Content uploaded by Zheng-Lin Jiang
Author content
All content in this area was uploaded by Zheng-Lin Jiang on Mar 10, 2016
Content may be subject to copyright.
Content uploaded by Zheng-Lin Jiang
Author content
All content in this area was uploaded by Zheng-Lin Jiang on Jan 19, 2016
Content may be subject to copyright.
Neuroprotective Effects of Hyperbaric Oxygen Treatment
on Traumatic Brain Injury in the Rat
Guo-Hua Wang,
1,
*
Xiang-Gen Zhang,
1,3,
*
Zheng-Lin Jiang,
1
Xia Li,
1
Liang-Liang Peng,
1
Yong-Cai Li,
2
and Yong Wang
2
Abstract
This study was designed to evaluate the potential benefits of hyperbaric oxygen (HBO) in the treatment of
traumatic brain injury (TBI). The right cerebral cortex of rats was injured by the impact of a 20-g object dropped
from a predetermined height. The rats received HBO treatment at 3 ATA for 60 min after TBI. Neurological
behavior score, brain water content, neuronal loss in the hipp ocampus, and cell apoptosis in brain tissue
surrounding the primary injury site were examined to determine brain damage severity. Th ree and six hours
after TBI, HBO-treated rats displayed a significant reduction in brain damage. However, by 12 h after TBI, the
efficacy of HBO treatment was con siderably attenuated. Furthermore, at 24, 48, and 72 h after TBI, the HB O
treatment did not show any notable effects. In contrast, multiple HBO treatments (three or five times in all), even
when started 48 h after TBI, remarkably reduced neurology deficit scores and the loss of neuronal numbers in the
hippocampus. Although multiple treatments started at 48 h significantly imp roved neurological behaviors and
reduced brain injury, the overall beneficial effects were substantially weaker than those seen after a single
treatment at 6 h. These results suggest that: (1) HBO treatment could alleviate brain damage after TBI; (2) a single
treatment with HBO has a time limitation of 12 h post-TBI; and (3) multiple HBO treatments have the possibility
to extend the post-TBI delivery time window. Therefore, our results clearly suggest the validity of HBO therapy
for the treatment of TBI.
Key words: apoptosis; hyperbaric oxygen; neuroprotective effect; secondary brain damage; time windo w, trau-
matic brain injury
Introduction
T
raumatic brain injury (TBI) leads to the death and
disability of millions of individuals around the world
every year (Flanagan et al., 2008), and constitutes the most
common cause of death and chronic disability in individuals
under 35 years old (Chua et al., 2007). Although TBI is a major
public health problem, patients are still inadequately treated
because of the lack of effective therapies (Adamides et al.,
2006; Flanagan et al., 2008; Roberts et al., 1998). Primary in-
juries, such as cerebral contusions, lacerations, and diffuse
axonal injury, usually induce irreversible damage to brain
tissues (Maas et al., 2008). Secondary injuries, resulting from
intracranial causes (mass lesions, focal/diffuse brain swelling,
intracranial hypertension, seizures, vasospasm, and infec-
tion), and/or extracranial causes (hypotension, hypoxia,
hyper/hypocapnia, hyper/hypoglycemia, anemia, pyrexia,
electrolyte abnormalities, coagulopathy, and infection), can
lead to cerebral ischemia, energy failure, inflammation, oxi-
dative stress, and neuronal death. For the primary injury, little
can be done except to attempt injury prevention. Therefore,
prevention and treatment of secondary brain injury repre-
sents a major aspect of the therapeutic management of TBI
(Adamides et al., 2006; Schneider et al., 2002). For instance, a
lack of prevention of hypotension and hypoxia can aggravate
cerebral hypo-oxygenation (low oxygen delivery), with con-
siderable detrimental effects on patient outcomes (Narotam
et al., 2006). Therefore, improvements in tissue oxygenation
post-TBI may represent an important therapeutic strategy.
Usually, hyperbaric oxygen (HBO) therapy is achieved
by exposing a patient to barometric pressures higher than
ambient pressure (1 atmosphere absolute [1 ATA]), while
they breathe 100% oxygen. Exposure to HBO dramati-
cally increases the oxygen content of the blood via physical
1
Department of Neuropharmacology, Institute of Nautical Medicine, Nantong University, Nantong, Jiangsu, China.
2
Department of Neurosurgery, First Hospital of Nantong, Nantong, Jiangsu, China.
3
Shanghai Salvage Corporation, Shanghai, China.
*
These authors contributed equally to this work.
JOURNAL OF NEUROTRAUMA 27:1733–1743 (September 2010)
ª Mary Ann Liebert, Inc.
DOI: 10.1089/neu.2009.1175
1733
dissolution of oxygen (Calvert et al., 2007; Daugherty et al.,
2004; Nemoto and Betterman, 2007). In mammals, the in-
creased blood oxygen levels seen during HBO treatment are
released passively, and can penetrate into ischemic areas
more deeply than under normobaric conditions (Calvert et al.,
2007; Nemoto and Betterman, 2007). Therefore, HBO may be a
very useful therapy for TBI patients. However, a recent liter-
ature review does not support the use of hyperbaric oxygen
for TBI and stroke (Oppel, 2003), and the value of HBO
treatment in TBI remains controversial (Rockswold et al.,
2007). There remain many questions about the use of HBO
therapy in TBI, such as the most effective therapeutic time
window for the application of HBO, the optimal dosing reg-
imen, guidelines that should be followed for repeated expo-
sures, and the safety of re-exposure (Daugherty et al., 2004;
Nemoto and Betterman, 2007). In the present study, we in-
vestigated the time window and the therapeutic effects of
repeated HBO treatments for TBI. We also evaluated the value
of systemic delivery of HBO treatment.
Pathologically, TBI shares several similarities with ischemic
stroke. Both of them are characterized by central necrosis and
a peri-lesional penumbra, where both excitotoxic and ische-
mic events eventually lead to delayed neuronal death (Leker
and Shohami, 2002). In TBI, apoptosis commonly occurs in the
peri-lesional area as a result of secondary brain insults ( Chen
et al., 2008; Conti et al., 1998). Several previous studies have
demonstrated that HBO can prevent apoptotic death of neu-
ronal cells in cerebral ischemic-anoxic and contusion insults
(Calvert et al., 2003; Palzur et al., 2004). Nevertheless, the ef-
fects of HBO on neural apoptosis after TBI have not been fully
elucidated. Therefore in this study we also examined apo-
ptosis in brain tissue surrounding the primary injury site to
explore the potential value of HBO in reducing secondary
traumatic brain damage.
Methods
Animals
Male Sprague-Dawley rats (250–280 g body weight) were
provided by the Experimental Animal Center of Nantong
University, Nantong, China. The rats were housed in a
temperature- and humidity-controlled animal facility with a
12-h light/dark cycle. All procedures used in this study were
in accordance with our institutional guidelines, which comply
with internationally accepted humane standards. The animal
study groups are shown in Table 1.
Traumatic brain injury
The rats were anesthetized using 2 mL enflurane in an ether
jar, and maintained with 10% chloral hydrate (400 mg kg
–1
IP).
The head of the animal was fixed in a stereotactic frame. A
right parietal craniotomy (3.5 mm posterior and 2.5 mm lat-
eral to the bregma, diameter 5 mm) was performed with a drill
under aseptic conditions. Following Feeney’s weight-drop
model (Feeney et al., 1981), a standardized parietal contusion
was produced by letting a steel rod weighing 20 g with a flat
end and diameter of 4.5 mm drop onto a piston resting on the
dura from a height of 30 cm. The piston was allowed to
compress the brain tissue to a depth of 2.5 mm. Heart rate,
Table 1. The Study Groups and the Corresponding Observation Intervals after TBI
Group
Morphological
evaluation
No. of rats for
neurological
observation
Gravimetric
analysis Total no.
Survival
interval
Therapeutic modes
Control 6 6 2 days
3 ATA N
2
-O
2
6 6 2 days
1 ATA O
2
6 6 2 days
3 ATA O
2
6 6 2 days
Time window of HBO
Sham-operated 10 6 6 12 4 days
Control 10 6 6 12 4 days
3 h after TBI 10 6 6 12 4 days
6 h after TBI 10 6 6 12 4 days
12 h after TBI 10 6 6 12 4 days
24 h after TBI 10 6 6 12 4 days
48 h after TBI 10 6 6 12 4 days
72 h after TBI 10 6 6 12 4 days
No. of HBO treatments (first treatment started at 6, 24, 48, or 72 h after TBI)
Control 10464 40 9 days
1 treatment 10464 40 9 days
3 treatments 10464 40 9 days
5 treatments 10464 40 9 days
Apoptosis detection RT-PCR TUNEL assay
Sham-operated 4 4 8 1 day
Control 4 4 8 1 day
HBO 4 4 8 1 day
Total no. of rats used for all groups 304
HBO, hyperbaric oxygen; RT-PCR, reverse-transcriptase polymerase chain reaction; TUNEL, terminal deoxynucleotidyl transferase-
mediated dUTP nick end labeling; TBI, traumatic brain injury; ATA, absolute atmosphere.
1734 WANG ET AL.
arterial blood pressure, and rectal temperature were moni-
tored. The animal’s temperature was maintained at 37 0.58C
throughout the experiment. Sham-operated rats were an-
esthetized and only the right parietal craniotomy was carried
out. All animals were randomly distributed in the study
groups.
Hyperbaric oxygen treatment
All treatments were begun at 9:00 am to prevent biological
rhythm differences. The animals were placed in a hyperbaric
chamber. After ventilation for 10 min with 100% oxygen (O
2
),
compression was started at a rate of 0.2 ATA/min. Upon
reaching the desired pressure, the flow of O
2
was reduced
to maintain constant pressure for 1 h, while allowing flow
(2 L/min) out of the chamber. Carbon dioxide (CO
2
) was
absorbed by calcium carbonate crystals. At the end of HBO
exposure, decompression was conducted for 10 min. For re-
peated treatments, HBO was performed once daily for 3 or 5
consecutive days. The ambient temperature was maintained
at 25 0.58C, and the humidity was continuously monitored
as well. After HBO treatment, the rats were returned to their
cages until sacrifice.
Neurological evaluation
All neurological evaluations were carried out by a re-
searcher blinded to study group. The beam-balancing test and
prehensile traction test were used for neurological scoring as
proposed by Dixon and colleagues (1987) and Hall and as-
sociates (1988). Both tests were scored according to several
grades. A higher score represents more severe neurological
deficit, ranging from a minimum score of 0 for near-normal
rats, to a maximum score of 14, indicating severe impairment.
Prior to TBI, all of the animals were trained, and rats with
abnormal neurological function were eliminated.
The beam-balancing test consisted of placing the rat on a
narrow wooden beam (1.5 cm wide), and noting how long (up
to 60 sec) the animal was able to maintain its balance: 0 ¼ the
rat walks easily and turns around freely; 1 ¼ the rat maintains
a stable posture for 60 sec; 2 ¼ the rat hugs the beam or hooks
it with its limb before 60 sec elapsed; and 3 ¼ the rat falls off of
the beam.
The prehensile traction test was conducted by placing the
rat on a 120-cm-long taut string that was suspended between
two upright metal bars 80 cm above a padded table, and noting
how long (up to 60 sec) the animal could remain on the string:
0 ¼ the rat grasps the string tightly and climbs up quickly;
1 ¼ the rat can hold onto the string with its rear limbs and try to
climb; 2 ¼ the rat can remain on the string but without using its
rear limbs; and 3 ¼ the rat falls off of the string.
Gravimetric analysis of brain water content
The rats were anesthetized with 10% chloral hydrate
(400 mg/kg IP) and killed by decapitation. The brains were
immediately removed and separated into the left and right
hemispheres. After the determination of the wet weight of
each hemisphere, the tissue was dried for 72 h at 1008C, fol-
lowed by measurement of the dry weight. The percentage
brain water content was calculated as 100(wet weight – dry
weight)/wet weight.
Reverse-transcriptase polymerase chain reaction
amplification of mRNA
The rats were sacrificed 24 h after TBI, and the brains were
immediately removed. The brain tissue surrounding the cor-
tical contusion site was dissected (see Fig. 1A). The samples
were frozen and stored at 808C (Heto Ultra Freeze; Thermo
Scientific, Milford, MA). Total RNA was extracted from brain
tissue using Trizol reagent (Invitrogen, Carlsbad, CA), and
quantified by optical density readings (GeneQuant; Amer-
sham Biosciences, Buckinghamshire, U.K.). For RT-PCR, 2 mg
of total RNA was reverse transcribed by using RevertAid
First Strand cDNA Synthesis Kits (MBI Fermentas, Burling-
ton, Ontario, Canada).
The sense and antisense primers used in this study are
shown in Table 2 (the primers were purchased from Shengong
Inc., Shanghai, China). The number of PCR cycles for each set
of primers was optimized during the exponential phase of
PCR by titration of visible product on GelStar-stained 1.5%
agarose gels containing ethidium bromide. Glyceraldehyde-3-
phosphate dehydrogenase (GAPDH) and b-actin were used
as controls. Quantification of amplified product was per-
formed by gel densitometry. The band intensities were de-
termined using a computer image analysis system (Quantity
One; Bio-Rad Laboratories, Hercules, CA), and are expressed
as the ratio to GAPDH or b-actin.
Nissl staining
The animals were killed with deep anesthesia by perfusion
through the left ventricle with 200 mL of ice-cold phosphate-
buffered saline (PBS; 0.1 mol/L), followed by 400 mL of 4%
paraformaldehyde in 0.1 mol/L PBS (pH 7.4). The brains were
then removed and post-fixed for 24 h in the same fixative. The
post-fixed brains were protected in 30% sucrose in PBS. The
brain tissue was coronally sectioned 20-mm thick with a
cryostat (CM1900; Leica, Bensheim, Germany). Sections be-
tween 3 and 4.5 mm posterior to the bregma were selected.
The free-floating sections were mounted onto slides and
processed through different baths in the following order:
chloroform, 30 min; acetone, 15 min; 100% ethyl alcohol
Table 2. Primer Sequences Used To Amplify Target mRNA
Gene Sense (5
0
? 3
0
) Antisense (5
0
? 3
0
) Product length (bp)
bcl-2 CTGGTGGACAACATCGCTCTG GGTCTGCTGACCTCACTTGTG 228
bax TTCATCCAGGATCGAGCAGAG TGAGGACTCCAGCCACAAAGAT 458
Caspase-3 GCACTGGAATGTCAGCTCGCAA GCCACCTTCCGGTTAACACGAG 559
b-Actin ATGGATGACGATATCGCT ATGAGGTAGTCTGTCAGG 570
GAPDH ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA 452
GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
HYPERBARIC OXYGEN FOR TRAUMATIC BRAIN INJURY 1735
(EtOH), 30 sec; 95% EtOH, 30 sec; 70% EtOH, 30 sec; distilled
water, 30 sec, twice; cresyl violet, 20 min; distilled water,
30 sec, three times; 70% EtOH, 1 min; 95% EtOH, 1 min; 100%
EtOH, 1 min; chloroform, 5 min; differentiator (95% EtOH
with glacial acetic acid added until the pH was 4.1), 6 min;
95% EtOH, 2 min, 100% EtOH, 3 min, twice; xylene, 2 min; and
xylene, 3 min, twice. After staining the sections were mounted
with neutral balata and covered with a cover-slip.
The brain slices in each section were photographed
(DM5000B; Leica). Normal neuronal profiles in the pyramidal
cell layer of hippocampal area CA2 of the right side were
counted. In each section the number of neuronal profiles, each
identified as having a distinct nucleolus, were assessed in a
1-mm section of area CA2 at 200magnification. Hippo-
campal cell counts were taken from six sections per hemi-
sphere, with two sections from each of three different coronal
levels (3.1, 3.8, and 4.4 mm posterior to the bregma).
TUNEL assay
Apoptosis was measured with terminal deoxynucleotidyl
transferase-mediated dUTP nick end labeling (TUNEL)
staining of brain slices (sectioned at 4 mm thickness), using the
TACS
TdT Kit (Trevigen, Gaithersburg, MD). The positive
cells in the brain tissue surrounding the cortical contusion
area (see Fig. 1A) were identified and counted using a light
microscope by an investigator blinded to study group.
The extent of brain damage present was evaluated by the
apoptotic index, which was the average number of TUNEL-
positive cells in each section counted in 10 microscopic fields
(at 200magnification).
Statistical analysis
All values are presented as mean standard deviation.
Data from two groups were analyzed with the Student’s t-test
(non-directional), and data from repeated groups with one-
way ANOVA and the Newman-Keuls test for post-hoc com-
parisons. Differences were considered statistically significant
at a level of p < 0.05.
Results
Comparison of the effects of three different HBO
treatment protocols
The rats were randomly divided into four groups : a
control g roup, an HBO group, a normobaric hypero xia
group (100% O
2
, 1 ATA), and a hyperbar ic normoxia group
(3 ATA, partial pressure of O
2
0.21 ATA). To observe
structural changes, all animals were killed 48 h after TBI.
The wei ght-drop trauma produced a wedg e-shaped, highly
reproducible lesio n involving the parietal cortex and the
subcortical white matter (Fig. 1A-a). Grossly, the lesion was
characterized by a central cavity encompassed by a zone of
hemorr hagic necrosis that was well d elineated fr om the
surrounding tissue. The lesionsintheHBOgroupwereless
severe than those in the control group (Fig. 1A- b). Ho w-
ever, with normobaric hyperoxia or hyperbaric normoxia,
FIG. 1. Comparison of the effects of three kinds of therapy. (A) Macroscopic appearance of the focal injury produced by
weight-drop trauma in a coronal section. The white open square represents the region of interest beside the injured area for
cell counting and PCR and TUNEL assays. (B) Numbers of neurons in CA2 of the right side of the hippocampus (n ¼ 6). (C)
Nissl staining of the right side of the hippocampus in the four treatment groups: a, control group; b, HBO therapy group; c,
normobaric hyperoxia group (1 ATA, 100% O
2
); d, hyperbaric normoxia group (3 ATA, O
2
0.21 ATA). (e, f, g, h) High-
magnification photos of the same groups shown in a, b, c, and d (scale bars ¼ 1mm in C-a–d, 100 mminC-e–h;**p < 0.01
versus the control group; RT-PCR, reverse-transcriptase polymerase chain reaction; TUNEL, terminal deoxynucleotidyl
transferase-mediated dUTP nick end labeling; HBO, hyperbaric oxygen; ATA, absolute atmosphere).
1736 WANG ET AL.
the lesions were similar to those seen in the co ntrol group
(Fig. 1A-c and A-d). Microscopically, the outlines of the
CA2 and CA3 areas in the hippocampus were damaged by
TBI (Fig. 1C-a and C-e). The number of neuronal cells re-
vealed by Nissl staining was greatly reduced after TBI
(112.0 12.45). However, when the rats were treated with
HBO (3 ATA, 100% O
2
), at 6 h after TBI the number of
neurons (220.0 23.0) was sig nificantly higher than without
treatment ( p < 0.01, Fig. 1B). Compared with t he control
group, the numbers of neurons in both the normobaric
hyperoxia group and the hyperbaric normoxia group were
not significantly different ( p > 0.05, Fig. 1B).
FIG. 2. Time window of the onset of hyperbaric oxygen (HBO) treatment for rats with traumatic brain injury (TBI). (A)
Neurology deficit score (n ¼ 10). (B) Brain water content (n ¼ 6). (C) Number of neurons in the CA2 area of the right
hippocampus (n ¼ 6). (D) Nissl staining of brain tissue 3.8 mm posterior to the bregma: a and i, sham-operated group; b and j,
control group; c and k, 3-h group; d and l, 6-h group; e and m, 12-h group; f and n, 24 h group; g and o, 48-h group; h and p,
72 h group (scale bars ¼ 1mm in a–h, 100 mmini–p; Sham, sham-operated group; Ctl, control group; **p < 0.01 versus the
control group;
#
p < 0.05,
##
p < 0.01 versus the 12-h group;
D
p < 0.05 versus the 3-h and 6-h groups).
HYPERBARIC OXYGEN FOR TRAUMATIC BRAIN INJURY 1737
Time window of HBO treatment
In order to observe the time window of the neuroprotective
effect, HBO therapy was started at 3, 6, 12, 24, 48, and 72 h
after TBI. The neurological evaluations, brain water content,
and histopathological changes were analyzed 4 d post-TBI.
We found that the onset of HBO treatment at 3, 6, or 12 h
significantly reduced neurology deficit scores and brain water
content ( p < 0.01, Fig. 2A and B). However, no discernible
effect was observed for these two variables when HBO
treatment was started at 24, 48, or 72 h after TBI (Fig. 2A and B,
p > 0.05). Compared with the sham-operated group, the
number of neuronal cells revealed by Nissl staining was
greatly reduced after TBI ( p < 0.01), as shown in Figure 2C
and D. When the rats were treated with HBO at 3, 6, or 12 h
after TBI, the numbers of neurons were clearly increased
( p < 0.01), but not in groups in which HBO treatment was
started at 24, 48, or 72 h after TBI (Fig. 2C and D, p > 0.05).
Multiple HBO treatments expand
the therapeutic window
In these studies, we found that HBO used at 3–12h following
TBI reduced brain water content, improved neurological out-
come, and decreased neuronal loss. However, HBO treatment
started at 24–72 h had a less neuroprotective effect. The greatest
effects of HBO treatment were seen when it was given three or
five times per day, especially for the delayed-treatment group.
The neurology deficit scores of all rats were evaluated on the
day before the final HBO treatment in the 72-h group. Then the
animals were sacrificed for histological examination.
As shown in Figure 3F, for animals that received the first
HBO treatment 6 h after TBI, multiple treatments appeared to
further decrease the neurology deficit score and alleviate
neuronal loss, but the values of these two parameters were not
significantly different from animals receiving only one treat-
ment ( p > 0.05).
As shown in Figure 4, when the first HBO treatment was
given 24 h after TBI, multiple HBO treatments decreased
neurology deficit scores and increased neuronal loss signifi-
cantly ( p < 0.01). The effect of HBO was more marked with
two treatments than with only one treatment (Fig. 4). How-
ever, no significant difference in the effects of HBO on these
two parameters was observed between three and five treat-
ments ( p > 0.05, Fig. 4).
When the first HBO treatment was carried out 48 h after
TBI, the results of three and five HBO treatments were similar
FIG. 3. The effect of multiple hyperbaric oxygen (HBO) treatments, with the first treatment given at 6 h after traumatic brain
injury (TBI). (A) Neurology deficit scores (n ¼ 10). (B) Number of neurons in the CA2 area of the right hippocampus (n ¼ 6).
(C) Nissl staining of brain tissue 3.8 mm posterior to the bregma: a and e, control; b and f, 1-treatment group; c and g,3-
treatment group; d and h, 5-treatment group (scale bar ¼ 1mmina–d, 100 mmine–h; Ctl, control group; **p < 0.01 versus the
control group).
1738 WANG ET AL.
to those seen when the first treatment was given 24 h after TBI
(Figs. 4 and 5). Compared with the control group, three and
five treatments reduced neurology deficit scores ( p < 0.01,
Fig. 5), and increased the number of neurons ( p < 0.01, Fig. 5).
However, the reduction in neurology deficit scores and ele-
vation of neuron numbers were less than those of animals
receiving one HBO treatment administered 3 or 6 h after TBI
( p < 0.05 or 0.01, Figs. 2 and 5). In addition, five treatments
did not show any improvement of efficacy for these two
parameters compared with three treatments ( p > 0.05, Fig. 5).
When the first treatment was delayed until 72 h post-TBI,
three or five HBO treatments did not improve neurological
outcomes ( p > 0.05), and only slightly elevated the numbers
of neurons ( p < 0.05, data not shown).
Effect of HBO treatment on neuronal apoptosis
Compared with sham-operated rats, the expression of
bcl-2 mRNA in the cortex surrounding the contusion area was
greatly reduced after TBI ( p < 0.01, Fig. 6A and D). However,
when the animals were treated once with HBO at 6 h after
TBI, the expression of bcl-2 mRNA recovered partially
( p < 0.05). The level of expression of bax mRNA in the control
group tended to increase, but it was not significantly different
from those of the other two groups ( p > 0.05, Fig. 6B and D).
Thus the changes in the relative ratio of bcl-2 to bax were
almost identical to those of bcl-2 mRNA (Fig. 6D). Changes in
the expression of caspase-3 mRNA were opposite to those of
bcl-2 mRNA (i.e., caspase-3 mRNA expression was markedly
increased after TBI [p < 0.01], but were significantly reduced
by HBO treatment [p < 0.01, Fig. 6C and D]).
Few TUNEL-positive apoptotic cells were found in the
cortex of sham-operated rats (Fig. 7A and D). In the control
group, the numbers of apoptotic neurons in the cortex sur-
rounding the primary injury site were significantly increased
after TBI ( p < 0.01, Fig. 7B and D), but were decreased by HBO
treatment ( p < 0.05, Fig. 7C and D).
Discussion
On the basis of the neurological functions and histopatho-
logical changes seen in the present study, we found that HBO
treatment after TBI can exert significant neuroprotective ef-
fects. We found that HBO treatment in rats after experimental
TBI decreased cerebral water content, improved neurological
recovery, and reduced hippocampal neuron loss, thus pro-
viding clear experimental data to validate the efficacy of HBO
treatment. This effect appears to be attributable to exposure to
pure hyperbaric oxygen, since hyperbaric normoxia and
normobaric hyperoxia treatment had no significant effect on
the aforementioned parameters. The effects of these three
different treatment protocols have rarely been compared be-
fore. Our results using HBO treatment for TBI are consistent
with those of many other researchers (Neubauer et al., 1994;
Niklas et al., 2004; Rockswold et al., 2001, 2009; Zhou et al.,
2007). Although a few investigators have reported that early
normobaric hyperoxia therapy has beneficial effects on TBI
(Menzel et al., 1999a, 1999b; Palzur et al., 2004; Rockswold
et al., 2009; Tolias et al., 2004), the present data and those of
other studies (Diringer et al., 2007; Zhou et al., 2007) do not
support this conclusion.
Ischemia, elevated intracranial pressure, and reduced ce-
rebral blood flow are widely recognized as major factors
causing secondary brain injury after severe TBI (Cormio et al.,
1997). HBO treatment is thought to improve the ischemic
condition of the brain tissue surrounding the primary injury
(Calvert et al., 2007; Palzur et al., 2004). Because the volume of
oxygen in the blood is proportional to the increase in partial
oxygen pressure, according to Henry’s law (Calvert et al.,
2007;Gill and Bell, 2004), there is a massive increase in blood
oxygen levels with the use of hyperbaric oxygen (Calvert et al.,
2007; Goldman, 2009; Niklas et al., 2004; Tibbles and Edels-
berg, 1996;). Insufficient transport and delivery of oxygen to
tissues can be compensated for by a high Po
2
gradient. HBO
treatment has been shown to exert many benefits in the brain
after TBI (Niklas et al., 2004), such as relief of hypoxia (Con-
treras et al., 1988; Calvert et al., 2007; Rockswold et al., 2009;
Sheffield and Davis, 1976), improvement of microcirculation
with a decrease in intracranial pressure (Kohshi et al., 2001;
Rogatsky et al., 2005, 2009; Sukoff, 2001), amelioration of ce-
rebral edema by vasoconstriction (Niklas et al., 2004; Qin et al.,
2008), preservation of partially-damaged tissue, prevention of
progression of secondary injury, and improvements in cere-
bral metabolism (Gill and Bell, 2004; Palzur et al., 2008;
Rockswold et al., 2009).
Inconsistent data have been reported about the effective-
ness of HBO on TBI (Adamides et al., 2006; Rockswold et al.,
2007). The contradictory reports probably result from differ-
ences in TBI models and HBO treatment methods, including
the timing of HBO and the number of treatments, which are
two of the most important factors affecting the efficacy of
FIG. 4. The effect of multiple hyperbaric oxygen (HBO)
treatments, with the first treatment given 24 h after traumatic
brain injury (TBI). (A ) Neurology deficit scores (n ¼ 10). (B)
Number of neurons in the CA2 area of the right hippocam-
pus (n ¼ 6; Ctl, control group; **p < 0.01 versus the control
group;
##
p < 0.01 versus the 1-treatment group).
FIG. 5. The effect of multiple hyperbaric oxygen (HBO)
treatments, with the first treatment given 48 h after traumatic
brain injury (TBI). (A) Neurology deficit scores (n ¼ 10). (B)
Number of neurons in the CA2 area of the right hippocam-
pus (n ¼ 6; Ctl, control group; **p < 0.01 versus the control
group;
##
p < 0.01 versus the 1-treatment group).
HYPERBARIC OXYGEN FOR TRAUMATIC BRAIN INJURY 1739
FIG. 6. The expression of bcl-2, bax, and caspase-3 mRNA in the right parietal cortex. (A) Gel electrophoresis of bcl-2. (B)
Gel electrophoresis of bax. (C) Gel electrophoresis of caspase-3. (D) Quantification of relative intensity of bcl-2, bax, and
caspase-3 mRNA in the indicated groups. Expression values of bcl-2 and caspase-3 were normalized to GAPDH, and bax was
normalized to b-actin (n ¼ 4; M, marker [DL 2000]; Sham, sham-operated group; *p < 0.05, **p < 0.01 versus the control group;
GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HBO, hyperbaric oxygen).
FIG. 7. TUNEL staining of the right parietal cortex in the different treatment groups. (A) Sham-operated group. (B) Control
group (TUNEL-positive cells are stained brown). (C) HBO group. (D) Relative ratio of TUNEL-positive cells in three indicated
groups (n ¼ 4; Sham, sham-operated group; *p < 0.05, **p < 0.01 versus the control group; scale bar ¼ 50 mm; the arrows
indicate apoptotic cells; TUNEL, terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling; HBO, hyperbaric
oxygen).
1740 WANG ET AL.
HBO. In the present study, we found that HBO given at 3–12 h
following TBI reduced neurology deficit scores, brain water
content, and neuronal loss, but HBO given at 24–72 h had
fewer neuroprotective effects. These time-dependent differ-
ences in the efficacy of HBO suggest that it should be im-
plemented as soon as possible after TBI. Our study also
demonstrated that delayed but repeated HBO treatments
could also exert protective effects against secondary brain
injury in rats. The efficacy of HBO treatments can thus be
obtained, even when the first treatment is delayed by 48 h.
Thus repeated treatments could extend the time window of
effective HBO therapy to 48 h after TBI. This result is consis-
tent with the report by Yin and Zhang (2005), who studied
HBO treatment of experimental ischemic stroke in rats.
Nonetheless, we found that repeated HBO treatments were
less effective when the first treatment session was much de-
layed. Moreover, we found that the efficacy of five consecu-
tive HBO treatments appeared to be no better than that of
three treatments. This indicates that HBO treatment does not
have to be repeated indefinitely when the first HBO inter-
vention is given 48 h after TBI, as this appears to be the time
point at which the optimal effects of hyperbaric oxygen
therapy are seen (Rogatsky et al., 2003). These findings about
the therapeutic time frame for optimal dosing, which has not
been systematically studied before, extend our knowledge
about the use of HBO to treat TBI.
Numerous TBI models have be en designed to study hu-
man brain injury, and an ideal model would replicate all
aspects of human brain injury. In addition, the responses to
injury specified in physiological, behavioral, and anatomi cal
terms should be reproducible and quantifiable over a con-
tinuum of injury severity (Park et al., 1999). The neocortical
contusion procedure and focal cortical weight-drop proce-
dure that we used that were based on Feeney’s model p ro-
duced cerebral lesions that are structurally similar to those
observed clinically. The injury results i n a cortical cavity that
extends into the underlying white matter, with microscopic
injury to underlying structures, including the hippocampus
(Golarai et al., 2001; Weisend and Feeney, 1994). In our
study, this TBI model yielded findings similar to those re-
ported by Chen and asso ciates (2008). Both the macroscopic
appearance and the microscopic findings were similar t o
those seen in clinical situations. A peri-lesional penumbra
could clearly be seen and was easily differentiated from the
spared surrounding brain tissue. These characteristics justi-
fied the selectio n of this model for the investigation of focal
TBI in our study.
It is well known that one important factor hindering the use
of HBO therapy is the risk of oxygen toxicity resulting from
breathing 100% oxygen under high pressure (Kleen and
Messmer, 1999). In general, HBO is a relatively safe treatment
(Gill and Bell, 2004), but it does carry some risk, especially
when given at high pressure (>3 ATA) and for long duration
(Blenkarn et al., 1969; Plafki et al., 2000). Blenkarn and asso-
ciates (1969) reported that HBO given at 4.96 ATA for 1 h
caused central nervous system toxicity in rats. Hampson and
Atik (2003) reported an overall incidence of oxygen-toxic
seizures of 0.03% when HBO treatment was routinely used in
all kinds of patients. The Committee of the Undersea and
Hyperbaric Medical Society (CUHMS) recommends that
levels of 2.4–3.0 ATA should be used, or the lowest pressure
that is effective, to avoid oxygen-induced convulsions (Zhang
et al., 2005). Using a relatively low pressure, Mink and Dutka
(1995) found that HBO (2.8 ATA for 75 min) did not increase
lipid peroxidation and promote early brain injury. We did not
study the potential side effects of HBO treatment in this study.
However, the pressure we selected was in the range re-
commended by the CUHMS for patient use. Moreover, HBO
treatment at 2.5–3 ATA for 1–2 h is usually used for experi-
mental studies in rats (Calvert et al., 2003; Niklas et al., 2004;
Qin et al., 2008; Vlodavsky et al., 2005).
Growing evidence suggests the involvement of apoptotic
processes in delayed post-traumatic neuronal death (Ng et al.,
2000; Smith et al., 2000). In this study, we found that the
numbers of TUNEL-positive cells seen in the cerebral cortex
surrounding the primary injury site were significantly in-
creased after TBI, but were reduced with HBO treatment. In
addition, we observed with RT-PCR that the expression of
bcl-2 mRNA was decreased and caspase-3 mRNA was ele-
vated after TBI. HBO treatment increased the expression of
bcl-2 mRNA with enhancement of the ratio of bcl-2 to bax, and
reduced caspsase-3 mRNA levels. These results support the
involvement of apoptosis in secondary brain injury after TBI
(Liu et al., 2006; Ng et al., 2000; Palzur et al., 2004; Smith et al.,
2000; Vlodavsky et al., 2005). This suggests that the protective
effects of HBO may be at least partly attributable to reductions
in apoptotic activity of brain tissue after TBI ( Liu et al., 2006;
Palzur et al., 2004; Vlodavsky et al., 2005).
In conclusion, our results suggest that HBO treatment can
help alleviate brain damage after TBI. With a single HBO
treatment, the most effective time point at which to give it is
about 12 h post-TBI, and multiple HBO treatments may help
extend the time window of efficacy. Taken together, our re-
sults considerably extend current knowledge about the ap-
plication of HBO post-TBI. We conclude that HBO therapy is
potentially beneficial as an adjunctive treatment for TBI.
Acknowledgments
The authors wish to thank Dr. Temugin Berta for help re-
vising the manuscript, and Dr. Yong-Jing Gao for constructive
suggestions about the writing of the manuscript. This study
was supported by a grant from the Administration of Science
and Technology of Nantong (project no. S5031), Jiangsu
Province, China.
Author Disclosure Statement
No conflicting financial interests exist.
References
Adamides, A.A., Winter, C.D., Lewis, P.M., Cooper, D.J., Koss-
mann, T., and Rosenfeld, J.V. (2006). Current controversies in
the management of patients with severe traumatic brain in-
jury. ANZ J. Surg. 76, 163–174.
Blenkarn, G.D., Schanberg, S.M., and Saltzman, H.A. (1969).
Cerebral amines and acute hyperbaric oxygen toxicity. J.
Pharm. Exp. Ther. 166, 346–353.
Calvert, J.W., Cahill, J., and Zhang, J.H. (2007). Hyperbaric
oxygen and cerebral physiology. Neurol. Res. 29, 132–141.
Calvert, J.W., Zhou, C.M., Nanda, A., and Zhang, J.H. (2003).
Effect of hyperbaric oxygen on apoptosis in neonatal hypoxia-
ischemia rat model. J. Appl. Physiol. 95, 2072–2080.
Chen, G., Shi, J., Hu, Z., and Hang, C. (2008). Inhibitory effect
on cerebral inflammatory response following traumatic brain
HYPERBARIC OXYGEN FOR TRAUMATIC BRAIN INJURY 1741
injury in rats: a potential neuroprotective mechanism of
N-acetylcysteine. Mediators Inflamm. 2008, 716458.
Chua, K.S., Ng, Y.S., Yap, S.G., and Bok, C.W. (2007). A brief
review of traumatic brain injury rehabilitation. Ann. Acad.
Med. Singapore 36, 31–42.
Conti, A.C., Raghupathi, R., Trojanowski, J.Q., and McIntosh,
T.K. (1998). Experimental brain injury induces regionally dis-
tinct apoptosis during the acute and delayed post-traumatic
period. J. Neurosci. 18, 5663–5672.
Contreras, F.L., Kadekaro, M. and Eisenberg, H.M. (1988). The
effect of hyperbaric oxygen on glucose utilization in a freeze-
traumatized rat brain. J. Neurosurg. 68, 137–141.
Cormio, M., Robertson, C.S., and Narayan, R.K. (1997).
Secondary insults to the injured brain. J. Clin. Neurosci. 4,
132–148.
Daugherty, W.P., Levasseur, J.E., Sun, D., Rockswold, G.L., and
Bullock, M.R. (2004). Effects of hyperbaric oxygen therapy on
cerebral oxygenation and mitochondrial function following
moderate lateral fluid-percussion injury in rats. J. Neurosurg.
101, 499–504.
Diringer, M.N., Aiyagari, V., Zazulia, A.R., Videen, T.O., and
Powers, W.J. (2007). Effect of hyperoxia on cerebral metabolic
rate for oxygen measured using positron emission tomogra-
phy in patients with acute severe head injury. J. Neurosurg.
106, 526–529.
Dixon, C.E., Lyeth, B.G., Povlishock, J.T., Findling, R.L., Hamm,
R.J., Marmarou, A., Young, H.F., and Hayes, R.L. (1987). A
fluid percussion model of experimental brain injury in the rat.
J. Neurosurg. 67, 110–119.
Feeney, D.M., Boyeson, M.G., Linn, R.T., Murray, H.M., and
Dail, W.G. ( 1981). Responses to cortical injury: I. Metho dol-
ogy and local effects of contusions in the rat. Brain Res. 211,
67–77.
Flanagan, S.R., Cantor, J.B., and Ashman, T.A. (2008). Traumatic
brain injury: future assessment tools and treatment prospects.
Neuropsych. Dis. Treat. 4, 877–892.
Gill, A.L., and Bell, C.N. (2004). Hyperbaric oxygen: its uses,
mechanisms of action and outcomes. Q. J. Med. 97, 385–395.
Golarai, G., Greenwood, A.C., Feeney, D.M., and Connor, J.A.
(2001). Physiological and structural evidence for hippocampa l
involvement in persistent seizure susceptibility after traumatic
brain injury. J. Neurosci. 21, 8523–8537.
Goldman, R.J. (2009). Hyperbaric oxygen therapy for wound
healing and limb salvage: a systematic review. P.M. R. 1,
471–489.
Hall, E.D., Yonkers, P.A., McCall, J.M., and Braughler, J.M.
(1988). Effects of the 21-aminosteroid U74006F on experi-
mental head injury in mice. J. Neurosurg. 68, 456–461.
Hampson, N., and Atik, D. (2003). Central nervous system ox-
ygen toxicity during routine hyperbaric oxygen therapy. Un-
dersea Hyperb. Med. 30, 147–153.
Kleen, M., and Messmer, K. (1999). Toxicity of high Pao
2
. Mi-
nerva Anesthesiol. 65, 393–396.
Kohshi, K., Yokota, A., Konda, N., Kinoshita, Y., and Kajiwara, H.
(1991). Intracranial pressure responses during hyperbaric oxy-
gen therapy. Neurol. Med. Chir. (Tokyo) 31, 575–581.
Leker, R.R ., and Shohami, E. (2002). Cerebral ischemia and
trauma—different etiologies yet similar mec hanisms: neu-
roprotective opportunities. Brain Res. Bra in Res. Rev. 39,
55–73.
Liu, Z., Jiao, Q.F., You, C., Che, Y.J., and Su, F.Z. (2006). Effect of
hyperbaric oxygen on cytochrome C, Bcl-2 and Bax expression
after experimental traumatic brain injury in rats. Chin. J.
Traumatol. 9, 168–174.
Maas, A.I.R., Stocchetti, N., and Bullock, R. (2008). Moderate and
severe traumatic brain injury in adults. Lancet Neurol. 7,
728–741.
Menzel, M., Doppenberg, E.M., Zauner, A., Soukup, J., Reinert,
M.M., and Bullock, R. (1999a). Increased inspired oxygen
concentration as a factor in improved brain tissue oxygenation
and tissue lactate levels after severe human head injury. J.
Neurosurg. 91, 1–10.
Menzel, M., Doppenberg, E.M., Zauner, A., Soukup, J., Reinert,
M.M., Clausen, T., Brockenbrough, P.B., and Bullock, R.
(1999b). Cerebral oxygenation in patients after severe head
injury: monitoring and effects of arterial hyperoxia on cerebral
blood flow, metabolism and intracranial pressure. J. Neuro-
surg. Anesthesiol. 11, 240–251.
Mink, R.B., and Dutka, A.J. (1995). Hyperbaric oxygen after
global cerebral ischemia in rabbits does not promote brain
lipid peroxidation. Crit. Care Med. 23, 1398–1404.
Narotam, P.K., Budonrappa, S.C., Raynor, S.C., Rao, M., and
Taylon, C. (2006). Cerebral oxygenation in major pediatric
trauma: its relevance to trauma severity and outcome. J.
Pediatr. Surg. 41, 505–513.
Nemoto, E.M., and Betterman, K. (2007). Basic physiology of
hyperbaric oxygen in brain. Neurol. Res. 29, 116–126.
Neubauer, R.A., Gottlieb, S.F., and Pevsner, N.H. (1994). Hy-
perbaric oxygen for treatment of closed head injury. South
Med J. 87, 933–936.
Ng, I., Yeo, T.T., Tang, W.Y., Soong, R., Ng, P.Y., and Smith, D.R.
(2000). Apoptosis occurs after cerebral contusions in humans.
Neurosurgery 46, 949–956.
Niklas, A., Brock, D., Schober, R., Schulz, A., and Schneider, D.
(2004). Continuous measurements of cerebral tissue oxygen
pressure during hyperbaric oxygenation—HBO effects on
brain edema and necrosis after severe brain trauma in rabbits.
J. Neurol. Sci. 219, 77–82.
Oppel, L. (2003). A review of the scientific evidence on the
treatment of traumatic brain injuries and strokes with hyper-
baric oxygen. Brain Inj. 17, 225–236.
Palzur, E., Vlodavsky, E., Mulla, H., Arieli, R., Feinsod, M., and
Soustiel, J.F. (2004). Hyperbaric oxygen therapy for reduction
of secondary brain damage in head injury: an animal model of
brain contusion. J. Neurotrauma 21, 41–48.
Palzur,E.,Zaaroor,M.,Vlodavsky,E.,Milman,F.,and
Soustiel, J.F. (2008). Neuroprotective effect of hyperbaric
oxygen therapy in bra in injury is mediate d by preserva tion
of mitochondrial membrane pro perties. Brain Res. 1221,
126–133.
Park, H.K., Fernandez, I.I., Dujovny, M., and Diaz, F.G. (1999).
Experimental animal models of traumatic brain injury: medi-
cal and biomechanical mechanism. Crit. Rev. Neurosurg. 9,
44–52.
Plafki, C., Peters, P., Almeling, M., Welslau, W., and Busch, R.
(2000). Complications and side effects of hyperbaric oxygen
therapy. Aviat. Space Environ Med. 71, 119–124.
Qin, Z., Xi, G., Keep, R.F., Silbergleit, R., He, Y., and Hua, Y.
(2008). Hyperbaric oxygen for experimental intracerebral
hemorrhage. Acta Neurochir. Suppl. 105, 113–117.
Roberts, I., Schierhout, G., and Alderson, P. (1998). Absence of
evidence for the effectiveness of five interventions routinely
used in the intensive care management of severe head injury:
a systematic review. J. Neurol. Neurosurg. Psychiat. 65,
729–733.
Rockswold, S.B., Rockswold, G.L., and Defillo, A. (2007). Hy-
perbaric oxygen in traumatic brain injury. Neurol. Res. 29,
162–172.
1742 WANG ET AL.
Rockswold, S.B., Rockswold, G.L., Vargo, J.M., Erickson, C.A.,
Sutton, R.L., Bergman, T.A., and Biros, M.H. (2001). Effects of
hyperbaric oxygenation therapy on cerebral metabolism and
intracranial pressure in severely brain injured patients. J.
Neurosurg. 94, 403–411.
Rockswold, S.B., Rockswold, G.L., Zaun, D.A., Zhang, X.W.,
Cerra, C.E., Bergman, T.A., and Liu, J.N. (2009). A prospective,
randomized clinical trial to compare the effect of hyperbaric to
normobaric hyperoxia on cerebral metabolism, intracranial
pressure, and oxygen toxicity in severe traumatic brain injury.
J. Neurosurg. 112, 1080–1094.
Rogatsky, G.G., Kamenir, Y., and Mayevsky, A. (2005). Effect of
hyperbaric oxygenation on intracranial pressure elevation rate
in rats during the early phase of severe traumatic brain injury.
Brain Res. 1047, 131–136.
Rogatsky, G.G., Shifrin, E.G., and Mayevsky, A. (2003). Optimal
dosing as a necessary condition for the efficacy of hyperbaric
oxygen therapy in acute ischemic stroke: A critical review.
Neurol. Res. 25, 95–98.
Schneider, G., Fries, P., Wagner-Jochem, D., Thome, D.,
Laurer, H., Kramann, B., Mautes, A., and Hagen, T. (2002).
Pathophysiological changes after traumatic brain injury:
comparison of two experimental animal models by means
of MRI. Magma 14, 233–241.
Sheffield, P.J., and Davis, J.C. (1976). Application of hyperbaric
oxygen therapy in a case of prolonged cerebral hypoxia fol-
lowing rapid decompression. Aviat. Space Environ. Med. 47,
759–762.
Smith, F.M., Raghupathi, R., MacKinnon, M.A., McIntosh, T.K.,
Saatman, K.E., Meaney, D.F., and Graham, D.I. (2000). TU-
NEL-positive staining of surface contusions after fatal head
injury in man. Acta Neuropathol. 100, 537–545.
Sukoff, M.H. (2001). Effects of hyperbaric oxygenation. J. Neu-
rosurg. 95, 544–546.
Tibbles, P.M., and Edelsberg, J.S. (1996). Hyperbaric-oxygen
therapy. N. Engl. J. Med. 334, 1642–1648.
Tolias, C.M., Reinert, M., Seiler, R., Gilman, C., Scharf, A., and
Bullock, M.R. (2004). Normobaric hyperoxia-induced im-
provement in cerebral metabolism and reduction in intracra-
nial pressure in patients with severe head injury: a prospective
historical cohort-matched study. J. Neurosurg. 101, 435–444.
Vlodavsky, E., Palzur, E., Feinsod, M., and Soustiel, J.F. (2005).
Evaluation of the apoptosis-related proteins of the BCL-2
family in the traumatic penumbra area of the rat model of
cerebral contusion, treated by hyperbaric oxygen therapy: a
quantitative immunohistochemical study. Acta Neuropathol.
110, 120–126.
Weisend, M.P., and Feeney, D.M. (1994). The relationship be-
tween traumatic brain injury-induced changes in brain tem-
perature and behavioral and anatomical outcome. J.
Neurosurg. 80, 120–132.
Yin, D.L., and Zhang, J.H. (2005). Therapeutic window in rat
focal cerebral ischemic model. Neurocrit. Care 2, 206–211.
Zhang, J.H., Lo, T., Mychaskiw, G., and Colohan, A. (2005).
Mechanisms of hyperbaric oxygen and neuroprotection in
stroke. Pathophysiology 12, 63–77.
Zhou, Z., Daugherty, W.P., Sun, D., Levasseur, J.E., Altememi, N.,
Hamm, R.J., Rockswold, G.L., and Bullock, M.R. (2007). Pro-
tection of mitochondrial function and improvement in cognitive
recovery in rats treated with hyperbaric oxygen following lat-
eral fluid-percussion injury. J. Neurosurg. 106, 687–694.
Address correspondence to:
Zheng-Lin Jiang, M.D., Ph.D.
Department of Neuropharmacology
Institute of Nautical Medicine
Nantong University
19 Qixiu Road
Chongchuan District
Nantong, Jiangsu, 226001 China
E-mail: jiangzl@ntu.edu.cn
HYPERBARIC OXYGEN FOR TRAUMATIC BRAIN INJURY 1743
