Content uploaded by Zhuang-Zhuang Zhang
Author content
All content in this area was uploaded by Zhuang-Zhuang Zhang on Jun 07, 2021
Content may be subject to copyright.
Insulin receptor tyrosine kinase substrate activates EGFR/ERK signalling
pathway and promotes cell proliferation of hepatocellular carcinoma
Yu-Ping Wang
a,b,c
, Li-Yu Huang
a,b
, Wei-Ming Sun
d,e
, Zhuang-Zhuang Zhang
a,b
, Jia-Zhu Fang
a,b
,
Bao-Feng Wei
a,b
, Bing-Hao Wu
a,b
, Ze-Guang Han
a,b,f,
⇑
a
Key Laboratory of Systems Biomedicine (Ministry of Education) of Rui-Jin Hospital, Shanghai Jiao Tong University School of Medicine, 197 Rui-Jin Road II, Shanghai 200025, China
b
Shanghai-MOST Key Laboratory for Disease and Health Genomics, Chinese National Human Genome Center at Shanghai, 351 Guo Shou-Jing Road, Shanghai 201203, China
c
Institute of Medical Biochemistry and Molecular Biology, School of Basic Medical Sciences, Lanzhou University, 199 Dong-Gang West Road, Lanzhou 730000, Gansu, China
d
Institute of Combined Traditional Chinese and Western Medicine, School of Basic Medical Sciences, Lanzhou University, 199 Dong-Gang West Road, Lanzhou 730000, Gansu, China
e
Department of Endocrinology, The First Hospital of Lanzhou University, 1 Dong-Gang West Road, Lanzhou 730000, Gansu, China
f
Shanghai Center of Systems Biomedicine, Shanghai Jiao Tong University, 800 Dongchuan Road, Shanghai 200240, China
article info
Article history:
Received 24 February 2013
Received in revised form 7 May 2013
Accepted 14 May 2013
Keywords:
IRTKS
Hepatocellular carcinoma
Proliferation
EGFR/ERK signalling
abstract
Insulin receptor tyrosine kinase substrate (IRTKS) is closely associated with actin remodelling and mem-
brane protrusion, but its role in the pathogenesis of malignant tumours, including hepatocellular carci-
noma (HCC), is still unknown. In this study, we showed that IRTKS was frequently upregulated in HCC
samples, and its expression level was significantly associated with tumour size. Enforced expression of
IRTKS in human HCC cell lines significantly promoted their proliferation and colony formation in vitro,
and their capacity to develop tumour xenografts in vivo, whereas knockdown of IRTKS resulted in the
opposite effects. Furthermore, the bromodeoxyuridine (BrdU) incorporation analyses and propidium
iodide staining indicated that IRTKS can promote the entry into S phase of cell cycle progression. Signif-
icantly, IRTKS can interact with epidermal growth factor receptor (EGFR), results in the phosphorylation
of extracellular signal-regulated kinase (ERK). By contrast, inhibition of ERK activation can attenuate the
effects of IRTKS overexpression on cellular proliferation. Taken together, these data demonstrate that
IRTKS promotes the proliferation of HCC cells by enhancing EGFR–ERK signalling pathway.
Ó2013 Elsevier Ireland Ltd. All rights reserved.
1. Introduction
Although liver cancer currently ranks worldwide as the fifth
most common malignant disease in men and seventh in women,
it is the second and sixth leading cause of cancer-related death,
respectively, with half of the incidence and deaths occurring in
China [1]. In primary liver cancers, hepatocellular carcinoma
(HCC) is the major histological subtype, contributing 70–85% of to-
tal liver cancer worldwide [2]. Despite the remarkable achieve-
ments that have been attained in the treatment of primary
hepatocellular carcinoma, the long-term survival rate for HCC is
still quite low [3]. Although a large number of molecules and sig-
nalling pathways that are related to the development of HCC have
been identified [4–7], the molecular mechanisms underlying the
tumourigenesis and proliferation of HCC are still poorly
understood.
Our group previously obtained insulin receptor tyrosine kinase
substrate (IRTKS) by cloning the full-length cDNA from the human
hypothalamus–pituitary–adrenal axis [8]. IRTKS belongs to the
IRSp53 protein family of which the main family members include
IRSp53 (BAIAP2), IRTKS (BAIAP2 L1), FLJ22582 (BAIAP2 L2), MIM,
and ABBA [9]. Each of these proteins contains a conserved
IRSp53/MIM domain (IMD) at the N-terminus and a canonical
SH3 domain near the C-terminus [9]. The IMD structure belongs
to the larger family of Bin-amphyipysin-Rvs67 (BAR) domains.
IRSp53 is a typical representative of the family that functions in
the regulation of membrane ruffling and cell shape [10,11] and is
related to the formation of filopodia and lamellipodia [12]. IRTKS
has been reported to be a substrate of insulin receptor tyrosine ki-
nase and has been observed to induce bundle actin filaments [13].
To date, most of the reports concerning IRTKS pertain to its
involvement in actin remodelling and membrane protrusion [14–
18]. However, the biological function of IRTKS in HCC proliferation
remains unknown.
In this study, we first demonstrate that IRTKS is frequently
upregulated in human HCC and is significantly associated with tu-
0304-3835/$ - see front matter Ó2013 Elsevier Ireland Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.canlet.2013.05.019
⇑
Corresponding author at: Shanghai-MOST Key Laboratory for Disease and
Health Genomics, Chinese National Human Genome Center at Shanghai, 351 Guo
Shou-Jing Road, Shanghai 201203, China. Tel.: +86 21 50801325; fax: +86 21
50800402.
E-mail addresses: wangyp@chgc.sh.cn (Y.-P. Wang), huangly@chgc.sh.cn
(L.-Y. Huang), swm77@163.com (W.-M. Sun), zhangzz@chgc.sh.cn (Z.-Z. Zhang),
fangjz@chgc.sh.cn (J.-Z. Fang), weibf@chgc.sh.cn (B.-F. Wei), wubh@chgc.sh.cn
(B.-H. Wu), hanzg@chgc.sh.cn (Z.-G. Han).
Cancer Letters 337 (2013) 96–106
Contents lists available at SciVerse ScienceDirect
Cancer Letters
journal homepage: www.elsevier.com/locate/canlet
mour size in an independent HCC cohort. Functional research indi-
cated that high levels of IRTKS promoted both in vitro and in vivo
cell proliferation by enhancing ERK activity, and IRTKS interacted
with EGFR and regulated its phosphorylation status. These data
suggest that IRTKS might balance EGFR activity as a new adaptor.
2. Materials and methods
2.1. Tissue specimens
All liver cancer specimens were acquired from patients who underwent surgical
resection with informed consent. Specimens of both the tumour and adjacent nor-
mal tissue were collected from each patient, and the diagnosis of HCC was validated
by pathological examination. The use of human and animal tissues in this investi-
gation was approved by the ethics committee of the Chinese National Human Gen-
ome Centre at Shanghai.
2.2. Liver cancer cell lines
Fourteen cell lines derived from liver tumours (QGY-7703, Focus, Hep3B,
HepG2, HepG2.2.15, Huh7, LM3, LM6, MHCC-H, MHCC-L, PLC/PRF/5, SK-Hep-1,
SNU398, and YY-8103) and the L02 cell line derived from foetal liver tissue were
used in this study. These cell lines were grown in Dulbecco’s Modified Eagle’s Med-
ium (DMEM, HyClone, USA) supplemented with 10% foetal bovine serum (GIBCO,
USA) at 37 °C in a humidified 5% CO
2
incubator.
2.3. Antibodies and reagents
An anti-IRTKS rabbit polyclonal antibody was raised against the GST-IRTKS fu-
sion protein [19]. Antibodies directed against IRTKS (mouse), EGFR (total), EGFR
(phosphorylated Tyr1173), b-catenin, b-actin, BrdU, and Ki67 were obtained from
Santa Cruz Biotechnology (USA). Akt (total), Akt (phosphorylated Ser473), ERK (to-
tal), ERK (phosphorylated Thr202/Tyr204), phosphorylated tyrosine, and PD98059
were obtained from Cell Signaling Technology (USA).
2.4. RNA extraction
Total RNA was extracted with the TRIzol
Ò
reagent (Invitrogen, USA) according
to the manufacturer’s instructions. To avoid possible genomic DNA contamination,
RNAase-free DNAase I (Takara, Japan) was used. The concentration and quantity of
RNA were assessed using a Nanodrop Spectrophotometer (ND-1000, Wilmington,
USA).
2.5. Semi-quantitative and real-time PCR
Reverse transcription was performed in a 25-
l
l reaction volume using M-MLV
Reverse Transcriptase (Promega, USA) with a total of 2
l
g of RNA. Semi-quantitative
RT-PCR and real-time PCR were performed using a Thermal Cycler Dice Detection
System and SYBR green dye (TaKaRa, Japan), according to the manufacturer’s proto-
col. The following primers were used to amplify a 205-bp PCR product for IRTKS:
forward, 5
0
-GAAGGATGGCTGGCTCTATG-3
0
, and reverse, 5
0
-GCATTCCAAG-
TAGTCGGGTG-3
0
. The housekeeping gene b-actin was used as an endogenous con-
trol with the following primers: forward, 5
0
-AGAGCCTCGCCTTTGCCGATCC-3
0
, and
reverse, 5
0
-CTGGGCCTCGTCGCCCACATA-3
0
.
2.6. Immunoblotting analysis
Cell extracts were collected in 2loading lysis buffer (50 mM Tris–HCl [pH 6.8],
2% SDS, 10% 2-mercaptoethanol, 10% glycerol, and protease inhibitor cocktail, Sig-
ma, USA). The total cellular protein was separated using 8% SDS–PAGE and trans-
ferred to Hybond-C nitrocellulose membranes (Amersham Life Science,
Buckinghamshire, UK). After blocking with PBS containing 5% BSA or nonfat milk,
the membrane was incubated with the appropriate primary antibody (1:1000) at
room temperature for 2 h or at 4 °C overnight, followed by incubation with IRDye
800CW or 680RD secondary antibodies (1:10,000, Li-COR Biosciences, USA). The
protein bands were detected using the Odyssey Infrared Imaging System (Li-COR
Biosciences, USA). b-actin was used as a loading control.
2.7. Construction of recombinant plasmids and adenoviral vectors
The full-length IRTKS ORF (1536 bp, GenBank accession number NM_018842)
was amplified from the pFLAG-CMV2-IRTKS plasmid [20]. The primers were as fol-
lows: forward, 5
0
-TACTCGAGATGTCCCGGGGGCCCGAGGAG-3
0
, and reverse, 5
0
-GAG-
GATCCTCGAATGATGGGTGCCGAGCGATCATTCG-3
0
. The PCR product was inserted
into the expression vector pcDNA3.1/myc-His(-)B-3 FLAG-IRES-hrGFP, derived
from pcDNA™3.1/myc-His(-)B (Invitrogen, USA). To construct the adenoviral vector
containing IRTKS, the plasmid pShuttle-IRTKS-IRES-hrGFP was constructed, and the
IRTKS ORF was subcloned into the AdEasy™ XL Adenoviral Vector System (Strata-
gene, USA).
2.8. RNA interference (RNAi)
Two siRNAs against IRTKS were chemically synthesised (Shanghai GenePharma
Co.) to target the coding region and 3
0
-untranslated region (UTR) of IRTKS: siRNA-1
(5
0
-CCAGUCCCUUGAUCGAUAUTT-3
0
and 5
0
-AUAUCGAUCAAGGGACUGGTA-3
0
) and
siRNA-2 (5
0
-GCUUAAGCAAAUCAUGCUUTT-3
0
and 5
0
-AAGCAUGAUUUGCUUAAG-
CAG-3
0
). In addition, siRNA-NC (5
0
-UUCUCCGAACGUGUCACGUTT-3
0
and 5
0
-
ACGUGACACGUUCGGAGAATT-3
0
) was also synthesised for use as a control.
The synthesised DNA fragments encoding the short hairpin RNA (shRNA) used
for the knockdown of endogenous IRTKS were inserted into the pGCsi-H1-
Neo-GFP plasmid derived from pSUPER (Oligoengine, USA). The sequences of the
oligonucleotides for RNAi IRTKS were as follows: shRNA-1 (forward, 5-GATCCCCC-
CAGTCCCTTGATCGATATTTCAAGAGAATATCGATCAAGGGACTGGTTTTTGGAAA-3,
and reverse, 5-AGCTTTTCCAAAAACCAGTCCCTTGATCGATATTCTCTTGAAATATCGAT-
CAAGGGACTGGGGG-3) and shRNA-2 (forward, 5-GATCCCCGCTTAAGCAAAT-
CATGCTTTTCAAGAGAAAGCATGATTTGCTTAAGCTTTTTGGAAA-3, and reverse,
5-AGCTTTTCCAAAAAGCTTAAGCAAATCATGCTTTCTCTTGAAAAGCATGATTTGCT-
TAAGCGGG-3). pSUPER shRNA-NC contained irrelevant nucleotides and served as a
negative control.
2.9. Cell transfection
Cell transfection was performed with Lipofectamine™ 2000 Transfection Re-
agent (Invitrogen, USA) according to the manufacturer’s protocols.
2.10. Cell proliferation
Transiently transfected cells were cultured in a 96-well plate for 6 days, and cell
viability was tested using the Cell Counting Kit-8 (Dojindo Laboratories, Japan),
according to the instructions of the manufacturer. The optical density measured
at 450 nm was used as an indicator of cell viability.
2.11. Colony formation
HCC cells transfected with the vectors containing IRTKS (or the empty vector as
a control) or IRTKS shRNA (or shRNA-NC as a control) were cultured in 100-mm
dishes for colony formation; G418 (Life Technologies, USA) was added to the culture
medium at a final concentration of 0.6 to 1 mg/ml. After 3–4 weeks, proliferating
colonies were dyed with crystal violet and counted.
For the soft agar colony formation assay, the transfected cells were cultured and
grown on 24-well plates containing 0.5% top agar and 1% base agar. The plated cells
were cultured for 3–4 weeks, and the colonies were counted using a dissecting
microscope.
2.12. Tumour xenografts in vivo
Male BALB/c nude mice (5–6 weeks old) were purchased from Shanghai Exper-
imental Animal Center. The kinetics of tumour formation were assessed by measur-
ing the tumour sizes at 3 or 4-day intervals. Tumour size was measured with digital
callipers, and the tumour volume was calculated using the following formula:
volume = 0.5 width
2
length.
2.13. Immunohistochemistry (IHC) assays
Five micrometre thick paraffin-embedded tumour sections were pretreated
with methanol to inactivated endogenous peroxidase. The sections were incubated
with anti-IRTKS or anti-Ki-67 antibody (1:100) at 4 °C overnight, then incubated
with the horseradish peroxidase (HRP)-conjugated antibodies (DACO, Kyoto, Japan)
at 37 °C for 1 h. The signals were detected by Diaminobenzidine (DAB) Substrate Kit
(Vector Laboratories, Inc., Burlingame, CA) according to the manufacturer’s
instructions.
2.14. Cell cycle analysis
Flow cytometry was performed to analyse the cell cycle distribution. For DNA
content detection, the cells were fixed in 70% ethanol, resuspended in PBS, and trea-
ted with RNase A (10 mg/mL) and propidium iodide (10
l
g/mL) for 30 min each.
Samples were measured using a FACSCalibur flow cytometer, CellQuest (BD Biosci-
ences, USA).
2.15. Bromodeoxyuridine (BrdU) incorporation assay
Two methods were used to determine the population of cells in S phase of the
cell cycle. For immunofluorescence assays, the transfected cells were treated with
BrdU (Sigma–Aldrich, USA) for 2 h and incubated with an anti-BrdU antibody
Y.-P. Wang et al. / Cancer Letters 337 (2013) 96–106 97
(1:100), followed by incubation with Alexa Fluor
Ò
Dyes (1:200, Invitrogen, USA).
Confocal microscopy (Carl Zeiss, Germany) was performed to analyse the cellular
incorporation of BrdU. In flow cytometric detection, the cells treated with BrdU
were incubated with an FITC-conjugated mouse anti-BrdU monoclonal antibody
and an mouse IgG1 isotype served as a control (20
l
l, BD Pharmingen™, USA).
The samples were measured using a FACSCalibur flow cytometer.
2.16. Immunofluorescence assays
An immunofluorescence assay was used to detect the colocalisation of IRTKS
and EGFR. The cells were incubated with anti-IRTKS and -EGFR antibodies
(1:200), with Alexa Fluor
Ò
488 (green) and Alexa Fluor
Ò
546 (red)-coupled second-
ary antibodies (1:200, Invitrogen, USA), respectively. The stained cells were ob-
served by Zeiss confocal microscopy and a ZEISS LSM Image Browser (Carl Zeiss,
Germany).
2.17. Co-immunoprecipitation (Co-IP)
HCC cells were resuspended in 1 ml of lysis buffer (20 mM Tris, [pH 7.5],
150 mM NaCl, 1.0% Triton X-100, 1 mM EDTA, and protease inhibitor cocktail).
The cell lysates were immunoprecipitated by incubation with 1
l
g anti-IRTKS or
anti-EGFR antibody, followed by immunoblotting with antibodies (1: 1000) against
p-Y, IRTKS, EGFR, and p-EGFR (Tyr 1173). The cell lysates incubated with 1
l
g IgG
served as a control.
2.18. Statistics
Significant differences and variances were evaluated using Student’s ttests.
Averaged data are presented as means ± standard deviation (SD). P< 0.05 was con-
sidered to be significant.
3. Results
3.1. IRTKS is upregulated in HCC and is associated with tumour size
To observe whether IRTKS contributes to HCC progression, we
analysed IRTKS mRNA expression in 68 HCC patients and 14 HCC
cell lines by real-time RT-PCR and western blotting. We found that
IRTKS mRNA expression was significantly upregulated in the HCC
tissue samples compared to the corresponding adjacent nontu-
mourous liver samples (Fig. 1A, P< 0.001). In these 68 samples,
Fig. 1. IRTKS is upregulated in HCC and liver cancer cell lines. (A) Expression of IRTKS in 68 pairs of human HCC and their corresponding non-tumourous samples. The IRTKS
expression level was determined by real-time PCR and normalised to an endogenous control (b-actin). The statistical analysis was performed using paired t-tests. (B) Paired
comparison of IRTKS expression levels between primary HCC samples and the corresponding noncancerous tissue samples. (C) Immunoblotting analysis results of 8 pairs of
HCC (C) and the adjacent non-HCC liver tissue (N). (D) Expression levels of IRTKS determined by immunoblotting analysis in 8 HCC cell lines. b-actin was used as an internal
control. All the above experiments were repeated at least 3 times to confirm the reproducibility of the results. The data are presented as the mean ± SD.
P< 0.001 versus the
control.
Table 1
The correlations of IRTKS expression with various clinicopathological features of HCC.
Clinicopathological
feature
Number of
cases
Expression of IRTKS
(mean ± SEM)
P-
value
Gender
Male 49 0.008 ± 0.001 0.516
Female 7 0.007 ± 0.001
Age (years)
P60 23 0.009 ± 0.001 0.044
*
<60 33 0.007 ± 0.001
HBsAg
P0.5 44 0.007 ± 0.001 0.129
<0.5 12 0.009 ± 0.001
HCV
Positive 1 0.013 –
Negative 55 0.007 ± 0.001
Diameter (cm)
P5 28 0.009 ± 0.001 0.002
**
<5 28 0.006 ± 0.001
Degree of differentiation
Well 4 0.005 ± 0.001 0.158
Moderately and
poorly
52 0.008 ± 0.001
TNM stage
I + II 7 0.007 ± 0.001 0.521
III + IV 49 0.008 ± 0.001
*
P< 0.05.
**
P< 0.01 between the two groups.
98 Y.-P. Wang et al. / Cancer Letters 337 (2013) 96–106
27 (39.7%) HCC cases exhibited an IRTKS mRNA level at least 2-fold
higher than the corresponding nontumourous liver tissue (Fig. 1B).
Eight pairs of typical cases are illustrated (Fig. 1CSupplementary
Fig. S1A and S1D). Moreover, the expression of IRTKS in most of
the examined human HCC cell lines was determined (Fig. 1D, Sup-
plementary Fig. S1B and S1C) to exist at a higher basal level when
compared to normal adult liver and foetal liver tissue.
In addition, we evaluated the expression of IRTKS in 56 HCC pa-
tients, and the correlations between the IRTKS expression level and
the clinicopathological characteristics of HCC are summarised in
Table 1. The expression of IRTKS in HCC patients did not signifi-
cantly correlate with gender, HBsAg, differentiation, and TNM
stage. In contrast, IRTKS expression was significantly associated
with tumour size, suggesting that IRTKS might have a stimulatory
role in the progression of HCC. Furthermore, IRTKS expression was
associated with the age of the patient, implying that IRTKS is per-
haps connected with other factors.
3.2. Overexpression of IRTKS promotes HCC cell proliferation and
colony formation in vitro
To determine the effect of IRTKS on HCC cells, recombinant
pcDNA3.1-IRTKS was transiently transfected into 2 HCC cell lines
with high expression levels (Huh7 and YY-8103) and 2 HCC cell
lines with relatively low expression levels (Hep3B and SK-hep-1),
as based on their expression profiles (Fig. 1D). After evaluating
the detectability of the recombinant IRTKS plasmid (Supplemen-
tary Fig. S2A and S2B), we observed that cell growth and colony
formation were significantly promoted by IRTKS overexpression
when compared to that of the cells transfected with the empty vec-
tor (Fig. 2A and B). Moreover, in soft agar, the ectopic IRTKS-trans-
fected HCC cell lines were endowed with abundant energy,
displaying more invasive growth that was accompanied by in-
creases in colony quantity and size, relative to the cells transfected
with the empty vector (Fig. 2C). This strong ability for anchorage-
Fig. 2. Overexpression of IRTKS promotes HCC cellular proliferation and colony formation in vitro. (A) Ectopic IRTKS promoted the proliferation of 4 HCC cell lines. (B)
Overexpressed IRTKS enhanced the colony formation of the HCC cell lines, as shown by representative plates of cells transfected with the IRTKS expression vector and empty
control vector. The histograms represent the numbers of colonies, and the data are shown as the mean ± SD. (C) Forced IRTKS expression promoted colony formation in soft
agar. The histograms represent the numbers of colonies, and the data are shown as the mean ± SD. All the above experiments were repeated at least 3 times to confirm the
reproducibility of the results.
P< 0.05,
P< 0.01 versus the control.
Y.-P. Wang et al. / Cancer Letters 337 (2013) 96–106 99
dependent and -independent growth suggested a specific require-
ment for IRTKS in maintaining normal cell proliferation.
3.3. Knockdown of IRTKS inhibits HCC cell proliferation and colony
formation in vitro
To further evaluate the effects of IRTKS on cell proliferation and
colony formation, we used chemically synthesised siRNAs and con-
structed an shRNA derived from the recombinant pSUPER plasmid
to knockdown endogenous IRTKS in the 4 HCC cell lines. As ex-
pected, both siRNAs significantly knocked down endogenous IRTKS
(Supplementary Fig. S3A) and inhibited the growth of the HCC cells
when compared to the si-NC-transfected cells (Fig. 3A). To investi-
gate the effect of IRTKS on colony formation, two recombinant
pSUPER-producing shRNAs were constructed and transfected into
the HCC cell lines Hep3B, SK-hep-1, Huh-7, and YY-8103 (Supple-
mentary Fig. S3B). The resulting data showed that both shRNAs sig-
nificantly inhibited the colony formation of these cell lines
compared to the control shRNA-NC-infected cells (Fig. 3B). Fur-
thermore, the downregulation of IRTKS reduced the anchorage-
independent growth of these HCC cell lines in soft agar and
significantly decreased the number of larger colonies compared
to the cells transfected with the negative control shRNA (Fig. 3C).
These collective data implied that endogenous IRTKS might be
essential for maintaining cell proliferation and colony formation
in HCC cells.
3.4. IRTKS enhances tumourigenicity in vivo
To determine whether IRTKS upregulation contributes to HCC
oncogenesis and progression, we constructed a recombinant aden-
oviral vector producing IRTKS. As expected, these adenoviruses
efficiently infected SK-hep-1 and YY-8103 cells, as shown by Green
Fluorescent Protein (GFP, Supplementary Fig. S4A). The SK-hep-1
and YY-8103 cells infected with Ad-GFP and Ad-IRTKS were in-
jected subcutaneously into athymic mice, and tumourigenicity
was assessed in the xenograft model. The results showed that
IRTKS overexpression facilitated tumour growth in both HCC cell
lines (Fig. 4A). In our experiments, the size and weight of the tu-
mours formed from cells overexpressing IRTKS were significantly
higher than those of xenografts formed from cells infected with
the control Ad-GFP (Fig. 4B and C, and Supplementary Fig. S4B).
Fig. 3. Knockdown of IRTKS inhibits HCC cellular proliferation and colony formation in vitro. (A) IRTKS knockdown suppressed the proliferation of 4 HCC cell lines. (B) IRTKS
RNAi limited colony formation in the HCC cell lines, as shown by representative plates of cells transfected with the IRTKS shRNA constructs and shRNA-NC control. The
histograms represent the number of colonies, and the data are shown as the mean ± SD. (C) IRTKS RNAi suppressed colony formation in soft agar. The histograms represent
the number of colonies, and the data are shown as the mean ± SD. All the above experiments were repeated at least 3 times to confirm the reproducibility of the results.
P< 0.05,
P< 0.01 versus the control.
100 Y.-P. Wang et al. / Cancer Letters 337 (2013) 96–106
The upregulation of the recombinant IRTKS protein was detected
using an anti-IRTKS antibody in the excised xenograft tumours
(Supplementary Fig. S4C), and tumour sections were measured
by Ki67 to observe proliferation (Supplementary Fig. S4D).
To further identify whether IRTKS downregulation restrains
HCC oncogenesis, we used two YY-8103 stable cell lines that con-
taining stable knockdown of endogenous IRTKS by transfecting
pSUPER vector containing shRNA-1 and shRNA-2. As expected,
the 2 stable knockdown subclones, shRNA-1-4 and shRNA-2-9
(Supplementary Fig. S5A), showed significantly slower cell growth
than the subclone line with a stable shRNA-NC (Fig. 4D, and Sup-
plementary Fig. S5B). Inversely, the size and weight of the tumours
formed from cells IRTKS knockdown were significantly lower than
the control shRNA-NC (Fig. 4E and F). Finally, the downregulation
of the IRTKS protein and Ki67 level were detected in the excised
xenograft tumours (Supplementary Fig. S5C and S5D), suggesting
that IRTKS plays an important role in boosting cell overgrowth
in vivo.
3.5. IRTKS influences the G1-S cell cycle transition
Changes in cell proliferation are usually associated with altera-
tions in the cell cycle. To evaluate the function of IRTKS in cell cycle
progression, a flow cytometric analysis was used following the
staining of the transfected cells with propidium iodide (PI). There
were significant increases in the S-phase cell fraction of the
IRTKS-transfected SK-hep-1 and YY-8103 cells; in contrast, siRNA
reduced the S-phase fraction of these cells compared to the control
si-NC cells (Fig. 5A and Supplementary Fig. S5A). In addition, de
novo DNA synthesis was identified by BrdU incorporation in the
transfected cells. Immunofluorescence assays with an anti-BrdU
antibody showed that the IRTKS-transfected SK-hep-1 and YY-
8103 cells exhibited significant increases in BrdU incorporation,
whereas siRNA reduced the BrdU-incorporated proportion of SK-
hep-1 and YY-8103 cells (Fig. 5B). Moreover, a flow cytometric
analysis with an FITC-conjugated anti-BrdU antibody also sup-
ported the observation of ectopic IRTKS expression in the SK-
Fig. 4. IRTKS enhances tumourigenicity in vivo. (A) Xenograft tumour growth of SK-hep-1 and YY-8103 cells was promoted by infection with a recombinant adenovirus
carrying IRTKS; cells carrying the empty vector were used as the controls (n= 7). Xenograft tumour growth was monitored every 3 days by tumour diameter measurement
(mean ± SD). (B and C) All the xenograft tumours were removed from the experimental mice and weighed (mean ± SD). (D) Xenograft tumour growth of YY-8103 stable cell
lines was delayed by stable knockdown of endogenous IRTKS; cell subclone line with a stable shRNA-NC was used as the controls (n= 5). Xenograft tumour growth was
monitored every 4 days by tumour diameter measurement (mean ± SD). (E and F) All the xenograft tumours were removed from the experimental mice and weighed
(mean ± SD).
P< 0.05,
P< 0.01,
P< 0.001 versus the control.
Y.-P. Wang et al. / Cancer Letters 337 (2013) 96–106 101
hep-1 cells (Supplementary Fig. S5B). These data indicated that
IRTKS could enhance the proliferation of HCC cells by promoting
the entry into S phase of cell cycle progression.
3.6. IRTKS promotes cell proliferation by enhancing ERK signalling
The common cell signalling pathways involved in cell prolifera-
tion include EGFR/ERK [21], PI3K/Akt/mTOR [22], and Wnt/b-cate-
nin [23]. To determine which pathway is related to IRTKS, we used
western blot analysis to detect changes in p-ERK, p-Akt, and b-
catenin. After the upregulation of IRTKS in the SK-hep-1 cells, we
did not observe a difference in b-catenin and p-Akt between those
cells and the vector control. Interestingly, forced IRTKS expression
did increase the level of p-ERK when compared with that of the
cells transfected with the empty vector. In contrast, the opposite
results were obtained with the downregulation of IRTKS in SK-
hep-1 cells (Fig. 6A and B).
To further confirm the association between the effects of the
proliferation promoted by IRTKS and ERK, we used PD98059, an
inhibitor of ERK. Serum-starved SK-hep-1 and YY-8103 cells over-
expressed IRTKS and stimulated with EGF (20 ng/ml for 10 min),
exhibited substantial increases in ERK phosphorylation compared
to the cells containing the empty vector. Furthermore, EGF plus
PD98059 (10
l
M for 1 h) rescued the change in ERK phosphoryla-
tion caused by the overexpression of IRTKS (Fig. 6C and Supple-
mentary Fig. S6A); downregulation of IRTKS also impaired the
status of ERK phosphorylation (Fig. 6D and Supplementary
Fig. S6B). In addition, we observed an effect of ectopic IRTKS
expression and PD98059 on HCC proliferation: the result showed
that inhibiting ERK phosphorylation could rescue the prolifera-
tion-promoting role of IRTKS in the SK-hep-1 and YY-8103 cell
lines (Fig. 6E). Therefore, we inferred that the characteristic promo-
tion of proliferation by IRTKS was achieved by enhancing ERK
signalling.
3.7. IRTKS interacts with EGFR and affects EGFR activation
EGFR/ERK signalling is an important pathway in the regulation
of cellular proliferation [24,25]. To elucidate whether the enhance-
ment of ERK signalling by IRTKS occurs through an interaction with
EGFR, we used an immunofluorescence assay to observe the loca-
tion of the two molecules in cell. In serum-starved YY-8103 cells
treated with EGF (20 ng/ml for 0, 10, 30, 60, 90, and 120 min),
we noted that IRTKS was localised near the cell membrane at
10–60 min after EGF stimulation; the co-localisation of endoge-
nous IRTKS and EGFR was enhanced at 30 min after EGF stimula-
tion (Fig. 7A). This finding suggested that IRTKS might interact
with EGFR and then modulate EGFR activation in response to EGF
stimulation.
Fig. 5. IRTKS promotes the G1-S transition of the cell cycle. (A) The cell cycle distributions were analysed after SK-hep-1 and YY-8103 cells were infected with plasmids or
siRNA. The histogram columns represent the means. (B) The immunofluorescence assays depict the cells that incorporated BrdU (red), and the cell nucleus was dyed with
DAPI (blue). The histograms represent the percentage of BrdU incorporation, and the data are shown as the mean ± SD. All the above experiments were repeated 3 times.
P< 0.05,
P< 0.01 versus the control (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.).
102 Y.-P. Wang et al. / Cancer Letters 337 (2013) 96–106
To test this hypothesis, we used reciprocally endogenous co-
immunoprecipitation (Co-IP) experiments in SK-hep-1 and YY-
8103 cells with anti-IRTKS and EGFR antibodies. As expected, EGFR
was immunoprecipitated by the anti-IRTKS antibody in both cell
lines, and the interaction was strengthened with EGF stimulation.
We also observed that IRTKS tyrosine phosphorylation was en-
hanced after EGF treatment (Fig. 7B). Similarly, IRTKS was immu-
noprecipitated by the anti-EGFR antibody, and EGF stimulation
could also enhance this association. The phosphorylation levels of
EGFR at Tyr 1173 immunoprecipitated by IRTKS, in addition to
the site involved in MAP kinase signalling activation [26], were in-
creased after EGF stimulation (Fig. 7C). In conclusion, these collec-
tive data indicate that IRTKS function may be an adaptor of EGFR
that positively regulates ERK signalling.
4. Discussion
The abnormal expression of genes is very common in tumours.
Indeed, certain ‘‘driver genes’’ can affect tumour proliferation
[27,28], metastasis [29,30], and differentiation [31,32]. In addition,
some genes are ‘‘passenger genes’’ that might be used as clinical
markers [33,34]. Mounting evidence suggests an important role
for IRTKS in the regulation of actin filaments, including pedestal
formation [14,15,18], actin assembly and polymerisation
[13,16,35,36], and lamellipodia formation [9]. However, the func-
tional role of IRTKS in HCC proliferation remains unknown. In this
study, we showed that IRTKS is frequently upregulated in human
HCC and that this upregulation is significantly associated with tu-
mour size. These data suggest that IRTKS might play a specific
functional role in HCC.
Clearly, the most elementary characteristic of cancer cells is
their ability to maintain chronic proliferation [37]. Accordingly,
the development of an effective intervention targeting proliferous
disease should improve the mortality rate and surgical opportunity
of cancer patients. In this study, the forced expression of IRTKS pro-
moted the proliferation, colony formation, and anchorage-inde-
pendent growth of HCC cells both in vitro and in vivo. In contrast,
the downregulation of IRTKS produced the opposite results, further
confirming that IRTKS can facilitate HCC cell proliferation.
ERK is a well-documented, important signalling node that reg-
ulates cell growth and differentiation [38,39]. In addition, the
activities of Akt [40,41] and b-catenin [42,43] are also related to
cell proliferation. After preliminary screening, we found that IRTKS
Fig. 6. IRTKS promotes cellular proliferation by enhancing ERK signalling. (A) After overexpression and knockdown of IRTKS, canonical signalling pathway nodes were
screened using immunoblotting. (B) The relative quantification of bands was performed by the optical density scanning of (A). (C) ERK phosphorylation was detected by
immunoblotting after the cells overexpressing IRTKS and treated with PD98059 (an ERK inhibitor). (D) Phosphorylation of ERK was detected by immunoblotting after IRTKS
knockdown. (E) Cell proliferation was detected after the cells overexpressing IRTKS and treated with PD98059 (mean ± SD). The results of the above analyses were from 3
independent experiments.
P< 0.05,
P< 0.01,
P< 0.001 versus the control;
#
P< 0.05,
##
P< 0.01,
###
P< 0.001 IRTKS plus PD98059 versus IRTKS.
Y.-P. Wang et al. / Cancer Letters 337 (2013) 96–106 103
can affect the phosphorylation status of ERK. We further identified
EGFR, an important proliferation-associated receptor and upstream
molecular of ERK signalling [44,45], in this response. Strikingly, the
results of this study showed that IRTKS regulates cell proliferation
by associating with EGFR and adjusting the tyrosine-specific pro-
tein kinase activity intrinsic to the EGF receptor. To our knowledge,
this is the first report to explore the role of IRTKS in the tumouri-
genesis of HCC, and our results indicate that IRTKS functions in
promoting the proliferation of HCC cells by interacting with EGFR.
Interestingly, the data provided in Table 1 exhibit that IRTKS
expression is associated with patient age. Because a previous study
revealed that IRTKS is a substrate of the insulin receptor tyrosine
kinase [13], it is possible that IRTKS is involved in the insulin sig-
nalling pathway, as the older age group is the population at high
risk for diabetes.
In summary, we identified the promotion of proliferation as an-
other important function of IRTKS. IRTKS is frequently upregulated
and associated with tumour size in HCC. The ectopic expression of
IRTKS facilitates HCC cell proliferation, colony formation, and
anchorage-independent growth by strengthening the interaction
with EGFR and via the positive regulation of ERK phosphorylation.
Using these data, we derived a simple signalling flow chart
Fig. 7. IRTKS interacts with EGFR and affects EGFR phosphorylation. (A) Dynamic images of YY-8103 cells are shown with EGF stimulation for the indicated times. (B and C)
Reciprocal Co-IP experiments were performed using cell extracts from SK-hep-1 and YY-8103 cells with anti-IRTKS (B) and -EGFR (C) antibodies. The asterisk (
) indicates the
IgG heavy chain. (D) Schematic representation of the regulation of HCC proliferation involving IRTKS that is formed following EGF stimulation.
104 Y.-P. Wang et al. / Cancer Letters 337 (2013) 96–106
(Fig. 7D). Future investigations will assess the precise interaction
between IRTKS and EGFR in relation with the EGFR/Shc/GRB2 com-
plex [46]. Expanding on the role of IRTKS in HCC cell proliferation
will promote our understanding of the sophisticated mechanisms
underlying liver cancer progression and might improve the devel-
opment of new treatment regimens for curing liver cancer.
Funding
This work was supported by Chinese National Key Program on
Basic Research (2010CB529200), China National Key Projects for
Infectious Disease (2012ZX10002012-008 and 2013ZX10002010-
006), and National Natural Science Foundation (81071722 and
81272271).
Conflict of Interest
We declare that there are no potential conflicts of interest.
Acknowledgements
We gratefully acknowledge Qing Deng and Xiao Xu for help in
the cell cycle analysis, Da-Li Zheng, Bing-Bing Wan, Yan-Dong Li,
Rui-Fang Liu, Na Cheng, and Hui Chen for experimental assistance,
and Fei Chen, Qian-Lan Fei, and Jin-Shan Li for help in cell
culturing.
Appendix A. Supplementary material
Supplementary data associated with this article can be found,
in the online version, at http://dx.doi.org/10.1016/j.canlet.2013.
05.019.
References
[1] A. Jemal, F. Bray, M.M. Center, J. Ferlay, E. Ward, D. Forman, Global cancer
statistics, CA Cancer J. Clin. 61 (2011) 69–90.
[2] J.F. Perz, G.L. Armstrong, L.A. Farrington, Y.J. Hutin, B.P. Bell, The contributions
of hepatitis B virus and hepatitis C virus infections to cirrhosis and primary
liver cancer worldwide, J. Hepatol. 45 (2006) 529–538.
[3] N.C. Tsim, A.E. Frampton, N.A. Habib, L.R. Jiao, Surgical treatment for liver
cancer, World J. Gastroenterol. 16 (2010) 927–933.
[4] P. Yang, Q.J. Li, Y. Feng, Y. Zhang, G.J. Markowitz, S. Ning, Y. Deng, J. Zhao, S.
Jiang, Y. Yuan, H.Y. Wang, S.Q. Cheng, D. Xie, X.F. Wang, TGF-beta-miR-34a-
CCL22 signaling-induced treg cell recruitment promotes venous metastases of
HBV-positive hepatocellular carcinoma, Cancer Cell. 22 (2012) 291–303.
[5] J. Yang, X. Cai, W. Lu, C. Hu, X. Xu, Q. Yu, P. Cao, Evodiamine inhibits STAT3
signaling by inducing phosphatase shatterproof 1 in hepatocellular carcinoma
cells, Cancer Lett. 328 (2013) 243–251.
[6] J.P. Guegan, F. Ezan, N. Theret, S. Langouet, G. Baffet, MAPK signaling in
cisplatin-induced death: predominant role of ERK1 over ERK2 in human
hepatocellular carcinoma cells, Carcinogenesis 34 (2013) 38–47.
[7] C.M. Tsao, M.D. Yan, Y.L. Shih, P.N. Yu, C.C. Kuo, W.C. Lin, H.J. Li, Y.W. Lin, SOX1
functions as a tumor suppressor by antagonizing the WNT/beta-catenin
signaling pathway in hepatocellular carcinoma, Hepatology 56 (2012) 2277–
2287.
[8] R.M. Hu, Z.G. Han, H.D. Song, Y.D. Peng, Q.H. Huang, S.X. Ren, Y.J. Gu, C.H.
Huang, Y.B. Li, C.L. Jiang, G. Fu, Q.H. Zhang, B.W. Gu, M. Dai, Y.F. Mao, G.F. Gao,
R. Rong, M. Ye, J. Zhou, S.H. Xu, J. Gu, J.X. Shi, W.R. Jin, C.K. Zhang, T.M. Wu, G.Y.
Huang, Z. Chen, M.D. Chen, J.L. Chen, Gene expression profiling in the human
hypothalamus–pituitary–adrenal axis and full-length cDNA cloning, Proc. Natl.
Acad. Sci. USA 97 (2000) 9543–9548.
[9] G. Scita, S. Confalonieri, P. Lappalainen, S. Suetsugu, IRSp53: crossing the road
of membrane and actin dynamics in the formation of membrane protrusions,
Trends Cell Biol. 18 (2008) 52–60.
[10] H. Miki, H. Yamaguchi, S. Suetsugu, T. Takenawa, IRSp53 is an essential
intermediate between Rac and WAVE in the regulation of membrane ruffling,
Nature 408 (2000) 732–735.
[11] A. Disanza, S. Mantoani, M. Hertzog, S. Gerboth, E. Frittoli, A. Steffen, K.
Berhoerster, H.J. Kreienkamp, F. Milanesi, P.P. Di Fiore, A. Ciliberto, T.E. Stradal,
G. Scita, Regulation of cell shape by Cdc42 is mediated by the synergic actin-
bundling activity of the Eps8-IRSp53 complex, Nat. Cell Biol. 8 (2006) 1337–
1347.
[12] A. Yamagishi, M. Masuda, T. Ohki, H. Onishi, N. Mochizuki, A novel actin
bundling/filopodium-forming domain conserved in insulin receptor tyrosine
kinase substrate p53 and missing in metastasis protein, J. Biol. Chem. 279
(2004) 14929–14936.
[13] T.H. Millard, J. Dawson, L.M. Machesky, Characterisation of IRTKS, a novel
IRSp53/MIM family actin regulator with distinct filament bundling properties,
J. Cell Sci. 120 (2007) 1663–1672.
[14] A.R. Wong, B. Raymond, J.W. Collins, V.F. Crepin, G. Frankel, The
enteropathogenic E. coli effector EspH promotes actin pedestal formation
and elongation via WASP-interacting protein (WIP), Cell. Microbiol. (2012).
[15] T.J. Ruetz, A. En-Ju Lin, J.A. Guttman, Enterohaemorrhagic Escherichia coli
requires the spectrin cytoskeleton for efficient attachment and pedestal
formation on host cells, Microb. Pathogenesis 52 (2012) 149–156.
[16] O. Aitio, M. Hellman, B. Skehan, T. Kesti, J.M. Leong, K. Saksela, P. Permi,
Enterohaemorrhagic Escherichia coli exploits a tryptophan switch to hijack
host f-actin assembly, Structure 20 (2012) 1692–1703.
[17] J.C. de Groot, K. Schluter, Y. Carius, C. Quedenau, D. Vingadassalom, J. Faix, S.M.
Weiss, J. Reichelt, C. Standfuss-Gabisch, C.F. Lesser, J.M. Leong, D.W. Heinz, K.
Bussow, T.E. Stradal, Structural basis for complex formation between human
IRSp53 and the translocated intimin receptor Tir of enterohemorrhagic E. coli,
Structure 19 (2011) 1294–1306.
[18] D. Vingadassalom, A. Kazlauskas, B. Skehan, H.C. Cheng, L. Magoun, D. Robbins,
M.K. Rosen, K. Saksela, J.M. Leong, Insulin receptor tyrosine kinase substrate
links the E. coli O157:H7 actin assembly effectors Tir and EspF(U) during
pedestal formation, Proc. Natl. Acad. Sci. USA 106 (2009) 6754–6759.
[19] G. Chen, T. Li, L. Zhang, M. Yi, F. Chen, Z. Wang, X. Zhang, Src-stimulated IRTKS
phosphorylation enhances cell migration, FEBS Lett. 585 (2011) 2972–2978.
[20] K.S. Wang, G. Chen, H.L. Shen, T.T. Li, F. Chen, Q.W. Wang, Z.Q. Wang, Z.G. Han,
X. Zhang, Insulin receptor tyrosine kinase substrate enhances low levels of
MDM2-mediated p53 ubiquitination, PLoS One 6 (2011) e23571.
[21] C. Andradas, M.M. Caffarel, E. Perez-Gomez, M. Salazar, M. Lorente, G. Velasco,
M. Guzman, C. Sanchez, The orphan G protein-coupled receptor GPR55
promotes cancer cell proliferation via ERK, Oncogene 30 (2011) 245–252.
[22] M.T. Lau, P.C. Leung, The PI3K/Akt/mTOR signaling pathway mediates insulin-
like growth factor 1-induced E-cadherin down-regulation and cell
proliferation in ovarian cancer cells, Cancer Lett. 326 (2012) 191–198.
[23] M. Basu, S.S. Roy, Wnt/beta-catenin pathway is regulated by PITX2
homeodomain protein and thus contributes to the proliferation of human
ovarian adenocarcinoma cell, SKOV-3, J. Biol. Chem. (2012).
[24] S. Ling, X. Chang, L. Schultz, T.K. Lee, A. Chaux, L. Marchionni, G.J. Netto, D.
Sidransky, D.M. Berman, An EGFR–ERK–SOX9 signaling cascade links
urothelial development and regeneration to cancer, Cancer Res. 71 (2011)
3812–3821.
[25] J.M. Hsu, C.T. Chen, C.K. Chou, H.P. Kuo, L.Y. Li, C.Y. Lin, H.J. Lee, Y.N. Wang, M.
Liu, H.W. Liao, B. Shi, C.C. Lai, M.T. Bedford, C.H. Tsai, M.C. Hung, Crosstalk
between Arg 1175 methylation and Tyr 1173 phosphorylation negatively
modulates EGFR-mediated ERK activation, Nat. Cell Biol. 13 (2011) 174–181.
[26] E. Zwick, P.O. Hackel, N. Prenzel, A. Ullrich, The EGF receptor as central
transducer of heterologous signalling systems, Trends Pharmacol. Sci. 20
(1999) 408–412.
[27] A. Ravi, A.M. Gurtan, M.S. Kumar, A. Bhutkar, C. Chin, V. Lu, J.A. Lees, T. Jacks,
P.A. Sharp, Proliferation and tumorigenesis of a murine sarcoma cell line in the
absence of DICER1, Cancer Cell. 21 (2012) 848–855.
[28] Q. Deng, Q. Wang, W.Y. Zong, D.L. Zheng, Y.X. Wen, K.S. Wang, X.M. Teng, X.
Zhang, J. Huang, Z.G. Han, E2F8 contributes to human hepatocellular
carcinoma via regulating cell proliferation, Cancer Res. 70 (2010) 782–791.
[29] N. Cheng, Y. Li, Z.G. Han, Ago2 promotes tumor metastasis via upregulating
FAK expression in hepatocellular carcinoma, Hepatology (2012).
[30] J. Huang, D.L. Zheng, F.S. Qin, N. Cheng, H. Chen, B.B. Wan, Y.P. Wang, H.S. Xiao,
Z.G. Han, Genetic and epigenetic silencing of SCARA5 may contribute to
human hepatocellular carcinoma by activating FAK signaling, J. Clin. Invest.
120 (2010) 223–241.
[31] A. Begum, Y. Kim, Q. Lin, Z. Yun, DLK1, delta-like 1 homolog (Drosophila),
regulates tumor cell differentiation in vivo, Cancer Lett. 318 (2012) 26–33.
[32] B. King, P. Ntziachristos, I. Aifantis, Hijacking T cell differentiation: new
insights in TLX function in T-ALL, Cancer Cell. 21 (2012) 453–455.
[33] Y.H. Jan, H.Y. Tsai, C.J. Yang, M.S. Huang, Y.F. Yang, T.C. Lai, C.H. Lee, Y.M. Jeng,
C.Y. Huang, J.L. Su, Y.J. Chuang, M. Hsiao, Adenylate kinase-4 is a marker of
poor clinical outcomes that promotes metastasis of lung cancer by
downregulating the transcription factor ATF3, Cancer Res. 72 (2012) 5119–
5129.
[34] X. Xu, R.F. Liu, X. Zhang, L.Y. Huang, F. Chen, Q.L. Fei, Z.G. Han, DLK1 as a
potential target against cancer stem/progenitor cells of hepatocellular
carcinoma, Mol. Cancer Ther. 11 (2012) 629–638.
[35] V.F. Crepin, F. Girard, S. Schuller, A.D. Phillips, A. Mousnier, G. Frankel,
Dissecting the role of the Tir:Nck and Tir:IRTKS/IRSp53 signalling pathways
in vivo, Mol. Microbiol. 75 (2010) 308–323.
[36] O. Aitio, M. Hellman, A. Kazlauskas, D.F. Vingadassalom, J.M. Leong, K. Saksela,
P. Permi, Recognition of tandem PxxP motifs as a unique Src homology 3-
binding mode triggers pathogen-driven actin assembly, Proc. Natl. Acad. Sci.
USA 107 (2010) 21743–21748.
[37] D. Hanahan, R.A. Weinberg, Hallmarks of cancer: the next generation, Cell 144
(2011) 646–674.
[38] A. Friedman, N. Perrimon, A functional RNAi screen for regulators of receptor
tyrosine kinase and ERK signalling, Nature 444 (2006) 230–234.
[39] C. Rommel, B.A. Clarke, S. Zimmermann, L. Nunez, R. Rossman, K. Reid, K.
Moelling, G.D. Yancopoulos, D.J. Glass, Differentiation stage-specific inhibition
of the Raf–MEK–ERK pathway by Akt, Science 286 (1999) 1738–1741.
Y.-P. Wang et al. / Cancer Letters 337 (2013) 96–106 105
[40] Y.J. Cheng, J.W. Tsai, K.C. Hsieh, Y.C. Yang, Y.J. Chen, M.S. Huang, S.S. Yuan, Id1
promotes lung cancer cell proliferation and tumor growth through Akt-related
pathway, Cancer Lett. 307 (2011) 191–199.
[41] D. Ruckerl, S.J. Jenkins, N.N. Laqtom, I.J. Gallagher, T.E. Sutherland, S. Duncan,
A.H. Buck, J.E. Allen, Induction of IL-4Ralpha-dependent microRNAs identifies
PI3K/Akt signaling as essential for IL-4-driven murine macrophage
proliferation in vivo, Blood 120 (2012) 2307–2316.
[42] S. Vijayakumar, G. Liu, I.A. Rus, S. Yao, Y. Chen, G. Akiri, L. Grumolato, S.A.
Aaronson, High-frequency canonical Wnt activation in multiple sarcoma
subtypes drives proliferation through a TCF/beta-catenin target gene, CDC25A,
Cancer Cell. 19 (2011) 601–612.
[43] G. Liu, S. Jiang, C. Wang, W. Jiang, Z. Liu, C. Liu, H. Saiyin, X. Yang, S. Shen, D.
Jiang, P. Zhou, D. Han, X. Hu, Q. Yi, L. Yu, Zinc finger transcription factor 191,
directly binding to beta-catenin promoter, promotes cell proliferation of
hepatocellular carcinoma, Hepatology 55 (2012) 1830–1839.
[44] R. Benelli, R. Vene, S. Minghelli, S. Carlone, B. Gatteschi, N. Ferrari, Celecoxib
induces proliferation and Amphiregulin production in colon subepithelial
myofibroblasts, activating erk1-2 signaling in synergy with EGFR, Cancer Lett.
328 (2013) 73–82.
[45] A. Jain, E. Penuel, S. Mink, J. Schmidt, A. Hodge, K. Favero, C. Tindell, D.B. Agus,
HER kinase axis receptor dimer partner switching occurs in response to EGFR
tyrosine kinase inhibition despite failure to block cellular proliferation, Cancer
Res. 70 (2010) 1989–1999.
[46] R.J. Coffey, M.K. Washington, C.L. Corless, M.C. Heinrich, Menetrier disease and
gastrointestinal stromal tumors: hyperproliferative disorders of the stomach,
J. Clin. Invest. 117 (2007) 70–80.
106 Y.-P. Wang et al. / Cancer Letters 337 (2013) 96–106
