that the two lines probably contained
the same resistance gene Pl5. QIR8 was bred by INRA from a cross
between an INRA line containing Pl2 (PIR2) and RHA340, a
USDA line containing Pl8 (Miller and Gulya 1991) and resistant to
all known downy mildew races. As for YSQ, the resistance of
RHA340 to races 100, 703 and 710 was found not to segregate with
Pl5 in XRQ (Vear et al. 2000). To check the position of resistance
genes Pl5 and Pl8, and to find RGAs linked with them, crosses
were made between two INRA downy mildew susceptible lines,
OC and CAY, and YSQ and QIR8, respectively. The F1 plants were
selfed to obtain about 200 F2 plants in each case, from which DNA
was isolated. These plants were, in turn, selfed to obtain F3 families
which were tested to determine the resistance genotype of the F2
plants.
Downy mildew races
Tests of downy mildew segregations were made with race 710 for
the F3 progenies of OC YSQ and CAY QIR8. In addition, to
confirm the results of these tests for CAY QIR8, since
segregation between resistance to races 703 and 710 has never
been observed (Vear et al. 1997, 2000; Bert et al. 2001), the
progenies difficult to classify were subjected to tests with race 703,
in a separate growth chamber.
Resistance tests
The downy mildew resistance genotype of each F2 plant was
determined by testing their F3 progenies. For each progeny, at least
20 seedlings were infected and grown as described previously by
Mouzeyar et al. (1993). Seedlings were scored as susceptible if
fungal sporulation was evident on cotyledons and true leaves, and
resistant if no sporulation was observed on true leaves (Mouzeyar et
al. 1993, 1994). Plants with sporulation on cotyledons (Type II
resistance) were considered as resistant, but progenies with many
such plants were re-tested to confirm classification as resistant,
susceptible or segregating. The corresponding F2 plants were then
classified as homozygous susceptible, homozygous resistant, or
heterozygous.
DNA manipulations
Young leaf tissue from the F2 plants was collected and freeze-
dried. DNA was isolated using the CTAB method, as described by
Saghai Maroof et al. (1984). Equal quantities of DNA were bulked
from 12 homozygous-resistant and from 12 homozygous-suscepti-
ble F2 plants, according to the method of Michelmore et al. (1991),
to give the two DNA bulks of each cross.
Oligonucleotide primers and PCR amplification
One degenerate oligonucleotide primer pair (Leister et al. 1996; Yu
et al. 1996) and four specific oligonucleotide primer pairs were
used in this study. The specific primers were designed using the
sunflower RGAs sequences (Genbank Accession number
1439
AF272766, AF272767, AF272768 and AF272769) described by
Gedil et al. (2001a). The sequences of all primer pairs are presented
in Table 1. The PCR amplification with degenerate primers was
carried out with 100 ng of sunflower DNA from the parents and the
two bulks of the OC YSQ cross. In the presence of 0.2 mM of
each dNTP, 1 U (1 ml) of Taq DNA polymerase (Advantage 2,
Clontech, France), 1 Taq polymerase buffer [40 mM Tricine-
KOH pH 8.7, 15 mM KOAc and 3.5 mM Mg(Oac)
2
] and 1 mMof
each primer, PCR was carried out in a 2400 Perkin-Elmer
thermocycler under the following conditions: initial denaturation
at 95 C for 3 min, 40 cycles of 94 C for 30 s, 50 C for 30 s and
72 C for 45 s. The PCR specific primer amplifications were carried
out with 50 ng of DNA in the presence of 0.2 mM of each dNTP,
0.4 U (0.4 ml) of Taq DNA polymerase (Advantage 2, Clontech),
1Taq polymerase buffer and 0.5 mM of each primer. Following
initial denaturaton at 95 C for 3 min, 35 PCR cycles of 94 C for
10 s, 58 C for 30 s and 72 c for 1 min 30 s were performed. PCR
products were separated using standard TAE agarose-gel electro-
phoresis.
RGA cloning and sequence analysis
The PCR products were cloned into the pGEM-T Easy vector
(Promega). A total of 96 colonies were sequenced on both strands
using the Dye-Terminator method (Genome Express, France). The
BLASTX program (Altschul et al. 1997) was used for homology
search against the data banks. The sequences were aligned using the
CLUSTALX software with default options (Thompson et al. 1997)
and the resulting alignments were shaded using the GENEDOC
software (Nicholas et al. 1997).
RFLP analysis and genetic mapping
DNA digestion and Southern hybridisation were performed as
described previously (Gentzbittel et al. 1999) using four restriction
enzymes: EcoRI, EcoRV, HindIII and BglII. The RGA probes were
prepared by digesting 10 mg of the corresponding plasmids with
100 U of the restriction enzyme EcoRI. The digestion products
were separated by standard agarose electrophoresis. The complete
inserts were purified from the gel and used in subsequent
experiments. The different RGAs were tested for polymorphism
and those which produced polymorphic bands on the bulks were
scored on 150 F2 plants of each cross. Two genetic maps were
constructed for linkage group 6, comprising Pl5 and Pl8 polymor-
phic RGA loci, and three RFLP markers from the map of
Gentzbittel et al. (1999). Linkage analysis was made with the
software Mapmaker 3.0 (Lander et al. 1987). Markers were ordered
with a LOD value threshold of 3.0 and a maximum recombination
fraction of 50.
Results
Resistance tests and bulked segregant analysis
Both progenies showed Type II resistance, with plants
showing sporulation on cotyledons. For the cross OC
YSQ, 209 F3 families were first tested with race 710, then
44 that were difficult to classify were re-tested with the
same race, and the conclusion was modified for seven
families. The segregation for OC YSQ was concluded
to be 64 homozygous resistant (RR): 92 heterozygous
(Rr): 53 homozygous susceptible (rr). This agrees with the
hypothesis of a single dominant gene c
2
: 4.22, P > 0.05),
although with a slight excess of plants considered as
homozygous resistant. In the case of the cross CAY
QIR8, when tested with race 710, the F3 progenies were
observed as a segregation of 43 RR: 73 Rr: 19 rr. This is
significantly different from a 1:2:1 segregation (X
2
: 9.43).
Since resistances to races 703 and 710 have co-segregated
without exception in all studies in our laboratory (Vear et
al. 1997, 2000; Bert et al. 2001), to reduce possible error
from difficult observations of reaction to race 710, the 72
progenies, which showed heavy sporulation on cotyledons
with this race, were re-tested with race 703 in a different
growth chamber. In this case there was less sporulation on
cotyledons and it was easier to distinguish resistant and
susceptible plants. Six progenies were observed as Rr
instead of RR, eight as rr instead of Rr and three as rr
instead of RR, giving a final ratio of 34 RR: 71 Rr: 30 rr
(c
2
: 0.60). These conclusions were used for the genotypes
of F2 plants for mapping.
Mapping of loci Pl5 and Pl8
The Pl5 locus showed linkage with two RFLP markers,
S094H3 and S069H3, located on linkage group 6 of the
RFLP map of Gentzbittel et al. (1999). The first was
dominant, revealing a band only in the susceptible bulk
and the susceptible parent OC, whereas the RFLP marker
S069H3 was co-dominant, producing fragments polymor-
phic between the two bulks and the two parents. Mapping
analysis using 150 F2 plants and the two probes revealed
that the Pl5 locus mapped 18.4 cM and 20.4 cM from
S094H3 and S069H3, respectively. Similarly the Pl8
locus in QIR8 showed linkage (21.1 cM) with the RFLP
marker SO17H3
6
, also previously mapped on group 6,
which produced fragments polymorphic between the two
Table 1 Sequences of forward and reverse primers amplifying RGAs linked to Pl5 and Pl8 Degenerate IUB code: I (inosine); R (A or G);
D (G, A or T); Y(C or T)
Primer pair Forward primer sequences Reverse primer sequences
HaNTP1 5'GGIGGIGTIGGIAAIACIAC3' 5'YCTAGTTGTRAYDATDAYYYTRC3'
HaNTP2 5'GGIGGIGTIGGIAAIACIAC3' 5'TTCCCAGTCGTCATAGTTTTCA3'
HaNTP3 5'GAATATTGTATAACGATACACGAG3' 5'TTCCAGTAGCCCTAGAATGAAATG3'
HaNTP4 5'GACATTTATATAACGACGCACAAG3' 5'TTCCAGGAGCCCCCAAATGAAATG3'
HaNTP5 5'GACATTTATATAACGACGCACAAG3 5'TTCCATGGGCACATGAACGAAATG3'
HaNTP6 5'GACTATTGTACAATGAAAAGCAAG3' 5'TTCCAGGAGCACATGCATGAAATG3'
1440
bulks and the two parents. Thus, it was confirmed that Pl5
and Pl8 are located on linkage group 6 and in the same
area (see Fig. 3)
Cloning and sequence analysis of sunflower RGAs
Using DNAs from the parents and the two bulks of the
OC YSQ cross, PCR amplifications were obtained with
the different pairs of primers. The length of the ampli-
fication products were the same for the parental and the
bulked DNAs. The degenerate primer pair HaNTP1
produced an approximately 300-bp band. When we used
the combination between the degenerate and specific
primers, HaNTP2, the approximate 250- and the approx-
imate 300-bp bands were obtained. The specific primer
pairs HaNTP3, HaNTP4 and HaNTP5 produced an
approximate 250-bp band, and the specific primer pair
HaNTP6 gave an amplification product at about 270 bp.
The PCR products were excised, purified from the gel and
cloned into the pGEM-T Easy vector. Fourty eight clones
(24 clones from the resistant parent and 24 clones from
the susceptible one), amplified using the degenerate
primer pair HaNTP1, were chosen randomly and se-
quenced. From the other primer-pair experiments, four
clones from each parent were chosen randomly and
sequenced. A total of 96 clones were sequenced on both
strands. Sequencing results demonstrated that there were
PCR products of different size even with the same primer
pair (Table 2).
Table 2 RFLP profile classification of 16 RGAs amplified from OC and YSQ DNA with degenerate and specific NBS primers
Class
a
RGA Primers Length
(bp)
Parent
b
Polymorphism
c
NBS-LRR
subfamily
Accession
Number
A Ha-NTIR3 HaNTP5 277 Resistant Yes Non-TIR AF528539
Ha-NTIR4 HaNTP5 277 Susceptible Yes Non-TIR AF528540
Ha-NTIR9 HaNTP1 308 Susceptible Yes Non-TIR AF528541
Ha-NTIR16 HaNTP1 308 Resistant Yes Non-TIR AF528542
Ha-NTIR12 HaNTP5 269 Resistant Yes Non-TIR AF528543
B Ha-NTIR5 HaNTP3 277 Susceptible Yes Non-TIR AF528544
Ha-NTIR6 HaNTP3 277 Resistant Yes Non-TIR AF528545
Ha-NTIR10 HaNTP2 284 Resistant Yes Non-TIR AF528546
Ha-NTIR11 HaNTP2 248 Resistant Yes Non-TIR AF528547
Ha-NTIR15 HaNTP2 248 Susceptible Yes Non-TIR AF528548
C Ha-NTIR7 HaNTP4 278 Resistant Yes Non-TIR AF528549
Ha-NTIR8 HaNTP4 278 Susceptible Yes Non-TIR AF528550
D Ha-NTIR2 HaNTP6 277 Resistant Yes Non-TIR AF528551
Ha-NTIR1 HaNTP6 277 Susceptible Yes Non-TIR AF528552
E Ha-TIR13 HaNTP1 308 Susceptible Yes TIR AF528553
F Ha-TIR14 HaNTP1 305 Resistant No TIR AF528554
a
Based on RFLP analysis and sequence comparison
b
The parent from which the fragment was cloned
c
Polymorphism between parents in the crosses OC YSQ and CAY QIR8
Fig. 1 Partial alignment of de-
duced amino-acid sequences of
four non-TIR-NBS-LRR, two
TIR-NBS-LRR RGAs and of
two R-genes, tobacco N (acces-
sion number, U15605) and A.
thaliana RPS2 (accession num-
ber, U14158). The Computer
program CLUSTALX was used
in alignment analysis. Align-
ments were shaded using the
Genedoc software. The Kin-2
domains and Kin-3 are under-
lined. The RNBS-A (FDLx-
AWVCVSQxF) motif is boxed
1441
A total of 52 clones out of 96 shared homology with
genes from the NBS-LRR class of plant resistance genes.
In contrast, 2 out of 48 clones amplified by degenerate
primers showed homology with hypothetical proteins
from A. thaliana, and 42 clones showed no significant
homology with any known gene in the databases. Thus,
these 44 clones were considered as not related to disease
resistance genes and excluded from further analysis.
As expected, homology search showed that all the
clones obtained by specific primers showed homology
with genes from the NBS-LRR class of plant resistance
genes, and with the clones of Gedil et al. (2001a) from
which the primers were derived. For each primer pair
combination, the eight clones sequenced (four clones
originating from each parent) were aligned, and this
showed that some of these clones were identical. After
eliminating this redundancy, the 52 clones were found to
correspond to 16 unique sequences. In order to group
these RGAs, they were used as RFLP probes and those
which had identical RFLP profiles were then arranged in
the same class, giving six classes denoted A to F (Table 2).
Of the 16 RGAs, 14 belonged to the non-TIR-NBS-LRR
subfamily that contains the RPS2 gene from A. thaliana
(Mindrinos et al. 1994), and two RGAs belonged to the
TIR-NBS-LRR subfamily of resistant genes that contains
the N gene from tobacco (Whitham et al. 1994). One
representative RGA from each class was selected for
sequence comparison and alignment. The amino-acid
alignment between four non-TIR-NBS-LRR and two TIR-
NBS-LRR sequences is shown in Fig. 1. Some of the
motifs characteristic of the TIR-NBS-LRR or non-TIR-
NBS-LRR subclasses are indicated according to Meyers
et al. (1999).
Within each class of RGA, the pair-wise identity at the
amino-acid level varied between 85 and 98% within class
A, between 50 and 85% within class B, about 92% within
class C and about 87% within class D. In contrast, classes
E and F contained only one clone each.
When the subfamilies were compared, the identity
between the two RGAs (TIR13 and TIR14) belonging to
the TIR-NBS-LRR subfamily was about 72%, while the
identity between the four RGAs of the non-TIR-NBS-
LRR subfamily ranged from 47 to 68%. The mean percent
identity between the two subclasses was weak and ranged
from 15 to 17% (Table 3).
Similarity between these sequences and those obtained
by Gedil et al. (2001a) ranged from 42% (between Ha-
TIR14 and Ha-IW22) to 96% (between Ha-NTIR3 and
Ha-IB39).
Linkage between sunflower RGAs and the Pl5/Pl8 cluster
Of the 16 RGAs cloned and sequenced, one, TIR14, did
not show any polymorphic profile in either cross using
different restriction enzymes. This RGA was excluded
from further linkage analysis. The RGA TIR13, which
belongs to the TIR-NBS-LRR subclass, showed polymor-
phic bands in both crosses, but none of these bands was
linked to Pl5 or Pl8.
Four RGAs (Ha-NTIR7, Ha-NTIR11, Ha-NTIR2 and
Ha-NTIR3), representative of the 14 clones of the non-
TIR-NBS-LRR subfamily, were used to pursue the
linkage study with the Pl5/Pl8 locus. Southern blots
showed multiple bands of varying intensity with these
probes. Some of these bands were polymorphic between
the two bulks of each cross. An example of a profile
obtained with the Ha-NTIR11 clone is shown in Fig. 2. It
may be noted that for a given RGA probe, all the
Table 3 Percent amino-acid
sequence identities of four non-
TIR-NBS-LRR, two TIR-NBS-
LRR RGAs and of two R-genes
(N from tobacco, Whitham et al.
1994, and RPS2 from A. thali-
ana, Mindrinos et al. 1994).
Values were calculated using
the CLUSTALX program
Item Ha-TIR14 Ha-TIR13 N RPS2 Ha-NTIR2 Ha-NTIR11 Ha-NTIR7
Ha-TIR13 72
N 30 39
RPS2 10 12 12
Ha-NTIR2 16 16 13 22
Ha-NTIR11 15 17 12 20 47
Ha-NTIR7 15 16 14 23 56 57
Ha-NTIR3 15 16 14 22 52 52 68
Fig. 2 Autoradiographs showing the linkage between the Pl5 locus
(A), Pl8 locus (B) and the RGA (Ha-NTIR11) which was used as a
RFLP probe. Downy mildew phenotypes: R homozygous resistant,
S homozygous susceptible and H heterozygous. The polymorphic
bands between the parent and the two bulks of each cross are
indicated by the arrows
1442
polymorphic bands were found absolutely linked and thus
were considered as unique loci.
All the non-TIR-NBS-LRR RGAs were found linked
to Pl5 and Pl8, and the RFLP markers S094H3, S069H3
and S017H3
6
on linkage group 6 of the map of Gentzbittel
et al. (1999). The map of the regions containing Pl5 and
Pl8 is shown in Fig. 3A and B. The closest markers to Pl5
were Ha-NTIR7H3 and Ha-NTIR3E5 at 2 cM and 4.1 cM,
respectively; the marker Ha-NTIR2H3 mapped 52 cM
from Pl5 (Fig. 3A). The closest markers to Pl8 were Ha-
NTIR7H3 and Ha-NTIR11H3 at 4.5 cM and 8 cM,
respectively; the Ha-NTIR3H3 marker mapped at 18.7 cM
from Pl8 (Fig. 3B).
Discussion
Mapping of Pl5 and Pl8 on linkage group 6
Bert et al. (2001) reported that Pl5, present in the inbred
line XRQ, was linked to ten AFLP markers and two RFLP
markers, S094H3 and S034H3, on linkage group 6 of the
map of Gentzbittel et al. (1999). Pl5 was found to be
situated at 36 cM from the first RFLP and 38 cM from the
second (Bert et al. 2002). It was 27 cM from Rf1, the
restoration gene. In this study, a different RFLP marker,
S069H3, reported by Gentzbittel et al. (1999) to be 1 or
2 cM from S034H3 and S094H3, confirmed that the Pl5
gene in the line YSQ was also situated on linkage group 6,
in the same area. The difference in positioning, about
15 cM, is probably due to the different segregating
populations used for mapping, but the difficulties in
determining downy mildew resistance genotypes in the
presence of Type II resistance could also contribute to the
difference.
Bert et al. (2001) reported that the resistance controlled
by Pl8 did not segregate with that of Pl5. The results
presented here demonstrate that Pl5 and Pl8 are linked,
and may form a major cluster for resistance to all known
races of P. halstedii on linkage group 6. The linkage of
Pl8 to S017H3
6
confirms the position of the locus close to
this RFLP marker suggested by Bert et al. (2001).
According to their position relative to the marker Ha-
NTIR7H3, resistance to races 703 and 710 controlled by
Pl5 and Pl8 may be separated by about 2 cM. This
distance indicates the possible complexity of the locus.
The clustering of the resistance genes has been reported
for many plant species such as the Cf4/Cf9 cluster in
tomato (Parniske et al. 1999) and Dm3 in lettuce
(Michelmore 2000). In sunflower, a major cluster for
resistance to downy mildew had been described on
linkage group 1 (Bouzidi et al. 2002), with genes also
conferring resistance to all known races of downy
mildew, so the two clusters appear to be functionally
similar and it was important to determine whether they
have different structures.
Linkage of non-TIR-NBS-LRR RGAs
to the Pl5/Pl8 cluster
Since the initial cloning of some plant resistance genes,
several research groups have demonstrated that PCR-
amplification-conserved disease-resistance motifs can be
used to identify disease-resistance loci (Kanazin et al.
1996; Leister et al. 1996; Yu et al. 1996; Hayes and
Saghai Maroof 2000). In sunflower, a TIR-NBS-LRR
RGA was localised within the Pl6 locus by Gentzbittel et
al. (1998) using degenerate primers. In a similar study,
Gedil et al. (2001a) used two pairs of degenerate
oligonucleotide primers and obtained different RGAs
from sunflower. They reported that three markers (HR-
1W23, HR-1B39 and HR-1W41) were clustered on one
end of linkage group 13 of the map of Gedil et al.
(2001b). All of the NBS clones that detected these loci
were of the non-TIR-NBS-LRR subfamily and shared 56–
69% amino-acid identity. They also found that two TIR-
NBS-LRR markers segregated independent of other RGA
loci (HR-4W2 and HR-1W22) that were mapped on
linkage groups 8 and 15 of the map of Gedil et al.
(2001b). Thus it appears that there are both TIR-NBS-
LRR and non-TIR-NBS-LRR sequences in sunflower and
that they may be distributed in different regions of the
sunflower genome. Bouzidi et al. (2002) reported that the
Fig. 3 Genetic map of sunflower linkage group 6 showing the
relative positions of downy mildew resistance loci Pl5 (A), Pl8 (B),
RGA (Ha-NTIR7H3, accession number AF528549; Ha-NTIR3E5,
accession number AF528539; Ha-NTIR11H3, accession number
AF528547; Ha-NTIR3H3, accession number AF528539 and Ha-
NTIR2H3, accession number AF528551) and RFLP markers
(S069H3, S094H3 and S017H3
6
). RFLP markers are shown in
bold. Genetic distances were calculated using the Kosambi map
function and are shown in centimorgans (cM). The suffixes E5 and
H3 indicate the restriction enzymes EcoRV and HindIII respec-
tively
1443
Pl6 locus on linkage group 1 of the map of Gentzbittel et
al. (1999) appears to contain only TIR-NBS-LRR RGAs.
None of these markers detected other resistance loci on
other linkage groups.
In a recent study Yu et al. (2002) concluded that, by
mapping phenotypic marker loci such as downy mildew
resistance (Pl genes) and fertility restoration (Rf1)on
different RFLP maps made up of different anonymous
RFLP probes, linkage groups 1 and 6 of the map of
Gentzbittel et al. (1999) correspond respectively to
linkage groups 8 and 13 of the map of Yu et al. (2002).
In addition, Yu et al. (2002) mapped SCAR markers that
were previously linked to the rust resistance genes R1 and
Radv (Lawson et al. 1998) on linkage groups 8 and 13,
respectively, of the map of Yu et al. (2002). As stated by
these authors, the two linkage groups contain duplicated
clusters for resistance both to P. halstedii and Puccinia
graminis. It will be interesting to verify for each linkage
group whether these clusters are overlapping or that they
are tightly linked.
In this study, RGAs of the non-TI R-NBS-LRR
subclass were cl oned using either degenerate or specific
primers. As expected, the clones obtained wer e similar to
those of Gedil et al. (2001a) but not identical. The
percentage identity between the clones described by
Gedil et al. (2001a) and those obtained in the present
work varied bet ween 42 % (between Ha-TIR14, this
work, and Ha-IW22, Gedil et al. 2001a) and 96%
(between Ha-NTI3, this work, and Ha-IW41, Gedil et
al. 2001a) . These variations in sequence comparison may
indicate that eit her the different sequences are part of
different genes and/or that it is due to sequence variation
between sunflower lines. The identification of these
RGAs was based on the conservation of some motifs or
amino-acid characteristics of the non-TIR-NBS-LRR
subfa mily (Meyers et al . 1999). TIR and no n-TIR-NBS-
LRR sequences are distinguishable by amino -acid mo tifs
internal to the NBS domains while some of the motifs are
present in both sub classes such as P-loop or G LPL
motifs. Sequence comparison of the RGAs obtained in
this study, and partial sequences from RPS2 (Mindri nos
et al. 1994) and N (Whitham et al. 1994) genes, showed
the presence of the motif RNBS-A (FDLx -
AWVCVSQxF) which is characteristic of the non-TIR-
NBS-LRR sequ ences (Meyers et al. 1999). The presence
of a tryptophan residue (W) as the final amino ac id in
motif Kinase-2 in some sequences, and an aspartic acid
(D) in others, can be used to distinguish the two
subclasses (Meyers et al. 1999; Penuela et al. 2002).
The last author s exploited the existence of conserved
motifs characteristic of each subclass to clone specifi-
cally non-TIR-NBS-LRR RGAs in soybean. In the
grapevine genome , Donal d et al. (2002) reported that
analysis of the Kinase motifs predicted that 19 out of the
22 RGA cl ones, obtaine d using this PCR strategy, were
of the non-TIR subfamily.
The present results showed that the Pl5 and Pl8
regions on linkage group 6 of the map of Gentzbittel et al.
(1999) appear linked to the RGAs of the non-TIR-NBS-
LRR subfamily (Ha-NTIR7H3, Ha-NTIR11H3, Ha-
NTIR3E5, Ha-NTIR2H3 and Ha-NTIR3H3). In contrast,
one marker (Ha-TIR13H3) of the TIR-NBS-LRR sub-
family segregated independently of the other RGAs of the
non-TIR-NBS-LRR subfamily, and Pl5 and Pl8. These
results and those of Bouzidi et al. (2002) indicate that in
sunflower there are at least two regions controlling
resistance to the same races of P. halstedii and that these
regions may contain different types of NBS-LRR se-
quences. However, further RGAs of both classes should
be cloned and mapped to test this hypothesis. If the Pl1/
Pl2/Pl6 cluster on linkage group 1 and the Pl5/Pl8 cluster
on linkage group 6 contain different classes of NBS-LRR
RGAs, conferring resistance to the same races of P.
halstedii, then the markers developed here and those of
Gedil et al. (2001a) and Bouzidi et al. (2002) will be
useful in marker-assisted selection to accumulate different
Pl genes in the same sunflower variety, which may
enhance the durability of field resistance.
Acknowledgements We thank F. Cambon, S. Roche and P. Walser
for their technical assistance. The first author thanks the Egyptian
Ministry of Higher Education for a Doctoral Scholarship. This
study was supported by PROMOSOL. Some equipment was
financed by a state-region grant “Qualit des Aliments”.
References
Aarts MGM, te Lintel Hekkert B, Holub ED, Beynon JL, Stiekema
WJ, Pereia A (1998) Identification of R-gene homologous DNA
fragments genetically linked to disease resistance loci in
Arabidopsis thaliana. Mol Plant–Microbe Interact 11:251–258
Altschul SF, Madden TL, Schaffer AA, Zhang Z, Miller W, Lipman
DJ (1997) Gapped BLAST and PSI-BLAST: a new generation
of protein database search programs. Nucleic Acids Res 25:
3389–3402
Bent AF (1996) Plant disease resistance gene-function meets
structure. Plant Cell 8:1757–1771
Bent AF, Kunkel BN, Dahlbeck D, Brown KL, Schmidt R,
Giraudat J, Leung J, Staskawicz BJ (1994) RPS2ofArabidopsis
thaliana: a leucine-rich repeat class of plant disease resistance
genes. Science 265:1856–1860
Bert PF, Tourvieille de Labrouhe D, Philippon J, Mouzeyar S,
Jouan I, Nicolas P, Vear F (2001) Identification of a second
linkage group carrying genes controlling resistance to downy
mildew (Plasmopara halstedii) in sunflower (Helianthus
annuus L.). Theor Appl Genet 103:992–997
Bert PF, Jouan I, Tourvieille de Labrouhe D, Serre F, Nicolas P,
Vear F (2002) Comparative genetic analysis of quantitative
traits in sunflower (Helianthus annuus L.). 1. QTLs involved in
resistance to Sclerotinia sclerotiorum and Diaporthe helianthi.
Theor Appl Genet (in press)
Bouzidi MF, Badaoui S, Cambon F, Vear F, Tourvieille de
Labrouhe D, Nicolas P, Mouzeyar S (2002) Molecular analysis
of a major locus for resistance to downy mildew in sunflower
with specific PCR-based markers. Theor Appl Genet 104:592–
600
Collins NC, Webb CA, Seah S, Ellis JG, Hulbert SH, Pryor A
(1998) The isolation and mapping of disease resistance gene
analogs in maize. Mol Plant–Microbe Interact 11:968–978
Donald TM, Pellerone F, Adam-Blondon AF, Bouquet A, Thomas
MR, Dry LB (2002) Identification of resistance gene analogs
linked to the powdery mildew resistance locus in grapevine.
Theor Appl Genet 104:610–618
1444
Ellis J, Dodds P, Pryor T (2000) Structure, function and evolution
of plant disease resistance genes. Curr Opin Plant Biol 3:278–
284
Feuillet C, Schachermayr G, Keller B (1997) Molecular cloning of
a new receptor-like kinase gene encoded at the Lr10 disease
resistance locus of wheat. Plant J 11:45–52
Flor HH (1955) Host-parasite interaction in flax rust: its genetics
and other implications. Phytopathology 45:680–685
Gedil MA, Slabaugh MB, Berry S, Johnson R, Michelmore R,
Miller J, Gulya T, Knapp SJ (2001a) Candidate disease
resistance genes in sunflower cloned using conserved nucleo-
tide-binding site motifs: genetic mapping and linkage to the
downy mildew resistance gene Pl1. Genome 44:205–212
Gedil MA, Wye C, Berry S, Segers B, Peleman J, Jones R, Leon A,
Slabaugh MB, Knapp SJ (2001b) An integrated restriction
fragment length polymorphism-amplified fragment length
polymorphism linkage map for cultivated sunflower. Genome
44:213–221
Gentzbittel L, Mouzeyar S, Badaoui S, Mestries E, Vear F,
Tourvieille de Labrouhe D, Nicolas P (1998) Cloning of
molecular markers for disease resistance in sunflower, He-
lianthus annuus L. Theor Appl Genet 96:519–525
Gentzbittel L, Mestries E, Mouzeyar S, Mazeyrat F, Badaoui S,
Vear F, Tourvieille de Labrouhe D, Nicolas P (1999) A
composite map of expressed sequences and phenotypic traits of
the sunflower (Helianthus annuus L.) genome. Theor Appl
Genet 99:218–234
Grant MR, Godiard L, Straube E, Ashfield T, Lewald J, Sattler A,
Innes RW, Dangl JL (1995) Structure of the Arabidopsis RPM1
gene enabling dual specificity disease resistance. Science
269:843–846
Hammond-Kosack KE, Jones JDG (1997) Plant disease resistance
genes. Annu Rev Plant Physiol Mol Biol 48:575–607
Hayes AJ, Saghai Maroof MA (2000) Targeted resistance gene
mapping in soybean using modified AFLPs. Theor Appl Genet
100:1279–1283
Kanazin V, Marek LF, Shoemaker RC (1996) Resistance gene
analogs are conserved and clustered in soybean. Proc Natl Acad
Sci USA 93:11,746–11,750
Lander ES, Green P, Abrahamson J, Barlow A, Daly MJ, Lincoln
SE, Newburg L (1987) MAPMAKER: an interactive computer
package for constructing primary genetic linkage maps of
experimental and natural populations. Genomics 1:174–181
Lawrence GJ, Finnegan EJ, Ayliffe MA, Ellis JG (1995) The L6
gene for flax rust resistance is related to the Arabidopsis
bacterial resistance gene RPS2 and the tobacco viral resistance
gene N. Plant Cell 7:1195–1206
Lawson WR, Goulter KC, Henry RJ, Kong GA, Kochman JK
(1998) Marker-assisted selection for two rust resistance genes
in sunflower. Mol Breed 4:227–234
Leister D, Ballvora A, Salamini F, Gebhardt C (1996) A PCR-based
approach for isolating pathogen resistance genes from potato
with potential for wide application in plants. Nature Genet
14:421–429
Martin GB (1999) Functional analysis of plant disease genes and
their downstream effectors. Curr Opin Plant Biol 2:273–279
Meyers BC, Dickerman AW, Michelmore RW, Pecherer RM,
Sivaramakrishnan S, Sobral B, Young ND (1999) Plant disease
resistance genes encode members of an ancient and diverse
protein family within the nucleotide binding super family. Plant
J 20:317–332
Michelmore RW (1995a) Isolation of disease resistance genes from
crop plants. Curr Opin Biotechnol 6:145–152
Michelmore RW (1995b) Molecular approaches to manipulation of
disease resistance genes. Annu Rev Phytopathol 15:393–727
Michelmore RW (2000) Genomic approaches to plant disease
resistance. Curr Opin Plant Biol 3:125–131
Michelmore RW, Paran I, Kesseli RV (1991) Identification of
markers linked to disease resistance genes by bulked segregant
analysis: a rapid method for markers in specific genomic
regions by using segregating populations. Proc Natl Acad Sci
USA 88:9828–9832
Miller JF, Gulya TJ (1991) Inheritance of resistance to race 4 of
downy mildew derived from interspecific crosses in sunflower.
Crop Sci 31:40–43
Mindrinos M, Katagiri F, Yu GL, Ausubel FM (1994) The A.
thaliana disease-resistance gene RPS2 encodes a protein
containing a nucleotide binding site and leucine-rich repeats.
Cell 78:1089–1099
Mouzeyar S, Tourvieille de Labrouhe D, Vear F (1993) Histopath-
ological studies of resistance of sunflower (Helianthus annuus
L.) to downy mildew (Plasmopara halstedii). J Phytopathol
139:289–297
Mouzeyar S, Tourvieille de Labrouhe D, Vear F (1994) Effect of
host-race combination on resistance of sunflower (Helianthus
annuus L.) to downy mildew (Plasmopara halstedii). J
Phytopathol 141:249–258
Mouzeyar S, Roeckel-Drevet P, Gentzbittel L, Philippon J,
Tourvieille de Labrouhe D, Vear F, Nicolas P (1995) RFLP
and RAPD mapping of the sunflower Pl1 locus for resistance
toPlasmopara halstedii race 1. Theor Appl Genet 91:733–737
Nicholas KB, Nicholas HB, Deerfield, DW (1997) EMBnet News
4: 14
Ohmori T, Murata M, Motoyoshi F (1998) Characterization of
disease resistance gene-like sequences in near-isogenic lines of
tomato. Theor Appl Genet 96:331–338
Parker JE, Coleman MJ (1997) Molecular intimacy between
proteins specifying plant–pathogen recognition. Trends Bio-
chem Sci 22:291–296
Parker JE, Holub EB, Frost LN, Falk A, Gunn ND, Daniels MJ
(1996) Characterization of eds 1, a mutation in Arabidopsis
suppressing resistance to Peronospora parasitica specified by
several different RPP genes. Plant Cell 8:2033–2046
Parniske M, Wulff BB, Bonnema G, Thomas CM, Jones DA, Jones
JD (1999) Homologues of the Cf-9 disease resistance gene
(Her9s) are present at multiple loci on the short arm of tomato
chromosome 1. Mol Plant Microbe Interact 12:93–102
Penuela S, Danesh D, Young ND (2002) Targeted isolation,
sequence analysis, and physical mapping of non-TIR NBS-LRR
genes in soybean. Theor Appl Genet 104:261–272
Roeckel-Drevet P, Gagne G, Mouzeyar S, Gentzbittel L, Philippon
J, Nicolas P, Tourvieille de Labrouhe D, Vear F (1996)
Colocation of downy mildew (Plasmopara halstedii) resistance
genes in sunflower (Helianthus annuus L.). Euphytica 91:225–
228
Saghai Maroof MA, Soliman KM, Jorgensen RA, Allard RW
(1984) Ribosomal DNA spacer-length polymorphisms in bar-
ley: Mendelian inheritance, chromosomal location, and popu-
lation dynamics. Proc Natl Sci USA 81:8014–8018
Shen KA, Keyers BC, Islam-Faridi MN, Chin DB, Stelly DM,
Michelmore RW (1998) Resistance gene candidate identified
by PCR with degenerate oligonucleotide primers map to
clusters of resistance genes in lettuce. Mol Plant–Microbe
Interact 11:815–823
Speulman E, Bouchez D, Holub ED, Beynon JL (1998) Disease
resistance gene homologs correlate with disease resistance loci
of Arabidopsis thaliana. Plant J 14:467–474
Staskawicz BJ, Ausubel FM, Baker Bj, Ellis JG, Jones JDG (1995)
Molecular genetics of plant disease resistance. Science
268:661–667
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgens DG
(1997) The CLUSTAL-X windows interface: flexible strategies
for multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Res 25:4876–4882
Vear F, Gentzbittel L, Philippon J, Mouzeyar S, Mestries E,
Roeckel-Drevet P, Tourvieille de Labrouhe D, Nicolas P (1997)
The genetics of resistance to five races of downy mildew
(Plasmopara halstedii). Theor Appl Genet 95:584–589
Vear F, Philippon J, Roche S, Walser P, Tourvieille de Labrouhe D,
Mouzeyar S, Nicolas P (2000) Genetical analysis of the
sunflower downy mildew resistance gene Pl5. 15th Int
Sunflower Conf, Toulouse-France, pp 53–66
1445
Vranceanu V, Stoenescu F (1970) Immunity to sunflower downy
mildew due to a single dominant gene. Probleme Agric 22:34–
40
Whitham S, Dinesh-Kumar SP, Choi D, Hehl R, Corr C, Baker B
(1994) The product of tobacco mosaic virus resistance gene N:
similarity to Toll and interleukin-1 receptor. Cell 78:1101–1115
Yu Yg, Buss GR, Saghai Maroof MA (1996) Isolation of the super
family of candidate disease-resistance genes in soybean based
on a conserved nucleotide-binding site. Proc Natl Acad Sci
USA 93:11,751–11,756
Yu JK, Tang S, Slabaugh MB, Heesacker A, Cole G, Herring MJ,
Soper J, Han F, Chu WC, Webb DM, Thompson L, Edwards
KJ, Berry S, Leon A, Olungu C, Maes N, Knapp SJ (2002)
Towards a saturated molecular genetic linkage map for
cultivated sunflower. Crop Sci (in press)
1446
