No full-text available
To read the full-text of this research,
you can request a copy directly from the authors.
Development of a yeast-based recombination cloning/system for the analysis of gene products from diverse human immunodeficiency virus type 1 isolates
Abstract
A recent shift from studies on a few subtype B laboratory human immunodeficiency virus type 1 (HIV-1) clones to analyses of extremely diverse primary HIV-1 isolates from different subtype requires the development of a rapid and generic cloning technique. This report describes the use of gap repair/recombination in yeast to shuttle env, gag, and pol genes from diverse HIV-1 subtypes into a DNA vector that can be amplified in bacteria and can express the gene of interest in mammalian cells. These diverse HIV-1 genes have also been introduced into an infectious clone to produce chimeric viruses that are useful for studies on drug susceptibility, receptor binding and fitness.
... These overlapping 5′ and 3′ patient-specific HIV-1 DNA fragments were transfected into Saccharomyces cerevisiae along with linearized pREC-nflΔgenome/ URA3. Following a double recombination event in yeast, all resulting colonies were harvested to acquire maximum viral diversity-a process well described in multiple articles [16][17][18] (Fig. S1). The DNAs were then transfected into 293T cells to produce VPs. ...
... VP and VLP vaccine production All formulations were cloned using a similar protocol to that previously described and schematically depicted in Figure S1. [16][17][18] Briefly, seraderived viral RNA was isolated using a viral RNA Isolation Kit (Qiagen, USA) and reverse transcribed to cDNA (Agilent Technologies, USA) using two primers to generate a 5′ (5020R) and 3′ (1.R3.B3.R) fragment encompassing the entire HIV-1 genome. The two overlapping cDNA fragments were then PCR amplified in a nested PCR protocol using 5′ and 3′ primer pairs described in Table S1. ...
... A radioactive RT assay was also used to measure VP and VLP levels in cellfree supernatants as described previously. 18 Viral proteins in formulations were also analyzed by western blot using NuPAGE Novex 3-8% Tris-Acetate Protein Gels (Thermo-Fischer Scientific) and a 1:100 dilution of heat-inactivated serum derived from SHIV-infected macaques, before addition of a 1:2000 dilution of goat anti-monkey IgG: horseradish peroxidase (HRP) (Bio-Rad). Samples were then developed with 3,3′diaminobenzidine (DAB) SK-4100 (Vector Laboratories). ...
First identified as the etiological agent behind Acquired Immunodeficiency Syndrome (AIDS) in the early 1980s, HIV-1 has continued to spread into a global pandemic and major public health concern. Despite the success of antiretroviral therapy at reducing HIV-1 viremia and preventing the dramatic CD4+ T-cell collapse, infected individuals remain HIV positive for life. Unfortunately, it is increasingly clear that natural immunity is not, and may never be, protective against this pathogen. Therefore, efficacious vaccine interventions, which can either prevent infection or eradicate the latent viral reservoir and effect cure, are a major medical priority. Here we describe the development of a safe vaccine platform, currently being utilized in on-going prophylactic and therapeutic preclinical studies and consisting of highly heterogeneous virus-like particle formulations that represent the virus diversity within infected individuals. These VLPs contain no 5'LTR, no functional integrase, and have a severely mutated stem loop 1-thereby preventing any potential reverse transcription, integration, and RNA packaging. Furthermore, we demonstrate that these VLPs are morphologically identical to wild-type virus with polyvalent Env in a functional form. Finally, we show that the VLPs are antigenic and capable of generating strong immune recall responses.
... Sites of predicted amino acid substitutions within or near these epitopes were also mapped to the p24 [36] and gp120 crystal structures [37] (Figures 2B and 3B, respectively). For the current analyses, p24 and gp120 coding regions were PCRamplified from patient 1362 PBMC and then cloned into an HIV-1 NL4-3 background genome by yeast homologous recombination (Figure 1, Figure S1 and Protocol S1 online) [38]. We have previously reported on the cloning of two CTL escape mutations in one of the p24 epitopes (EW10) [35]. ...
... PCR reactions were conducted using PlatinumH Taq DNA Polymerase High Fidelity following the manufacturer's recommendation (Invitrogen). Primers ENV START and ED12- EXT [38], and GAD5 and GAD4 (Table S1 online) were used for the gp120 and p24 amplifications, respectively. PCR products were inserted into two versions of the NL4-3 HIV-1 molecular clone, pNL4-3 vifA and pNL4-3 vifB , differing at only six synonymous nucleotides in the HIV-1 vif gene, using a previously described yeast-based recombination system [38] (Figure S1 online). ...
... Primers ENV START and ED12- EXT [38], and GAD5 and GAD4 (Table S1 online) were used for the gp120 and p24 amplifications, respectively. PCR products were inserted into two versions of the NL4-3 HIV-1 molecular clone, pNL4-3 vifA and pNL4-3 vifB , differing at only six synonymous nucleotides in the HIV-1 vif gene, using a previously described yeast-based recombination system [38] (Figure S1 online). Infectious HIV-1 chimeras were produced by transfection of NL4-3/gp120 and NL4-3/p24 into 293T cells as previously described [38]. ...
Human lymphocyte antigen (HLA)-restricted CD8(+) cytotoxic T lymphocytes (CTL) target and kill HIV-infected cells expressing cognate viral epitopes. This response selects for escape mutations within CTL epitopes that can diminish viral replication fitness. Here, we assess the fitness impact of escape mutations emerging in seven CTL epitopes in the gp120 Env and p24 Gag coding regions of an individual followed longitudinally from the time of acute HIV-1 infection, as well as some of these same epitopes recognized in other HIV-1-infected individuals. Nine dominant mutations appeared in five gp120 epitopes within the first year of infection, whereas all four mutations found in two p24 epitopes emerged after nearly two years of infection. These mutations were introduced individually into the autologous gene found in acute infection and then placed into a full-length, infectious viral genome. When competed against virus expressing the parental protein, fitness loss was observed with only one of the nine gp120 mutations, whereas four had no effect and three conferred a slight increase in fitness. In contrast, mutations conferring CTL escape in the p24 epitopes significantly decreased viral fitness. One particular escape mutation within a p24 epitope was associated with reduced peptide recognition and high viral fitness costs but was replaced by a fitness-neutral mutation. This mutation appeared to alter epitope processing concomitant with a reduced CTL response. In conclusion, CTL escape mutations in HIV-1 Gag p24 were associated with significant fitness costs, whereas most escape mutations in the Env gene were fitness neutral, suggesting a balance between immunologic escape and replicative fitness costs.
... PBMC from CCR5 wild type individuals were treated for 1h with 640 nM RANTES, 100 nM AOP- RANTES or 100 nM PSC-RANTES, then fixed with paraformaldehyde, stained with MAb 2D7, 45531 or 45523 and analyzed by flow cytometry. similar pattern of genetic changes had occurred during the development of SCH-D resistance by the same virus, we made clonal, SCH-D-resistant viruses by cassetting env genes from the resistant isolates into the NL4-3 background (Kuhmann et al., 2004; Marozsan and Arts, 2003; Marozsan et al., 2005). The same procedure was used to make clonal, chimeric viruses from the PC isolates (Marozsan and Arts, 2003; Marozsan et al., 2005). ...
... similar pattern of genetic changes had occurred during the development of SCH-D resistance by the same virus, we made clonal, SCH-D-resistant viruses by cassetting env genes from the resistant isolates into the NL4-3 background (Kuhmann et al., 2004; Marozsan and Arts, 2003; Marozsan et al., 2005). The same procedure was used to make clonal, chimeric viruses from the PC isolates (Marozsan and Arts, 2003; Marozsan et al., 2005). The V3 sequences of the chimeric viruses were determined, as were IC 50 values for SCH-D inhibition of the replication of some of the chimeras in primary CD4 + T-cells (Fig. 7A). ...
... D1/85.16, D101.PC.12 and D101.12 env genes from infected PBMC, and a partial analysis of their sequences, were accomplished by using a newly developed yeast recombination system that offers several advantages over previous methods (Marozsan and Arts, 2003). Briefly, the env gene was PCR-amplified from the respective virus isolates using the Env-Start and Env-End primers (Marozsan and Arts, 2003). ...
We describe the generation of two genetically related human immunodeficiency virus type 1 (HIV-1) isolates highly (>20,000-fold) resistant to the small molecule CCR5 inhibitor, SCH-417690 (formerly SCH-D). Both viruses were cross-resistant to other small molecules targeting entry via CCR5, but they were inhibited by some MAbs against the same coreceptor on primary CD4+ T-cells. The resistant isolates remained sensitive to inhibitors of other stages of virus entry, and to replication inhibitors acting post-entry. Neither escape mutant could replicate detectably in peripheral blood mononuclear cells (PBMC) from two donors homozygous for the CCR5-Delta32 allele and both were insensitive to the CXCR4-specific inhibitor, AMD3100. Hence, the SCH-D escape mutants retained the R5 phenotype. One of the resistant isolates was, however, capable of replication in U87.CD4.CXCR4 cells and, after expansion in those cells, was sensitive to AMD3100 in primary CD4+ T-cells. Hence, some X4 variants may be present in this escape mutant swarm. A notable observation was that the SCH-D escape mutants were also cross-resistant to PSC-RANTES and AOP-RANTES, chemokine derivatives that are reported to down-regulate cell surface CCR5 almost completely. However, the extent to which CCR5 is down-regulated was dependent upon the detection MAb. Hence, the escape mutants may be using a CCR5 configuration that is only detected by some anti-CCR5 MAbs. Finally, two SCH-D-resistant clonal viruses revealed no amino acid changes in the gp120 V3 region relative to the parental viruses, in marked contrast to clones resistant to the AD101 small molecule CCR5 inhibitor that possess 4 such sequence changes. Several sequence changes elsewhere in gp120 (V2, C3 and V4) were present in the SCH-D-resistant clones. Their influence on the resistant phenotype remains to be determined.
... This r5 HIV-1 concentration likely saturated the susceptible CCR5+/CD4+ cells in the PBMC culture. Nonetheless, some inhibition of the more abundant "CCR5"-using component in the B12 and B19 viruses did reduce the overall fitness of B12 and C19-24 .......................................................................................I............................................ C19-28 .......................................................................................I............................................ C19-30 .......................................................................................I............................................ C19-15 .......................................................................................I....................................I....... C19-23 .......................................................................................I....................................I....... C19-3 .......................................................................................I.....................W...................... C19-12 ...................V...................................................................I............................................ C19-16 ...................V...................................................................I............................................ C19-22 ...................V...................................................................I....................................I....... C19-5 A..................V................T..................................................I....................................I....... C19-10 A..................V................T..................................................I....................................I....... C19-9 ...................V...................................................................I....................................... Fig. 1) were cloned into pREC_env/URA3 via yeast-based recombination/gap repair [81,82]. A 132 and 118 amino acid sequence of the C2-V3 region was used to group the C19 (a) and C27 (b) based on sequence identity/difference. ...
... This PCR product was then cloned into a yeast vector by homologous recombination as described elsewhere. Briefly, the PCR amplified gp160 was cloned into a SacII linearized pREC_ nfl_HIV-1 nl4-3 env/URA3 vector by homologous recombination as already described [81,82]. Thirty colonies were picked for each of the dual-tropic isolates. ...
Background:
CCR5-using (r5) HIV-1 predominates during asymptomatic disease followed by occasional emergence of CXCR4-using (x4) or dual tropic (r5x4) virus. We examined the contribution of the x4 and r5 components to replicative fitness of HIV-1 isolates.
Methods:
Dual tropic r5x4 viruses were predicted from average HIV-1 env sequences of two primary subtype C HIV-1 isolates (C19 and C27) and from two patient plasma samples (B12 and B19). Chimeric Env viruses with an NL4-3 backbone were constructed from the B12 and B19 env sequences. To determine replicative fitness, these primary and chimeric dual tropic HIV-1 were then competed against HIV-1 reference isolates in U87.CD4 cells expressing CXCR4 or CCR5 or in PBMCs ± entry inhibitors. Contribution of the x4 and r5 clones within the quasispecies of these chimeric or primary HIV-1 isolates were then compared to the frequency of x4, r5, and dual tropic clones within the quasispecies as predicted by phenotypic assays, clonal sequencing, and 454 deep sequencing.
Results:
In the primary HIV-1 isolates (C19 and C27), subtype C dual tropic clones dominated over x4 clones while pure r5 clones were absent. In two subtype B chimeric viruses (B12 and B19), r5 clones were >100-fold more abundant than x4 or r5/x4 clones. The dual tropic C19 and C27 HIV-1 isolates outcompeted r5 primary HIV-1 isolates, B2 and C3 in PBMCs. When AMD3100 was added or when only U87.CD4.CCR5 cells were used, the B2 and C3 reference viruses now out-competed the r5 component of the dual tropic C19 and C27. In contrast, the same replicative fitness was observed with dualtropic B12 and B19 HIV-1 isolates relative to x4 HIV-1 A8 and E6 or the r5 B2 and C3 viruses, even when the r5 or x4 component was inhibited by maraviroc (or AMD3100) or in U87.CD4.CXCR4 (or CCR5) cells.
Conclusions:
In the dual tropic HIV-1 isolates, the x4 replicative fitness is higher than r5 clones but the x4 or x4/r5 clones are typically at low frequency in the intrapatient virus population. Ex vivo HIV propagation promotes outgrowth of the x4 clones and provides an over-estimate of x4 dominance in replicative fitness within dual tropic viruses.
... A modified yeast gap-repair homologous recombination method was used to incorporate the envelope products within the NL4-3 clone as previously described with minor modifications. 21,33,34 First, the full-length HIV-1 clone NL4-3 from pNL4-3 was incorporated into the multiple cloning site (MCS) of pRS315 (New England Biolabs). ...
... PCR product containing yeast centromere sequence (CEN6), an autonomously replicating sequence (ARSH4), and the LEU2 gene was amplified from pRS315 as described previously. 33 This PCR product was inserted into the MCS of pcDNA3 (Invitrogen) to generate pCDNA3-Leu. The HIV-1 NL4-3 fragment from 5¢ LTR to around 700 gag base pairs was generated using primers GGTAGGCGTGTACGGTGGGAG GTCTATATAAGCAGAGCTCGTTTAGTGAACCGACAAG AAATCCTTGATCTG and GGCTGATCAGCGAGCTCTAGC ATTTAGGTGACACTATAGAATAGTGCTATGTCACTTCC CCTTGGTTCTCTC; the underlined portions correspond to pCDNA3 sequences. ...
Abstract As HIV-1 evolves over the course of infection, resistance against antiretrovirals may arise in the absence of drug pressure, especially against receptor and fusion blockers because of the extensive changes observed in the envelope glycoprotein. Here we show that viruses from the chronic phase of disease are significantly less sensitive to CCR5 receptor and fusion blockers compared to early infection variants. Differences in susceptibility to CCR5 antagonists were observed in spite of no demonstrable CXCR4 receptor utilization. No significant sensitivity differences were observed to another entry blocker, soluble CD4, or to reverse transcriptase, protease, or integrase inhibitors. Chronic as compared to early phase variants demonstrated greater replication when passaged in the presence of subinhibitory concentrations of fusion but not CCR5 receptor inhibitors. Fusion antagonist resistance, however, emerged from only one chronic phase virus culture. Because sensitivity to receptor and fusion antagonists is correlated with receptor affinity and fusion capacity, respectively, changes that occur in the envelope glycoprotein over the course of infection confer greater ability to use the CCR5 receptor and increased fusion ability. Our in vitro passage studies suggest that these evolving phenotypes increase the likelihood of resistance against fusion but not CCR5 receptor blockers.
... Viruses such as human immunodeficiency virus type 1 (HIV-1) or hepatitis C virus (HCV) are highly heterogeneous and lack convenient, conserved, or unique restriction enzyme sites for cloning (13)(14)(15). In the past, molecular analyses of HIV-1 replication involved only a handful of subtype B laboratory strains (e.g., NL4-3, HXB2, Ada, BH10) but these are not representative of the majority of circulating HIV-1 isolates in the infected population. ...
... Recently, we adopted a yeast-based recombination/gap repair technique to shuttle any HIV-1 genetic element into an HIV-1 vector (15). This technique has several advantages over mammalian recombination Replication studies on human immunodeficiency virus 1 (HIV-1) rely on a few laboratory strains that are divergent from dominant HIV-1 subtypes in the epidemic. ...
Replication studies on human immunodeficiency virus 1 (HIV-1) rely on a few laboratory strains that are divergent from dominant HIV-1 subtypes in the epidemic. Several phenotypic differences between diverse HIV-1 isolates and subtypes could affect vaccine development and treatment, but this research field lacks robust cloning/virus production systems to study drug sensitivity, replication kinetics, or to develop personalized vaccines. Extreme HIV-1 heterogeneity leaves few restriction enzyme sites for bacterial cloning strategies. In this study, we describe an alternative approach that involves direct introduction of any HIV-1 coding regions (e.g., any gene from a patient sample) into an HIV-1 DNA vector using yeast recombination. This technique uses positive and negative selectable markers in yeast and avoids the need for purification and screening of the DNA substrates and cloning products. Replication-competent virus is then produced from a modified mammalian 293T packaging cell line transfected with this yeast-derived HIV-1 vector. Although HIV-1 served as the prototype, this cloning strategy is now being developed for other diverse virus species such as hepatitis C virus and influenza virus.
... The pNLluc-AM vector consists of the pNL4-3 proviral plasmid with a portion of the env gene deleted and replaced with an SV40 promoter/firefly luciferase cassette. The construction of the pNLluc-AM vector was accomplished by using a yeast recombination system (Marozsan and Arts, 2003 ). Briefly, the LEU2 gene was PCR-amplified using the NLleu-S (5'- GGTGGAAATGG GGCACCATGCTCCTTGGGATATTGATGATCTGTAGTCCGCGGAGATTGTACTGA GAGTGCAC-3') and NLleu-AS (5'- CTTTTTTCTCTCTGCACCACTCTTCTCTTTGCCTTGGTGGGTGCTACCTGTGCGGT ATTTCACACCG-3') primers. ...
... Briefly, the LEU2 gene was PCR-amplified using the NLleu-S (5'- GGTGGAAATGG GGCACCATGCTCCTTGGGATATTGATGATCTGTAGTCCGCGGAGATTGTACTGA GAGTGCAC-3') and NLleu-AS (5'- CTTTTTTCTCTCTGCACCACTCTTCTCTTTGCCTTGGTGGGTGCTACCTGTGCGGT ATTTCACACCG-3') primers. The product was then recombined into the pRecEnv vector as described previously (Marozsan and Arts, 2003), to form the pRecEnvLEU2 vector. Next, the SV40 promoter and luciferase gene were PCR-amplified from pGL3-Control vector (Promega) using the NLluc-S (5'- GGTGGAAATGGGGCACCATGCTCCTTGGGATATTGATGATCTGTAGTTAATGCA TCTCAATTAGTCAGCAACCA-3') and NLluc-AS (5'- CTTTTTTCTCTCTGCACCACTCTTCTCTTTGCCTTGGTGGGTGCTACTTACACGGC GATCTTTCCGCCCTTCT-3') primers. ...
Human immunodeficiency virus type 1 (HIV-1) infection can be inhibited by small molecules that target the CCR5 coreceptor. Here, we describe some properties of clonal viruses resistant to one such inhibitor, SCH-D, using both chimeric, infectious molecular clones and Env-pseudotypes. Studies using combinations of CCR5 ligands, including small molecule inhibitors, monoclonal antibodies (MAbs) and chemokine derivatives such as PSC-RANTES, show that the fully SCH-D-resistant viruses enter target cells by using the SCH-D-bound form of CCR5. However, the way resistance to SCH-D and other small molecule CCR5 inhibitors is manifested depends on the target cell and the nature of the assay (single- vs. multi-cycle). In multi-cycle assays using primary lymphocytes, SCH-D does not inhibit resistant molecular clones, and it can even enhance their infectivity modestly. In contrast, the same viruses (as Env-pseudotypes) are significantly inhibited by SCH-D in single-cycle entry assays using U87-CD4/CCR5 cells, resistance being manifested by incomplete inhibition at high SCH-D concentrations. When a single-cycle, Env-pseudotype entry assay was performed using either U87-CD4/CCR5 cells or PBMC under comparable conditions, entry was inhibited by up to 88% in the former cells but by only 28% in the PBMC. Hence, there are both cell- and assay-dependent influences on how resistance is manifested. We also take this opportunity to correct our previous report that SCH-D-resistant isolates are also substantially cross-resistant to PSC-RANTES [Marozsan, A.J., Kuhmann, S.E., Morgan, T., Herrera, C., Rivera-Troche, E., Xu, S., Baroudy, B.M., Strizki, J., Moore, J.P., 2005. Generation and properties of a human immunodeficiency virus type 1 isolate resistant to the small molecule CCR5 inhibitor, SCH-417690 (SCH-D). Virology 338 (1), 182-199]. A substantial element of this resistance was attributable to the unappreciated carry-over of SCH-D from the selection cultures into analytical assays.
... Simply put, unique and conserved restriction sites do not exist for cloning the extremely diverse HIV-1 env gene. We have developed a yeast-based cloning system to clone any HIV-1 env into a common HIV-1 or SHIV backbone through sequence homology recombination/gap repair [45][46][47]. This system was designed for rapid yeast-based cloning and we have introduced >130 HIV-1 env genes with balanced representation from different HIV-1 subtypes (e.g. ...
The extreme HIV diversity posts a great challenge on development of an effective anti-HIV vaccine. To solve this problem, it is crucial to discover an appropriate immunogens and strategies that are able to prevent the transmission of the diverse viruses that are circulating in the world. Even though there have been a number of broadly neutralizing anti-HIV antibodies (bNAbs) been discovered in recent years, induction of such antibodies to date has only been observed in HIV-1 infection. Here, in this mini review, we review the progress in development of HIV vaccine in eliciting broad immune response, especially production of bNAbs, discuss possible strategies, such as polyvalent sequential vaccination, that facilitates B cell maturation leading to bNAb response.
... In this study, we generated a pool of 16 SHIVenv's derived from the HIV-1 env genes of acute HIV-1 infections. The production of these SHIVenv's was not a simple task and first required our development of an SIV and SHIV cloning system similar to the yeast-based cloning system for HIV-1 [20,55,56]. Del Prete et al. [16] used conventional cloning strategy to generate a cocktail of multiple of SHIVenv viruses. ...
Background
New simian–human immunodeficiency chimeric viruses with an HIV-1 env (SHIVenv) are critical for studies on HIV pathogenesis, vaccine development, and microbicide testing. Macaques are typically exposed to single CCR5-using SHIVenv which in most instances does not reflect the conditions during acute/early HIV infection (AHI) in humans. Instead of individual and serial testing new SHIV constructs, a pool of SHIVenv_B derived from 16 acute HIV-1 infections were constructed using a novel yeast-based SHIV cloning approach and then used to infect macaques. ResultsEven though none of the 16 SHIVenvs contained the recently reported mutations in env genes that could significantly enhance their binding affinity to RhCD4, one SHIVenv (i.e. SHIVenv_B3-PRB926) established infection in macaques exposed to this pool. AHI SHIVenv_B viruses as well as their HIVenv_B counterparts were analyzed for viral protein content, function, and fitness to identify possible difference between SHIVenv_B3-PRB926 and the other 15 SHIVenvs in the pool. All of the constructs produced SHIV or HIV chimeric with wild type levels of capsid (p27 and p24) content, reverse transcriptase (RT) activity, and expressed envelope glycoproteins that could bind to cell receptors CD4/CCR5 and mediate virus entry. HIV-1env_B chimeric viruses were propagated in susceptible cell lines but the 16 SHIVenv_B variants showed only limited replication in macaque peripheral blood mononuclear cells (PBMCs) and 174×CEM.CCR5 cell line. AHI chimeric viruses including HIVenv_B3 showed only minor variations in cell entry efficiency and kinetics as well as replicative fitness in human PBMCs. Reduced number of N-link glycosylation sites and slightly greater CCR5 affinity/avidity was the only distinguishing feature of env_B3 versus other AHI env’s in the pool, a feature also observed in the HIV establishing new infections in humans. Conclusion
Despite the inability to propagate in primary cells and cell lines, a pool of 16 SHIVenv viruses could establish infection but only one virus, SHIVenv_B3 was isolated in the macaque and then shown to repeatedly infected macaques. This SHIVenv_B3 virus did not show any distinct phenotypic property from the other 15 SHIVenv viruses but did have the fewest N-linked glycosylation sites.
... To construct the 3 0 PPT and cPPT mutants, yeast homologous recombination [33][34][35] was employed to generate pREC_nfl_NL4-3_Δ3 0 PPT/URA3 and pREC_nfl_NL4-3_ ΔcPPT/URA3, i.e. NL4-3 plasmids where a sequence encompassing the PPT was replaced by URA3. ...
... To construct the 3 0 PPT and cPPT mutants, yeast homologous recombination [33][34][35] was employed to generate pREC_nfl_NL4-3_Δ3 0 PPT/URA3 and pREC_nfl_NL4-3_ ΔcPPT/URA3, i.e. NL4-3 plasmids where a sequence encompassing the PPT was replaced by URA3. ...
Converting single-stranded viral RNA into double stranded DNA for integration is an essential step in HIV-1 replication. Initial polymerization of minus-strand DNA is primed from a host derived tRNA, whereas subsequent plus-strand synthesis requires viral primers derived from the 3' and central polypurine tracts (3' and cPPTs). The 5' and 3' termini of these conserved RNA sequence elements are precisely cleaved by RT-associated RNase H to generate specific primers that are used to initiate plus-strand DNA synthesis. In this study, siRNA wad used to produce a replicative HIV-1 variant contained G(-1)A and T(-16)A substitutions within/adjacent to the 3'PPT sequence. Introducing either or both mutations into the 3'PPT region or only the G(-1)A substitution in the cPPT region of NL4-3 produced infectious virus with decreased fitness relative to the wild-type virus. In contrast, introducing the T(-16)A or both mutations into the cPPT rendered the virus(es) incapable of replication, most likely due to the F185L integrase mutation produced by this nucleotide substitution. Finally, the effects of G(-1)A and T(-16)A mutations on cleavage of the 3'PPT were examined using an in vitro RNase H cleavage assay. Substrate containing both mutations was mis-cleaved to a greater extent than either wild-type substrate or substrate containing the T(-16)A mutation alone, which is consistent with the observed effects of the equivalent nucleotide substitutions on the replication fitness of NL4-3 virus. In conclusion, siRNA targeting of the HIV-1 3'PPT region can substantially suppress virus replication, and this selective pressure can be used to generate infectious virus containing mutations within or near the HIV-1 PPT. Moreover, in-depth analysis of the resistance mutations demonstrates that although virus containing a G(-1)A mutation within the 3'PPT is capable of replication, this nucleotide substitution shifts the 3'-terminal cleavage site in the 3'PPT by one nucleotide (nt) and significantly reduces viral fitness.
... Thus, we report the first reverse genetics system for IBDV constructed from homologous recombination in yeast. This method has been described in the literature for the genetic manipulation of other viruses, such as Yellow Fever (Queiroz et al., 2013) and HIV-1 (Marozsan and Arts, 2003) and it has shown to be efficient and easier to perform compared to the use of restriction enzymes and in vitro ligation. ...
The Infectious Bursal Disease Virus (IBDV) causes immunosuppression in young chickens. Advances in molecular virology and vaccines for IBDV have been achieved by viral reverse genetics (VRG). VRG for IBDV has undergone changes over time, however all strategies used to generate particles of IBDV involves multiple rounds of amplification and need of in vitro ligation and restriction sites. The aim of this research was to build the world's first VRG for IBDV by yeast-based homologous recombination; a more efficient, robust and simple process than cloning by in vitro ligation. The wild type IBDV (Wt-IBDV-Br) was isolated in Brazil and had its genome cloned in pJG-CMV-HDR vector by yeast-based homologous recombination. The clones were transfected into chicken embryo fibroblasts and the recovered virus (IC-IBDV-Br) showed genetic stability and similar phenotype to Wt-IBDV-Br, which were observed by nucleotide sequence, focus size/morphology and replication kinetics, respectively. Thus, IBDV reverse genetics by yeast-based homologous recombination provides tools to IBDV understanding and vaccines/viral vectors development.
... 6,15 The chimeric envelopes were incorporated into a plasmid containing Q23-17 HIV sequences from the primer binding site (PBS) to the 3' long terminal repeat (LTR), pCMV-Q23-17-PBS?LTR, using yeast gap-repair homologous recombination as previously described. [16][17][18][19] Replication competent viruses were generated by co-transfecting HEK293T cells with a plasmid containing the subject V1-V2 envelope within pCMV-Q23-17-PBS LTR and another plasmid with Q23-17 sequences from 5' LTR to early portion of gag, pCMV-Q23-17-LTR Gag4. 16 The 293T transfection supernatants were passaged on activated CD4+ T cells for a maximum of 7 days to generate high titer peripheral blood mononuclear cell (PBMC) derived viruses. ...
It has been postulated that HIV-1 envelope properties, such as shorter and less glycosylated V1-V2 loops commonly observed among non-subtype B early - transmitted viruses, promote utilization of the gut homing integrin α4β7. This property potentially confers an advantage to some HIV-1 variants early after acquisition. We found that replication competent recombinant viruses incorporating HIV-1 subtype A compact and less glycosylated early versus chronic phase V1-V2 loops demonstrated no significant difference in binding to α4β7 high CD8+ T cells or replication in α4β7 high CD4+ T cells. Integrin α4β7 usage does not select for shorter less glycosylated envelopes during transmission.
... Pseudotyped HIV-based third-generation lentivirus was generated by calcium phosphate-mediated co-transfection of 293T cells with the VRC01 or control lentiviral transfer vector and vectors expressing packaging proteins, the rev gene and the VSV-g envelope gene as described [33]. Highly purified mouse B cells isolated from hCD4/R5/cT1 mouse spleens by immunomagnetic sorting using MACS MicroBeads coupled to anti-mouse CD19 and passage through the AutoMACS automated were activated with LPS (50 mg/ml) and one day later were transduced with the VRC01 or control lentivirus (100 ng of p24 antigen, ,10 8 transducing units/ml) as described [34]. Transduced or untransduced mouse B cells (5610 6 cells) were then intrasplenicly injected into the hCD4/R5/cT1 mice three days after LPSactivation. ...
Mice cannot be used to evaluate HIV-1 therapeutics and vaccines because they are not infectible by HIV-1 due to structural differences between several human and mouse proteins required for HIV-1 entry and replication including CD4, CCR5 and cyclin T1. We overcame this limitation by constructing mice with CD4 enhancer/promoter-regulated human CD4, CCR5 and cyclin T1 genes integrated as tightly linked transgenes (hCD4/R5/cT1 mice) promoting their efficient co-transmission and enabling the murine CD4-expressing cells to support HIV-1 entry and Tat-mediated LTR transcription. All of the hCD4/R5/cT1 mice developed disseminated infection of tissues that included the spleen, small intestine, lymph nodes and lungs after intravenous injection with an HIV-1 infectious molecular clone (HIV-IMC) expressing Renilla reniformis luciferase (LucR). Furthermore, localized infection of cervical-vaginal mucosal leukocytes developed after intravaginal inoculation of hCD4/R5/cT1 mice with the LucR-expressing HIV-IMC. hCD4/R5/cT1 mice reproducibly developed in vivo infection after inoculation with LucR-expressing HIV-IMC which could be bioluminescently quantified and visualized with a high sensitivity and specificity which enabled them to be used to evaluate the efficacy of HIV-1 therapeutics. Treatment with highly active anti-retroviral therapy or one dose of VRC01, a broadly neutralizing anti-HIV-1 antibody, almost completed inhibited acute systemic HIV-1 infection of the hCD4/R5/cT1 mice. hCD4/R5/cT1 mice could also be used to evaluate the capacity of therapies delivered by gene therapy to inhibit in vivo HIV infection. VRC01 secreted in vivo by primary B cells transduced with a VRC01-encoding lentivirus transplanted into hCD4/R5/cT1 mice markedly inhibited infection after intravenous challenge with LucR-expressing HIV-IMC. The reproducible infection of CD4/R5/cT1 mice with LucR-expressing HIV-IMC after intravenous or mucosal inoculation combined with the availability of LucR-expressing HIV-IMC expressing transmitted/founder and clade A/E and C Envs will provide researchers with a highly accessible pre-clinical in vivo HIV-1-infection model to study HIV-1 acquisition, treatment, and prevention.
... In this study, we investigated whether a relatively simple cloning strategy where primary envelope cDNAs are inserted into a provirus in cis would lead to an improved ability to study fusogenic properties of these Env proteins compared to pseudotyping of HIV virions. Several cloning strategies have been developed including methods including shuttle vectors passed though yeast or laborious multi step cloning [30,31]. We took advantage of the molecular clone TN6-GFP developed by Neumman et al., that harbors two cloning sites on each side of env, to construct a set of six clones containing primary envelopes. ...
Over the course of infection, the human immunodeficiency virus type 1 (HIV-1) continuously adapts in part to evade the host's neutralizing antibody response. Antibodies often target the HIV envelope proteins that mediate HIV fusion to its cellular targets. HIV virions pseudotyped with primary envelopes have often been used to explore the fusogenic properties of these envelopes. Unfortunately, these pseudotyped virions fuse with greatly reduced efficiency to primary cells. Here, we describe a relatively simple strategy to clone primary envelopes into a provirus and increase the sensitivity of the virion-based fusion assay.
... The construction of the pNLluc-AM and PCI-Env plasmids has been previously described [18]. In brief, the pNLluc-AM vector consists of the pNL4-3 proviral plasmid, in which a portion of the env gene was deleted and replaced with an SV40 promoter/firefly luciferase cassette using a yeast recombination system [64]. The pCI-env expression plasmids were constructed by insertion of the CC1/85 cl.7, CC1/85 cl.6, CC101.19 cl.7 and D1/85.16 ...
Author Summary
Human immunodeficiency virus type 1 (HIV-1) is the causative agent of AIDS. HIV-1 entry into target cells is triggered by the interaction of the viral envelope glycoproteins with a cell-surface receptor (CD4) and a co-receptor (CCR5), and culminates in fusion of the viral and cell membranes. Small molecule inhibitors that bind to CCR5 are a new class of drug for treating HIV-1-infected people. However, HIV-1 can evolve ways to become resistant to these compounds, by acquiring mutations that alter how its envelope glycoproteins (gp120-gp41) interact with CCR5. In this study, we investigated how two resistant viruses gained the ability to use the inhibitor-bound form of CCR5 through two different mechanisms. In the first virus, four amino acid substitutions in the V3 region of gp120 created an increased dependency on interactions with the CCR5 N-terminus. These changes altered the configuration of gp120, increasing the exposure of antibody epitopes in the V3 region and the CD4i epitope cluster associated with the CCR5 binding site. In contrast, the second virus, which became resistant via three sequence changes in the gp41 subunit, did not become more dependent on the CCR5 N-terminus and remained resistant to neutralization by antibodies against elements of the CCR5 binding site.
... Construction of recombinant viral plasmids. We modified a previously described yeast gap repair homologous recombination method (43) to incorporate unique V1-V5 PCR-amplified envelope fragments into a full-length subtype A HIV-1 clone (Q23-17) (63) (Fig. 1). To incorporate the Q23 HIV-1 sequences into a Saccharomyces cerevisiae and Escherichia coli shuttle vector, NotI and XhoI digestion was used to isolate the full-length Q23 sequence, and this frag-ment was cloned into the multiple-cloning site of pRS315 (New England Biolabs). ...
Human immunodeficiency virus type 1 (HIV-1) envelope glycoprotein modifications over the course of infection have been associated with coreceptor switching and antibody neutralization resistance, but the effect of the changes on replication and host cell receptor usage remains unclear. To examine this question, unique early- and chronic-stage infection envelope V1-to V5 (V1-V5) segments from eight HIV-1 subtype A-infected subjects were incorporated into an isogenic background to construct replication-competent recombinant viruses. In all subjects, viruses with chronic-infection V1-V5 segments showed greater replication capacity than those with early-infection V1-V5 domains in cell lines with high levels of both the CD4 and the CCR5 receptors. Viruses with chronic-infection V1-V5s demonstrated a significantly increased ability to replicate in cells with low CCR5 receptor levels and greater resistance to CCR5 receptor and fusion inhibitors compared to those with early-infection V1-V5 segments. These properties were associated with sequence changes in the envelope V1-V3 segments. Viruses with the envelope segments from the two infection time points showed no significant difference in their ability to infect cells with low CD4 receptor densities, in their sensitivity to soluble CD4, or in their replication capacity in monocyte-derived macrophages. Our results suggest that envelope changes, primarily in the V1-V3 domains, increase both the ability to use the CCR5 receptor and fusion kinetics. Thus, envelope modifications over time within a host potentially enhance replication capacity.
Here we report the expression of HIV-1 gp160 and its mutated proteins in Saccharomyces cerevisiae. Two strong hydrophobic regions, aa 511-537 and aa 679-703, were predicted by GCG Wisconsin Package software and removed to investigate the solubility of the mutated gp160 (gp160Delta12). The results showed that gp160Delta12 assumes high solubility as to be present in supernatant of cell lysate exclusively. The mutant exists as trimeric form in solutions via some inter-molecule disulfide bonds, which can be associated to monomer with the reduced reaction of DTT. The fermentation procedure was optimized to get high cell density yield and expression level as approximately 10 mg/L. After purification with electro elution, gp160Delta12 was checked as glycosylation form by Endo-H deglycosylating catalysis. The ELISA performed with a panel of human sera suggests that the purified gp160Delta12 shares some determinants with gp120 and gp41, but exposes some distinct epitopes that react with early HIV-infected antibody. Thus, we may provide a novel antigen for immunodetection assay, vaccine candidate, and other relative research purposes.
PSC-RANTES binds to CCR5, inhibits human immunodeficiency virus type 1 (HIV-1) entry, and has been shown as a vaginal microbicide
to protect rhesus macaques from a simian-human immunodeficiency virus chimera (SHIVSF162-p3) infection in a dose-dependent manner. In this study, env gene sequences from SHIVSF162-p3-infected rhesus macaques treated with PSC-RANTES were analyzed for possible drug escape variants. Two specific mutations
located in the V3 region of gp120 (K315R) and C-helical domain of gp41 (N640D) were identified in a macaque (m584) pretreated
with a 100 μM dose of PSC-RANTES. These two env mutations were found throughout infection (through week 77) but were found at only low frequencies in the inoculating SHIVSF162-p3 stock and in the other SHIVSF162-p3-infected macaques. HIV-1 env genes from macaque m584 (envm584) and from inoculating SHIVSF162-p3 (envp3) were cloned into an HIV-1 backbone. Increases in 50% inhibitory concentrations to PSC-RANTES with envm584 were modest (sevenfold) and most pronounced in cells expressing rhesus macaque CCR5 as compared to human CCR5. Nonetheless,
virus harboring envm584, unlike inoculating virus envp3, could replicate even at the highest tissue culture PSC-RANTES concentrations (100 nM). Dual-virus competitions revealed
a dramatic increase in fitness of chimeric virus containing envm584 (K315R/N640D) over that containing envp3, but again, only in rhesus CCR5-expressing cells. This study is the first to describe the immediate selection and infection
of a drug-resistant SHIV variant in the face of a protective vaginal microbicide, PSC-RANTES. This rhesus CCR5-specific/PSC-
RANTES resistance selection is particularly alarming given the relative homogeneity of the SHIVSF162-p3 stock compared to the potential exposure to a heterogeneous HIV-1 population in human transmission.
The increasingly prevalent emergence of drug-resistant virus strains in patients being treated with highly active antiretroviral regimens and the increasing rates of transmission of drug-resistant virus strains have focused attention on the critical need for additional antiretroviral agents with novel mechanisms of action and enhanced potency. Furthermore, novel means of employing highly active antiretroviral therapy are needed to reduce or eliminate the virological treatment failures that currently occur. Over the past several years, evidence has mounted supporting the fact that the emergence of resistant strains is associated with reductions in viral fitness, yielding decreases in plasma virus load in treated patients harbouring resistant populations of the virus. Additional mutations that serve to modify fitness (compensatory mutations) and mutations that impact the viral replication capacity also emerge under the selective pressure of drug treatment, and have both negative and positive effects on virus growth. Fitness is generally accepted to refer to the ability of HIV to replicate in a defined environment and thus is used to describe the viral replication potential in the absence of the drug. Although viral fitness and replication capacity are related in some ways, it is important to recognise that viral fitness is not the same as viral replication capacity. This review will assess the recent literature on antiviral drug resistance, viral fitness and viral replication capacity, and discuss means by which the adaptability of HIV to respond rapidly to antiviral treatment through mutation may be used against it. This would be done by treating patients with an aim to lock the deleterious mutations into the resistant virus genome, resulting in a positive therapeutic outcome despite the presence of resistance to the selecting agents. The review will specifically discuss the literature on nucleoside and non-nucleoside reverse transcriptase inhibitors, protease inhibitors, integrase inhibitors, fusion inhibitors, as well as other biological factors involved in viral fitness.
The ability of one primary human immunodeficiency virus type 1 (HIV-1) isolate to outcompete another in primary CD4+ human lymphoid cells appears to be mediated by the efficiency of host cell entry. This study was designed to test the role
of entry on fitness of wild-type HIV-1 isolates (e.g., replicative capacity) and to examine the mechanism(s) involved in differential
entry efficiency. The gp120 coding regions of two diverse HIV-1 isolates (the more-fit subtype B strain, B5-91US056, and less-fit
C strain, C5-97ZA003) were cloned into a neutral HIV-1 backbone by using a recently described yeast cloning technique. The
fitness of the primary B5 HIV-1 isolates and its env gene cloned into the NL4-3 laboratory strain had similar fitness, and both were more fit than the C5 primary isolate and
its env/NL4-3 chimeric counterpart. Increased fitness of the B5 over C5 virus was mediated by the gp120 coding region of the env gene. An increase in binding/fusion, as well as decreased sensitivity to entry inhibitors (PSC-RANTES and T-20), was observed
in cell fusion assays mediated by B5 gp120 compared to C5 gp120. Competitive binding assays using a novel whole virus-cell
system indicate that the primary or chimeric B5 had a higher avidity for CD4/CCR5 on host cells than the C5 counterpart. This
increased avidity of an HIV-1 isolate for its cell receptors may be a significant factor influencing overall replicative capacity
or fitness.
Differential phenotypes or properties of HIV-1 gene products in primary virus isolates are difficult to assess due to interference by the high degree of sequence variation across the entire genome. Thus, chimeric viruses provide a powerful tool to study the function of single gene products or genetic elements in the context of a neutral viral genomic backbone. In this chapter, we describe how to produce HIV-1 chimeric viruses utilizing a yeast-based homologous recombination cloning technique to insert env sequences first into a yeast cloning vector and then into the common pNL4-3 virus backbone. This technique is not limited to the env gene, but can be used to build chimeric viruses with any HIV-1 gene or genetic element. This cloning technique involves the use of a shuttle vector that can replicate in yeast and bacterial cells. Along with acting as a shuttle vector for subsequent subcloning into pNL4-3, this construct pRec/env can also be used to express to the env gene product, gp120/gp41, on the surface of mammalian cells. The chimeric viruses produced by this cloning method are capable of undergoing multiple rounds of replication and are therefore very useful to study drug sensitivity, coreceptor usage, and viral fitness as influenced by a single gene or gene fragment of a primary HIV-1 isolate from any group M subtype.
Natural polymorphisms in the heterogeneous human immunodeficiency virus type 1 (HIV-1) envelope glycoprotein may have an impact on both sensitivity to entry inhibitors and viral replicative fitness. Of significant interest is variation in the V3 crown due to its involvement in direct engagement with the coreceptor. Two positions in the crown (318 and 319) appear to be important in determining intrinsic susceptibility to multiple entry inhibitors. Thus, we evaluated a series of natural polymorphisms at positions 318 and 319 in three distinct CCR5-tropic envelope genetic backgrounds to address their role in replicative fitness and sensitivity to entry inhibitors. Change at position 319 to each of the three major consensus amino acids (A, T, and R) resulted in variation in sensitivity to entry inhibitors and altered replicative fitness, but the effects of any one amino acid depended on the envelope context. Change of the nearly invariant tyrosine at position 318 to a rare arginine resulted in increased sensitivity to entry inhibitors and decreased replicative fitness independent of envelope context. Polymorphisms in the V3 crown that showed increased susceptibility to entry inhibitors also exhibited decreased entry efficiency, replicative fitness in primary peripheral blood mononuclear cells, and ability to replicate in primary macrophages. These findings suggest that differences in coreceptor affinity and/or avidity may underlie these phenotypic characteristics.
Small interfering RNAs (siRNAs) have been shown to effectively inhibit human immunodeficiency virus type 1 (HIV-1) replication in vitro. The mechanism(s) for this inhibition is poorly understood, as siRNAs may interact with multiple HIV-1 RNA species during different steps of the retroviral life cycle. To define susceptible HIV-1 RNA species, siRNAs were first designed to specifically inhibit two divergent primary HIV-1 isolates via env and gag gene targets. A self-inactivating lentiviral vector harboring these target sequences confirmed that siRNA cannot degrade incoming genomic RNA. Disruption of the incoming core structure by rhesus macaque TRIM5alpha did, however, provide siRNA-RNA-induced silencing complex access to HIV-1 genomic RNA and promoted degradation. In the absence of accelerated core disruption, only newly transcribed HIV-1 mRNA in the cytoplasm is sensitive to siRNA degradation. Inhibitors of HIV-1 mRNA nuclear export, such as leptomycin B and camptothecin, blocked siRNA restriction. All HIV-1 RNA regions and transcripts found 5' of the target sequence, including multiply spliced HIV-1 RNA, were degraded by unidirectional 3'-to-5' siRNA amplification and spreading. In contrast, HIV-1 RNA 3' of the target sequence was not susceptible to siRNA. Even in the presence of siRNA, full-length HIV-1 RNA is still encapsidated into newly assembled viruses. These findings suggest that siRNA can target only a relatively "naked" cytoplasmic HIV-1 RNA despite the involvement of viral RNA at nearly every step in the retroviral life cycle. Protection of HIV-1 RNA within the core following virus entry, during encapsidation/virus assembly, or within the nucleus may reflect virus evolution in response to siRNA, TRIM5alpha, or other host restriction factors.
Little is known about the in vivo development of resistance to human immunodeficiency virus type 1 (HIV-1) CCR5 antagonists.
We studied 29 subjects with virologic failure from a phase IIb study of the CCR5 antagonist vicriviroc (VCV) and identified
one individual with HIV-1 subtype C who developed VCV resistance. Studies with chimeric envelopes demonstrated that changes
within the V3 loop were sufficient to confer VCV resistance. Resistant virus showed VCV-enhanced replication, cross-resistance
to another CCR5 antagonist, TAK779, and increased sensitivity to aminooxypentane-RANTES and the CCR5 monoclonal antibody HGS004.
Pretreatment V3 loop sequences reemerged following VCV discontinuation, implying that VCV resistance has associated fitness
costs.
Combination therapy with protease (PR) and reverse transcriptase (RT) inhibitors can efficiently suppress human immunodeficiency virus (HIV) replication, but the emergence of drug-resistant variants correlates strongly with therapeutic failure. Here we describe a new method for high-throughput analysis of clinical samples that permits the simultaneous detection of HIV type 1 (HIV-1) phenotypic resistance to both RT and PR inhibitors by means of recombinant virus assay technology. HIV-1 RNA is extracted from plasma samples, and a 2.2-kb fragment containing the entire HIV-1 PR- and RT-coding sequence is amplified by nested reverse transcription-PCR. The pool of PR-RT-coding sequences is then cotransfected into CD4+ T lymphocytes (MT4) with the pGEMT3deltaPRT plasmid from which most of the PR (codons 10 to 99) and RT (codons 1 to 482) sequences are deleted. Homologous recombination leads to the generation of chimeric viruses containing PR- and RT-coding sequences derived from HIV-1 RNA in plasma. The susceptibilities of the chimeric viruses to all currently available RT and/or PR inhibitors is determined by an MT4 cell-3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide-based cell viability assay in an automated system that allows high sample throughput. The profile of resistance to all RT and PR inhibitors is displayed graphically in a single PR-RT-Antivirogram. This assay system facilitates the rapid large-scale phenotypic resistance determinations for all RT and PR inhibitors in one standardized assay.
The genetic diversity of the envelope glycoprotein of human immunodeficiency virus type 1 (HIV-1) isolates was studied. HIV-1 isolates were obtained from eight countries in Africa: Djibouti, Gabon, Kenya, Senegal, Somalia, Uganda, Zaire, and Zambia. The DNA sequences encoding the complete HIV-1 envelope protein were PCR amplified and sequenced. Phylogenetic relationships among the 21 sequences from this study and the 32 previously published full-length env HIV-1 sequences were determined. Twenty of the newly sequenced African isolates could be assigned to envelope subtypes A, C, D, and G. One isolate, collected in Zambia, did not belong to any of the eight previously described subtypes and may represent a prototype sequence of its envelope subtype. The phylogenetic classification of these isolates was strongly supported by bootstrapping and the congruence of trees generated by either distance methods or maximum parsimony analysis. The data presented in this study confirm the existence of several genetic subtypes within the global HIV epidemic and broaden the genetic variability previously observed for envelope subtypes. The geographic spread of different subtypes was shown to be substantial, and the notion of cocirculation of subtypes was reinforced.
The genetic diversity of human immunodeficiency virus (HIV) is a major concern thought to impact on immunologic escape and eventual vaccine efficacy. Here, simple and rapid methods are described for the detection and estimation of genetic divergence between HIV strains on the basis of the observation that DNA heteroduplexes formed between related sequences have a reduced mobility in polyacrylamide gels proportional to their degree of divergence. Reliable phylogenetic subtypes were assigned for HIV-1 strains from around the world. Relationships between viruses were closest when derived from the same or epidemiologically linked individuals. When derived from epidemiologically unlinked individuals, the relationships between viruses in a given geographic region correlated with the length of time HIV-1 had been detected in the population and the number of strains initiating widespread infection. Heteroduplex mobility analysis thus provides a tool to expedite epidemiological investigations by assisting in the classification of HIV and is readily applicable to the screening and characterization of other infectious agents and cellular genes.
A highly divergent HIV-1 isolate, designated YBF 30, was obtained in 1995 from a 40-year-old Cameroonian woman with AIDS. Depending on the genes studied, phylogenetic analysis showed that YBF30 branched either with SIVcpz-gab or between SIVcpz-gab and HIV-1 group M. The structural genes and tat, vpr, and nef of YBF30 are approximately equidistant from those of HIV-1 group M and SIVcpz-gab. In contrast, vif and rev are closer to HIV-1 group M, and vpu is highly divergent. Using a YBF30 V3 loop peptide enzyme immunoassay, we screened 700 HIV-1-positive sera collected in Cameroon; three reacted strongly with the YBF30 peptides and one was confirmed as being related to YBF30 by genetic analysis of a pol fragment. YBF30 is as distinct from SIVcpz-gab as it is from HIV-1 group M and can thus be considered as the prototype strain of a new human immunodeficiency virus group.
To determine whether C-C chemokines play an important role in the phenotype switch of human immunodeficiency virus (HIV) from CCR5 to CXCR4 usage during the course of an infection in vivo, macrophage inflammatory protein (MIP)-1alpha-resistant variants were isolated from CCR5-tropic (R5) HIV-1 in vitro. The selected variants displayed reduced sensitivities to MIP-1alpha (fourfold) through CCR5-expressing CD4-HeLa/long terminal repeat-beta-galactosidase (MAGI/CCR5) cells. The variants were also resistant to other natural ligands for CCR5, namely, MIP-1beta (>4-fold) and RANTES (regulated upon activation, normal T-cell expressed and secreted) (6-fold). The env sequence analyses revealed that the variants had amino acid substitutions in V2 (valine 166 to methionine) and V3 (serine 303 to glycine), although the same V3 substitution appeared in virus passaged without MIP-1alpha. A single-round replication assay using a luciferase reporter HIV-1 strain pseudotyped with mutant envelopes confirmed that mutations in both V2 and V3 were necessary to confer the reduced sensitivity to MIP-1alpha, MIP-1beta, and RANTES. However, the double mutant did not switch its chemokine receptor usage from CCR5 to CXCR4, indicating the altered recognition of CCR5 by this mutant. These results indicated that V2 combined with the V3 region of the CCR5-tropic HIV-1 envelope modulates the sensitivity of HIV-1 to C-C chemokines without altering the ability to use chemokine receptors.
Although combination antiretroviral therapy has resulted in a considerable improvement in the treatment of human immunodeficiency
virus (HIV) type 1 (HIV-1) infection, the emergence of resistant virus is a significant obstacle to the effective management
of HIV infection and AIDS. We have developed a novel phenotypic drug susceptibility assay that may be useful in guiding therapy
and improving long-term suppression of HIV replication. Susceptibility to protease (PR) and reverse transcriptase (RT) inhibitors
is measured by using resistance test vectors (RTVs) that contain a luciferase indicator gene and PR and RT sequences derived
from HIV-1 in patient plasma. Cells are transfected with RTV DNA, resulting in the production of virus particles that are
used to infect target cells. Since RTVs are replication defective, luciferase activity is measured following a single round
of replication. The assay has been automated to increase throughput and is completed in 8 to 10 days. Test results may be
useful in facilitating the selection of optimal treatment regimens for patients who have failed prior therapy or drug-naive
patients infected with drug-resistant virus. In addition, the assay can be used to evaluate candidate drugs and assist in
the development of new drugs that are active against resistant strains of HIV-1.
Aminooxypentane (AOP)-RANTES efficiently and specifically blocks entry of non-syncytium-inducing (NSI), CCR5-tropic (R5) human immunodeficiency virus type 1 (HIV-1) into host cells. Inhibition appears to be mediated by increased intracellular retention of the CCR5 coreceptor- AOP-RANTES complex and/or competitive binding of AOP-RANTES with NSI R5 HIV-1 isolates for CCR5. Although AOP-RANTES and other beta-chemokine analogs are potent inhibitors, the extreme heterogeneity of the HIV-1 envelope glycoproteins (gp120 and gp41) and variable coreceptor usage may affect the susceptibility of variant HIV-1 strains to these drugs. Using the same peripheral blood mononuclear cells (PBMC) with all isolates, we observed a significant variation in AOP-RANTES inhibition of 13 primary NSI R5 isolates; 50% inhibitory concentrations (IC(50)) ranged from 0.04 nM with HIV-1(A-92RW009) to 1.3 nM with HIV-1(B-BaL). Experiments performed on the same isolate (HIV-1(B-BaL)) with PBMC from different donors revealed no isolate-specific variation in AOP-RANTES IC(50) values but did show a considerable difference in virus replication efficiency. Exclusive entry via the CCR5 coreceptor by these NSI R5 isolates suggests that variable inhibition by AOP-RANTES is not due to alternative coreceptor usage but rather differential CCR5 binding. Analysis of the envelope V3 loop sequence linked a threonine or arginine at position 319 (numbering based on the HXB2 genome) with AOP-RANTES resistance. With the exception of one isolate, A319 was associated with increased sensitivity to AOP-RANTES inhibition. Distribution of AOP-RANTES IC(50) values with these isolates has promoted ongoing screens for new CCR5 agonists that show broad inhibition of HIV-1 variants.
This study was designed to examine the impact of human immunodeficiency virus type 1 (HIV-1) fitness on disease progression through the use of a dual competition/heteroduplex tracking assay (HTA). Despite numerous studies on the impact of HIV-1 diversity and HIV-specific immune response on disease progression, we still do not have a firm understanding of the long-term pathogenesis of this virus. Strong and early CD8-positive cytotoxic T-cell and CD4-positive T-helper cell responses directed toward HIV-infected cells appear to curb HIV pathogenesis. However, the rate at which the virus infects the CD4(+) T-cell population and possibly destroys the HIV-specific immune response may also alter the rate of disease progression. For HIV-1 fitness studies, we established conditions for dual HIV-1 infections of peripheral blood mononuclear cells (PBMC) and a sensitive HTA to measure relative virus production. A pairwise comparison was then performed to estimate the relative fitness of various non-syncytium-inducing/CCR5-tropic (NSI/R5) and syncytium-inducing/CXCR4-tropic (SI/X4) HIV-1 isolates. Four HIV-1 strains (two NSI/R5 and two SI/X4) with moderate ex vivo fitness were then selected as controls and competed against primary HIV-1 isolates from an HIV-infected Belgian cohort. HIV-1 isolates from long-term survivors (LTS) were outcompeted by control strains and were significantly less fit than HIV-1 isolates from patients with accelerated progression to AIDS (PRO). In addition, NSI/R5 HIV-1 isolates from PRO overgrew control SI/X4 strains, suggesting that not all SI/X4 HIV-1 isolates replicate more efficiently than all NSI/R5 isolates. Finally, there were strong, independent correlations between viral load and the total relative fitness values of HIV-1 isolates from PRO (r = 0.84, P = 0.033) and LTS (r = 0.86, P = 0.028). Separation of the PRO and LTS plots suggest that HIV-1 fitness together with viral load may be a strong predictor for the rate of disease progression.
To identify sites in gp120 that interact with the CCR5 coreceptor and to analyze the mechanisms of infection, we selected variants of the CCR5-dependent JRCSF molecular clone of human immunodeficiency virus type 1 (HIV-1) that adapted to replicate in HeLa-CD4 cells that express the mutant coreceptor CCR5(Y14N) or CCR5(G163R), which were previously shown to bind purified gp120-CD4 complexes only weakly. Correspondingly, these mutant CCR5s mediate infections of wild-type virus only at relatively high cell surface concentrations, demonstrating a concentration-dependent assembly requirement for infection. The plots of viral infectivity versus concentration of coreceptors had sigmoidal shapes, implying involvement of multiple coreceptors, with an estimated stoichiometry of four to six CCR5s in the active complexes. All of the adapted viruses had mutations in the V3 loops of their gp120s. The titers of recombinant HIV-1 virions with these V3 mutations were determined in previously described panels of HeLa-CD4 cell clones that express discrete amounts of CCR5(Y14N) or CCR5(G163R). The V3 loop mutations did not alter viral utilization of wild-type CCR5, but they specifically enhanced utilization of the mutant CCR5s by two distinct mechanisms. Several mutant envelope glycoproteins were highly fusogenic in syncytium assays, and these all increased the efficiency of infection of the CCR5(Y14N) or CCR5(G163R) clonal panels without enhancing virus adsorption onto the cells or viral affinity for the coreceptor. In contrast, V3 loop mutation N300Y was selected during virus replication in cells that contained only a trace of CCR5(Y14N) and this mutation increased the apparent affinity of the virus for this coreceptor, as indicated by a shift in the sigmoid-shaped infectivity curve toward lower concentrations. Surprisingly, N300Y increased viral affinity for the second extracellular loop of CCR5(Y14N) rather than for the mutated amino terminus. Indeed, the resulting virus was able to use a mutant CCR5 that lacks 16 amino acids at its amino terminus, a region previously considered essential for CCR5 coreceptor function. Our results demonstrate that the role of CCR5 in infection involves at least two steps that can be strongly and differentially altered by mutations in either CCR5 or the V3 loop of gp120: a concentration-dependent binding step that assembles a critical multivalent virus-coreceptor complex and a postassembly step that likely involves a structural rearrangement of the complex. The postassembly step can severely limit HIV-1 infections and is not an automatic consequence of virus-coreceptor binding, as was previously assumed. These results have important implications for our understanding of the mechanism of HIV-1 infection and the factors that may select for fusogenic gp120 variants during AIDS progression.
This chapter discusses the different steps of the polymerase chain reaction (PCR)-based gene targeting method and its possible applications for basic and advanced gene analyses. It highlights the experience with the selection marker, kanMX, a hybrid gene expressing a bacterial aminoglycoside phosphotransferase under the control of a strong fungal promoter. The introduction of this marker led to two essential improvements. First, gene targeting was no longer dependent on the presence of auxotrophic markers in the host strain and, second, high backgrounds of false-positive transformants often obtained in PCR-targeting using Saccharomyces cerevisiae genes as selectable markers were virtually eliminated because kanMX lacks homology to yeast DNA. The chapter also summarizes the features of several new modules for PCR-targeting, including a heterologous HIS3 marker, called “HIS3MX6,” two green fluorescent protein (GFP) reporter modules with HIS3MX or kanMX as selection marker, which are useful for generating carboxy-terminal GFP fusions, a kanMX-GAL1 promotor module for making promotor exchanges, and a kanMX-GAL1-GFP reporter module for generating amino-terminal fusions.
A laboratory network has been established by the World Health Organization (WHO) to systematically isolate and characterize HIV strains from different parts of the world, and to obtain information and reagents that would facilitate HIV vaccine development. Sixty-three HIV-1 isolates obtained from 224 specimens collected during 1992-1993 in Brazil, Rwanda, Thailand, and Uganda were characterized in this initial study. Virus strains were first genetically subtyped using three different screening methodologies: PCR-gag fingerprinting, RNase A mismatch, and heteroduplex mobility assay (HMA). In addition, selected viruses were sequenced in V3 (52 strains), C2-V3 (42 strains), gp120 (15 strains), and/or gp160 (8 strains) regions of their envelope genes. These studies identified viruses belonging to different sequence subtypes in the four countries: 16 subtype B and 1 subtype C strains in Brazil, 13 subtype A strains in Rwanda, 15 subtype E and 2 subtype B strains in Thailand, and 3 subtype A and 13 subtype D st...
The V3 loop of the ENV glycoprotein exerts a dominant influence on the interaction of gp120 with coreceptors. Primary env genes cloned from sequential isolates from two seroconverters revealed Pro→Ala conversion in the conserved GPG motif of the V3 crown in seven of 17 R5 ENV. ENV containing the GPG motif in the V3 crown had fusogenic activity with chimeric receptors containing either the N terminus or loops of CCR5, whereas those with the GAG variant utilized only the former. Site-directed mutagenesis of multiple primary and prototypic R5 env genes demonstrated that the GPG motif was necessary for dual utilization of the N terminus and body of CCR5 in both gain and loss-of-function experiments. All ENV containing the GPG V3 crown showed CCR5 binding in the presence of soluble CD4, whereas it was not detected with the GAG variants. Molecular dynamic simulations of a V3 peptide predicts that the Pro→Ala substitution results in a conformational change with loss of the crown structure. These studies demonstrate that sequences in the third hypervariable region determine the specificity of coreceptor utilization for fusion, and that a conserved motif in the crown directly influences the molecular anatomy of the interaction between gp120 and CCR5.
The kinetics of retroviral DNA and RNA synthesis are parameters vital to understanding viral growth, especially for human immunodeficiency virus (HIV), which encodes several of its own regulatory genes. We have established a single-cycle growth condition for HIV in H9 cells, a human CD4+ lymphocyte line. The full-length viral linear DNA is first detectable by 4 h postinfection. During a one-step growth of HIV, amounts of viral DNA gradually increase until 8 to 12 h postinfection and then decrease. The copy number of unintegrated viral DNA is not extraordinarily high even at its peak. Most strikingly, there is a temporal program of RNA accumulation: the earliest RNA is greatly enriched in the 2-kilobase subgenomic mRNA species, while the level of 9.2-kilobase RNA which is both genomic RNA and mRNA remains low until after 24 h of infection. Virus production begins at about 24 h postinfection. Thus, viral DNA synthesis is as rapid as for other retroviruses, but viral RNA synthesis involves temporal alteration in the species that accumulate, presumably as a consequence of viral regulatory genes.
We have constructed and tested a dominant resistance module, for selection of S. cerevisiae transformants, which entirely consists of heterologous DNA. This kanMX module contains the known kanr open reading-frame of the E. coli transposon Tn903 fused to transcriptional and translational control sequences of the TEF gene of the filamentous fungus Ashbya gossypii. This hybrid module permits efficient selection of transformants resistant against geneticin (G418). We also constructed a lacZMT reporter module in which the open reading-frame of the E. coli lacZ gene (lacking the first 9 codons) is fused at its 3' end to the S. cerevisiae ADH1 terminator. KanMX and the lacZMT module, or both modules together, were cloned in the center of a new multiple cloning sequence comprising 18 unique restriction sites flanked by Not I sites. Using the double module for constructions of in-frame substitutions of genes, only one transformation experiment is necessary to test the activity of the promotor and to search for phenotypes due to inactivation of this gene. To allow for repeated use of the G418 selection some kanMX modules are flanked by 470 bp direct repeats, promoting in vivo excision with frequencies of 10(-3)-10(-4). The 1.4 kb kanMX module was also shown to be very useful for PCR based gene disruptions. In an experiment in which a gene disruption was done with DNA molecules carrying PCR-added terminal sequences of only 35 bases homology to each target site, all twelve tested geneticin-resistant colonies carried the correctly integrated kanMX module.
We describe here the generation of gene disruption constructs using PCR amplification of selectable markers with primers that provide homology to the target gene of interest. We find that regions of homology as short as 38 to 50 bp suffice to mediate homologous recombination in yeast. We describe applications of this technology to three specific yeast genes that would have been difficult to disrupt with current methods. By dispensing with the need to either clone the gene of interest or engineer a standard disruption construct, this method should facilitate analysis of sequenced genes of unknown function, which will soon include the entire yeast genome.
To determine the extent of genetic variation among internationally collected HIV-1 isolates, to analyse phylogenetic relationships and the geographic distribution of different variants.
Phylogenetic comparison of 70 HIV-1 isolates collected in 15 countries on four continents.
To sequence the complete gag genome of HIV-1 isolates, build multiple sequence alignments and construct phylogenetic trees using distance matrix methods and maximum parsimony algorithms.
Phylogenetic tree analysis identified seven distinct genotypes. The seven genotypes were evident by both distance matrix methods and maximum parsimony analysis, and were strongly supported by bootstrap resampling of the data. The intra-genotypic gag distances averaged 7%, whereas the inter-genotypic distances averaged 14%. The geographic distribution of variants was complex. Some genotypes have apparently migrated to several continents and many areas harbor a mixture of genotypes. Related variants may cluster in certain areas, particularly isolates from a single city collected over a short time.
The genetic variation among HIV-1 isolates is more extensive than previously appreciated. At least seven distinct HIV-1 genotypes can be identified. Diversification, migration and establishment of local, temporal 'blooms' of particular variants may all occur concomitantly.
We have fused the open reading frames of his3-complementing genes from Saccharomyces kluyveri and Schizosac-charomyces pombe to the strong TEF gene promotor of the filamentous fungus Ashbya gossypii. Both chimeric modules and the cognate S. kluyveri HIS3 gene were tested in transformations of his3 S. cerevisiae strains using PCR fragments flanked by 40 bp target guide sequences. The 1.4 kb chimeric Sz. pombe module (HIS3MX6) performed best. With less than 5% incorrectly targeted transformants, it functions as reliably as the widely used geniticin resistance marker kanMX. The rare false-positive His+ transformants seem to be due to non-homologous recombination rather than to gene conversion of the mutated endogenous his3 allele. We also cloned the green fluorescent protein gene from Aequorea victoria into our pFA-plasmids with HIS3MX6 and kanMX markers. The 0.9 kb GFP reporters consist of wild-type GFP or GFP-S65T coding sequences, lacking the ATG, fused to the S. cerevisiae ADH1 terminator. PCR-synthesized 2.4 kb-long double modules flanked by 40-45 bp-long guide sequences were successfully targeted to the carboxy-terminus of a number of S. cerevisiae genes. We could estimate that only about 10% of the transformants carried inactivating mutations in the GFP reporter.
The Rev protein of the human immunodeficiency virus mediates the nuclear export of the intron-containing viral messages. This export is a consequence of the continuous shuttling of HIV Rev between the nucleus and cytoplasm. This shuttling is mediated by a nuclear localization signal and a nuclear export signal contained within Rev. Recently, several factors which are required for the movement of Rev through the nuclear pore have been identified. This review will focus on these factors and their role the nucleocytoplasmic shuttling of HIV Rev.
Saccharomyces cerevisiae CD-ROM edition (Sec-tion I basic techniques of yeast genetics)
- J E Coligan
- A M Kruisbeek
- D H Margulies
- E M Shevach
- W Strober
- R Coico
Coligan, J.E., Kruisbeek, A.M., Margulies, D.H., Shevach, E.M., Strober, W., Coico, R., 1999b. Saccharomyces cerevisiae. In: Current Protocols in Molecular Biology, CD-ROM edition (Sec-tion I basic techniques of yeast genetics). Wiley.
PCR-based gene targeting in Saccharomyces cerevisiae HIV type 1 variation in World Health Organization-sponsored vaccine evaluation sites: genetic screening, sequence analysis, and preliminary biological characterization of selected viral strains. WHO Network for HIV Isolation and Characteriza-tion
- A Wach
- C Brachat
- S Rebischung
- K Steiner
- S Pokorni
- S Heesen
- P Philippsen
Wach, A., Brachat, C., Rebischung, S., Steiner, K., Pokorni, S., te Heesen, S, Philippsen, P., 1998. PCR-based gene targeting in Saccharomyces cerevisiae. In: Brown, A., Tuite, M., Prosser, J. (Eds.), Yeast Gene Analysis, first ed. Academic Press, New York. WHO, 1994. HIV type 1 variation in World Health Organization-sponsored vaccine evaluation sites: genetic screening, sequence analysis, and preliminary biological characterization of selected viral strains. WHO Network for HIV Isolation and Characteriza-tion. AIDS Res. Hum. Retroviruses 10 (No. 11), 1327 Á/1343.
CD-ROM edition (Sec-tion IV preparation of yeast DNA, RNA, and proteins. Basic protocol : rapid isolation of plasmid DNA from yeast) Genetic rela-tionships determined by a DNA heteroduplex mobility assay: analysis of HIV-1 env genes
- J E Coligan
- A M Kruisbeek
- D H Margulies
- E M Shevach
- W Strober
- R Coico
- Wiley
- E L Delwart
- E G Shpaer
- J Louwagie
- F E Mccutchan
- M Grez
- H Waigmann
- J I Mullins
Coligan, J.E., Kruisbeek, A.M., Margulies, D.H., Shevach, E.M., Strober, W., Coico, R., 1999c. Saccharomyces cerevisiae. In: Current Protocols in Molecular Biology, CD-ROM edition (Sec-tion IV preparation of yeast DNA, RNA, and proteins. Basic protocol : rapid isolation of plasmid DNA from yeast). Wiley. Delwart, E.L., Shpaer, E.G., Louwagie, J., McCutchan, F.E., Grez, M., Rubsamen-Waigmann, H., Mullins, J.I., 1993. Genetic rela-tionships determined by a DNA heteroduplex mobility assay: analysis of HIV-1 env genes. Science 262 (No. 5137), 1257 Á/1261.
Genetic subtypes of HIV-1 Human Retroviruses and AIDS 1996: a Compilation and Analysis of Nucleic Acid and Amino Acid Sequences
- T Leitner
- G Myers
- B Korber
- B Foley
- K T Jeang
- J Mellors
Leitner, T., 1996. Genetic subtypes of HIV-1. In: Myers, G., Korber, B., Foley, B., Jeang, K.T., Mellors, J., Wain-Hobson, S. (Eds.), Human Retroviruses and AIDS 1996: a Compilation and Analysis of Nucleic Acid and Amino Acid Sequences. Theoretical Biology and Biophysics Group, Los Alamos National Laboratory, Los Alamos, NM, pp. III-28 Á/III-40.
Genetic subtypes of HIV-1
- Leitner
Saccharomyces cerevisiae
- Coligan