Content uploaded by Xiaochen Yuan
Author content
All content in this area was uploaded by Xiaochen Yuan on Sep 06, 2018
Content may be subject to copyright.
Enhancement of growth and intestinal flora in grass carp: The effect of
exogenous cellulase
Yi Zhou
1
, Xiaochen Yuan
1
, Xu-Fang Liang ⁎, Liu Fang, Jie Li, Xiaoze Guo, Xiaoli Bai, Shan He
College of Fisheries, KeyLab of Freshwater Animal Breeding, Ministry of Agriculture, Huazhong Agricultural University, Hubei Collaborative InnovationCenter for Freshwater Aquaculture, Wuhan,
Hubei 430070, China
abstractarticle info
Article history:
Received 21 April 2013
Received in revised form 20 August 2013
Accepted 20 August 2013
Available online 3 September 2013
Keywords:
Ctenopharyngodon idella
Duckweed
Cellulase
Growth performance
Intestinal microbiota
Digestive enzymes
Plant protein sourceshave been identifiedto have the greatest potential to replace fish mealprotein in aquafeeds.
However,plant ingredientscontain significantquantities of carbohydrates, and theability of fish to utilize dietary
carbohydrates as energy sources for growth is limited. Included in the carbohydrate group, cellulose is not toler-
ated by most fish. Inthe present study, thegrass carp, a typicalherbivorous fish, fedwith duckweed was selected
to study the effect of exogenouscellulase on the growth. Theresults of 2-month feeding experiment showed that
the cellulase promoted the growth of grass carp. In addition, the cellulase increased various digestive enzymeac-
tivities, such as cellulase, amylase and protease but not the lipase activity. Meanwhile, the polymerase chain re-
action denaturing gradient gel electrophoresis (PCR-DGGE) analysis indicated that the intestinal microbiota of
fish fed with the supplementalcellulase changed inbacteria species and density. Band patterns derivedfrom con-
trol and cellulase samplesshowed a low degree of similarity when analyzed by clusteranalysis. Some bandswere
unique to control samples, whereas other bands were obtained only with samples of the cellulase group. The 16S
rRNA gene sequencing identified that Proteobacteria and Firmicutes were the two dominant groups, and the
emergence of certain bacterial strains including Bacilli and Sphingomonas may contributeto the digestion of cel-
lulose. Theformer researches and this paper results suggest that the endogenous cellulase isfar from sufficient to
fully digest the ingested fiber, so cellulase should be developed as a kind of aquatic additive.
© 2013 Published by Elsevier B.V.
1. Introduction
Given the increasing global needs, price and world supply fluctua-
tions of fishmeal for aquaculture, there is an increasing demand for
more insight on the potential of alternative protein sources in aquafeeds
(New and Wijkström, 2002). Much attention has been focused on plant
proteins. However, the use of plant proteins is limited by deficiencies in
essential amino acids and minerals, and the presence of antinutritional
factors, and especially complex carbohydrates (Vielma et al., 2003).
Fish, compared withmammalian, cannot utilize carbohydrates as an en-
ergy source efficiently.
Cellulose, a polymer of glucose residues connected by β-1,4 linkages,
being a principal component of plant cell walls, is the most abundant
carbohydrate in nature (Péreza and Samain, 2010). It consists of com-
posite forms of highly crystallized microfibrils among amorphous ma-
trixes, thus refusing access to hydrolyzing enzymes. Utilization of
cellulose asa nutrient source requires the enzyme cellulase that cleaves
β-1,4 glycosidic bonds in the polymer to release glucose units (Barr
et al., 1996). Cellulolytic bacteria and fungi have developed complex
forms of cellulase systems which actively convert insoluble cellulosic
substrates into soluble saccharides (Tomme et al., 1995). And cellulase
enzymes are active in a wide range of invertebrate taxa (Martin, 1983;
Zinkler and Gotze, 1987). However, relatively few higher animals are
able to utilize this resource efficiently (Goodenough and Goodenough,
1993).
Basic and applied studies on cellulolytic enzymes have demon-
strated their biotechnological potential in various industries includ-
ing food, animal feed, brewing and wine making, agriculture,
biomass refining, pulp and paper, textile, and laundry (Karmakar
and Ray, 2011). In recent years, the use of cellulase becomes one of
the important measures to improve the livestock and poultry pro-
duction performance and feed utilization (Titi and Tabbaa, 2004).
However, information on proper identification, characterization
and application of these enzymes in fish is scarce (Gao et al., 2006;
Yu et al., 2001). Because of increasing scarcity of fishmeal, cellulose
has become essential to evaluate the nutritional value of plant mate-
rials, to increase the bioavailability of nutrients and to minimize the
cost of aquafeeds.
Grass carp (Ctenopharyngodon idella), a typical herbivorous fish, nat-
urally feeds on certain aquatic weeds, and utilizes both plantand animal
Aquaculture 416–417 (2013) 1–7
⁎Corresponding authorat: College of Fisheries,Huazhong Agricultural University, No.1,
Shizishan Street, Hongshan District, Wuhan, Hubei Province 430070, China. Tel.: + 86 27
8728 8255; fax: +86 27 8728 2114.
E-mail addresses: zhouy@mail.hzau.edu.cn (Y. Zhou), xfliang@mail.hzau.edu.cn
(X.-F. Liang).
1
Yi Zhou and Xiaochen Yuan contributed equally to this work.
0044-8486/$ –see front matter © 2013 Published by Elsevier B.V.
http://dx.doi.org/10.1016/j.aquaculture.2013.08.023
Contents lists available at ScienceDirect
Aquaculture
journal homepage: www.elsevier.com/locate/aqua-online
matter in aquaculture, so its digestion appears rather complicated (De
Silva, 2003; FAO, 2004). Das and Tripathi (1991) studied the digestive
enzymes of grass carp fed with different artificial and natural diets.
The cellulase activity was the highest in fish ingested the Lemna minor.
In the present study, cellulase was added into the feed to study effects
of the enzyme on the growth performance and intestinal microbiota
of grass carp. The results can provide the necessary information on
feed additives of grass carp. And as a representative of the herbivorous
fish, the information of cellulase application in grass carp will provide
references for other fish.
2. Materials and methods
2.1. Fish and experimental conditions
Grass carp was obtained from and reared in Guangdong Freshwater
Fish Farm (Panyu, China). The duckweed (L. minor Linn.) was collected
locally, drained of excess water and stored at −20 °C until use. Proxi-
mate composition of the following nutrients was determined using
standard procedures of AOAC (2000). Fish were kept in 1000-L tanks
under controlled light–dark conditions (12 L/12 D) with a constant
flow of filtered water and the water temperature regulated from 23 to
25 °C. The fish were fed uniformly shredded duckweed to apparent sa-
tiation at 10:00 am every day. Uneaten feed and feces were removed
every day. Animals were acclimated to these conditions for 2 weeks.
Table 1 Proximate composition of diets on dry weight basis. After ac-
climation, the fish (99.6 ± 3.2 g) were divided into two groups: exper-
imental group fed with shredded duckweed and wheat flour mixed
with cellulase, and one control group, which were fed with shredded
duckweed and the same percent of wheat flour. Each group was
assigned to triplicate 1000-L tanks (30 fishes per tank), and the feeding
trial lasted for 2 months.
Enzyme utilized was fungal cellulase derived from Trichoderma
longibrachiatum (SIGMA C9748, USA). Enzyme characterization showed
that it contains greater than or equal to 1.0 unit mg
−1
cellulase activity,
and one unit corresponds to the amount of enzymes which liberates
1.0 μmol of glucose from cellulose in 1 h at pH 5.0 at 37 °C. The cellulase
was supplemented at a rate of 3 g kg
−1
duckweed (enough to fully di-
gest cellulose of the deckweed according to the proximate composition)
and mixed with wheat flour. Then the proportion of duckweed and
wheat flour was 10:1, and all components were mixed before each feed-
ing. The incubation timewas not defined exactly,and was about 30 min.
After mixing, diets were pelleted (3 mm diameter) usinga hand operat-
ed mincer. Fish were fed by hand at 9:00 a.m. and 6:00 p.m. with equal
portion of diet, and each feeding last about 30 min.The feeding rate was
3–4% body weight d
‐1
based on the observation of acclimation period.
Fish were weighed with water once every 2 weeks and the daily rations
were adjusted accordingly. Any uneaten feed and feces were removed
respectively 30 min after feeding and were dried for feed intake
calculation. During the experimental period, the aerated and filtered
flow-through water was kept at a flow-rate of 3 L min
−1
, water tem-
perature ranged between 23 and 25 °C, dissolved oxygen was about
7.50 mg L
−1
, total ammonia–nitrogen was less than 0.10 mg L
‐1
and
the pH was ranged between 7.40 and 7.80.
2.2. Sampling and biological analysis
In the middle of the growout period (30 days), the weight and length
of fish were measured. At the end of the growout period (60 days), after
24 h food deprivation all fish were harvested, and anesthetized using 3-
aminobenzoic acid ethyl ester methanesulfonate (MS-222, 50 mg L
−1
water). Every fish was individually weighed and its length determined.
Six fish from each tank were randomly collected, and the entire intesti-
nal tracts were dissected, three of which for analysis of digestive en-
zyme, and three for intestinal microbial community analysis.
Weight gain ratio (WGR) was calculated using the following formula:
WGR (%) = (Wf −Wi) / Wi × 100, where Wf is the final weight of the
fish and Wi is the initial weight of the fish. Specificgrowthrate(SGR)was
estimated using the formula: SGR (%) = (lnWf −lnWi) / days × 100.
Length and weight measurements were used to calculate the condition
factor: condition factor (%) = 100 W / L
3
,whereW=fish weight (g)
and L = total length (cm).
2.3. Enzyme activity measurement
The intestines were dissected and weighed, and then homogenized
on ice. The homogenate was centrifuged at 5000 × gfor 15 min at
4 °C and the upper lipid layer was discarded. The supernatant was col-
lected and divided into small portions and kept at −20 °C for later de-
termination of the enzyme activities. The protein contents of the
intestinal extracts were determined using the BCA method (Wuhan
More Biotechnology Co., Ltd).
Cellulase activity was measured according to the procedure de-
scribed by Zhang et al. (2009) using sodium carboxymethyl cellulose
(Na-CMC) as the substrate. Enzymatic reactions contained 2 mL of tissue
homogenate supernatant, plus 2 mL of substrate solution. The reaction
mixtures were incubated at 37 °C for 30 min. The production of reduc-
ing glucose was estimated by dinitrosalicylic acid (DNS) method, mea-
suring the absorbance of color spectrophotometrically at 540 nm
(Spectronic Biomate 5 spectrophotometer, THERMO, USA). Absorbance
readings were compared to glucose standard curves ranging from 0.1
to 2.0 mg ml
−1
. The enzyme activity was calculated on the basis of a
linear relationship between the glucose released and enzyme dilution.
Cellulase activity was expressed as μg of glucose liberated per minute
per mg of tissue protein.
Amylase activity,protease activityand lipase activity were measured
using assay kits (Nanjing Jiancheng Bioengineering Institute, China)
according to the manufacturer's protocol. One unit of amylase activity
was defined as the amount of enzyme that hydrolyzes 10.0 mg starch
per 30 min. Protease activity was expressed as the equivalent enzyme
activity that was required to generate an optical density (OD) change
of 0.003. One unit of lipase activity was defined as the mmol of substrate
hydrolyzed per minute. Enzyme activities were expressed as specificac-
tivity (U protein
−1
).
2.4. DNA extraction and PCR amplification
The entire intestinal tracts were collected and excised with sterile
forceps and scissors, and then the contents were gently squeezed
out. To avoid inter-individual variations, intestinal contents of
three fish from each tank were pooled for microbiota analysis as de-
scribed previously (Sugita et al., 1991). The total genomic DNA was
isolated from the samples using an UltraClean™Fecal DNA Kit
(MOBIO, USA) according to the manufacturer's instructions. All
DNA was stored at −20 °C until use.
The V3 region of the 16S rRNA genes was amplified using the
Eubacteria-specificprimers8Fand518R(8F,5′-AGAGTTTGATC
ATGGCTCAG-3′; 518R, 5′-ATTACCGCGGCTGCTGG-3′,Baker et al.,
2003). A GC-clamp (CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCAC
GGGGGG) was applied to the 5′end of the forward primer to increase
the sensitivity of the DGGE analysis (Muyzer et al., 1993). PCR
Table 1
Proximate composition of diets on dry weight basis.
Diets Lemna minor Li nn. Lemna minor Linn. and
wheat flour mixture
In g kg
−1
DM
Crude protein 335.4 309.3
Crude lipid 23.6 22.1
Carbohydrate 491.8 542.2
Crude fiber 117.2 101.6
Ash 32.0 29.9
2Y. Zhou et al. / Aquaculture 416–417 (2013) 1–7
amplifications were performed in a 50 μL reaction volume comprising of
about 2.5 ng DNA, 5 μL 10 × PCR buffer, 0.4 μM each primer, 200 μM
each dNTPs and 1.25 U Ex Taq (TAKARA, Japan). Touchdown PCR was
conducted using the following conditions: 10 min at 94 °C, followed
by 30 cycles of 1 min at 94 °C, 1 min at 55 °C (the temperature was
then decreased by 1 °C each cycle), and 1 min at 72 °C, with a final ex-
tension step of 10 min at 72 °C. PCR products were visualized on aga-
rose gels and analyzed by densitometric scanning (AlphaImager™,
Alpha Innotech, USA). Two of each group were chosen for DGGE analysis
according to the product quality.
2.5. Denaturing gradient gel electrophoresis analysis
DGGE of the PCR products was conducted with the Dcode™muta-
tion detection system (Bio-Rad, USA) according to the manufacturer's
instructions. Briefly, approximately equal amounts of PCR product
were loaded per sample in a final volume of 40 μL into 8% (weight
in volume, w/v) polyacrylamide (37.5:1 acrylamide/bisacrylamide)
gels with a 30–60% denaturing gradient. Electrophoresis was then
performed at 60 °C with 150 V for 7 h, after that, gels were silver
stained, visualized and photographed. Next, an image analysis sys-
tem was used to analyze the DGGE band profiles, after which the
densities and migration patterns of the bands were calculated. Prin-
ciple component analysis was then performed based on the densities
and migration of the bands using the Band Scan software (version
5.0). Cluster analysis was used to determine the similarity of
microbiota among samples. A similarity matrix was constructed
using the unweighted pair group method with arithmetic averages,
which is derived from Dice's algorithm, and the software BioEdit
7.0, PHYLIP 4.0, and MEGA 5.0.
2.6. Cloning and sequencing
Prominent DGGE bands were excised and the gel was crushed in
50 μL washing buffer (0.5 M ammonium acetate, 10 mM magnesium
acetate, 1 mM EDTA [pH 8.0], 0.1% SDS) and equilibrated for 3 h at
37 °C. After centrifugation for 5 min at 12,000 × g, the supernatant
was transferred to a new centrifuge tube, ethanol was added to pre-
cipitate DNA, and then melted using Tris-EDTA buffer. DNA was used
as the template for amplification under the conditions described
above. PCR products were purified using UltraClean PCR clean-up
kit (MOBIO, USA) and cloned in Escherichia coli DH5αusing pMD
18-T vector (TAKARA, Japan). The recombinants were identified
through blue–white color selection in ampicillin-containing LB
plates and confirmed by PCR. Three positive clones in each PCR frag-
ment were sequenced.
16SrDNA gene sequences were analyzed in the GenBank data-
base using BLAST (www.ncbi.nlm.nih.gov/BLAST), and all sequences
were included in a phylogenetic analysis. Neighbor-joining phylo-
genetic trees were constructed with MEGA 5.0 using the p-distance
model. The tree was assessed using a bootstrap analysis with 1000
replicates.
2.7. Data analysis and statistics
All data were presented as mean ± SEM (standard error of the
mean). Statistical analysis was performed by t-test using SPSS 17.0. Sta-
tistical significance was determined at the 5% level.
3. Results
3.1. Growth performance
Table 2 showed that cellulase significantly affected WGR and SGR of
grass carp (Pb0.05). On 30 days and 60 days, fish of cellulase group
had the significant higher WGR and SGR than those of control group
(Pb0.05), respectively. The condition factor of fish fed with cellulase
was significant higher on 30 days (Pb0.05), while the condition factor
of both group decreased on 60 days and had no significant difference
(PN0.05). In addition, no significant differences were observed in
feed intake (PN0.05).
3.2. Digestive enzyme activity
As shown in Table 3, the cellulase activity (2.10 ±
0.10 μgglucosemin
−1
mg prot
−1
)offish fed with cellulase-
supplemented diets was significantly higher than that (1.65 ±
0.02 μg glucose min
−1
mg prot
−1
) of control group (Pb0.05). The ac-
tivities of amylase and protease also increased significantly in fish of the
cellulase group (Pb0.05). Meanwhile, the lipase activity did not differ
significantly between both groups (PN0.05).
3.3. PCR-DGGE analysis
To investigate the impact of the cellulase on bacterial community
structures, PCR-DGGE was used to analyze the total microbial DNA
extracted from intestine. Each lane of PCR-DGGE fingerprint represented
the composite samples of 3 fish from the same group. Most bands had a
similar pattern between the two samples of the control group (Fig. 1).
Meanwhile, the two replicates of the cellulase group are partially differ-
ent (Fig. 1). However, the unweighted pair group method with arithmet-
ic mean (UPGMA) clustering assay and multidimensional scaling (MDS)
analysis showed intestinal microbiota of cellulase group tended to cluster
together and segregate from the control group, which clustered together
(Fig. 2). Band patterns derived from control and cellulase samples
showed a low degree of similarity when analyzed by cluster analysis
(77.8%; Fig. 2). Some bands were unique to control samples (bands 1,
2, 9, 17, 18, 22, 23, and 26), whereas other bands were obtained only
with samples of the cellulase group (bands 14, 15, 19, 20, 21, 24, and 25).
Table 2
Growth performance of grass carp.
Control Cellulase
Wi (g) 99.88 ± 0.33 99.30 ± 0.15
Wf —30 days (g) 163.74 ± 0.54 170.21 ± 0.57*
WGR —30 days (%) 63.93 ± 0.10 71.40 ± 0.44*
SGR —30 days (%) 1.65 ± 0.00 1.80 ± 0.01*
FI —30 days (g kg
−1
days
−1
) 21.13 ± 1.87 23.48 ± 2.16
Condition factor —30 days (%) 2.01 ± 0.06 2.40 ± 0.13*
Wf —60 days (g) 264.31 ± 1.39 275.37 ± 0.60*
WGR —60 days (%) 164.61 ± 0.51 177.30 ± 0.43*
SGR —60 days (%) 1.62 ± 0.00 1.70 ± 0.00*
FI —60 days (g kg
−1
days
−1
) 20.62 ± 1.94 22.06 ± 2.25
Condition factor —60 days (%) 1.91 ± 0.05 1.87 ± 0.03
The asterisk (*) means significant difference at Pb0.05 level.
Wi: initial weight, Wf: final weight, WGR: Weight gain ratio, SGR: Specific growth rate, FI:
Feed intake.
WGR (%) = (Wf −Wi) / Wi × 100.
SGR (%) = (lnWf −lnWi) / days × 100.
Condition factor (%) = 100 W / L
3
,W=fish weight (g), L = total length (cm).
Table 3
Digestive enzyme activities of grass carp.
Digestive enzyme Control group Cellulase group
Cellulase activity (μgglucosemin
−1
mg prot
−1
) 1.65 ± 0.02 2.10 ± 0.10*
Amylase activity (U mg prot
−1
) 58.45 ± 2.19 99.43 ± 2.42*
Protease activity (U μgprot
−1
) 24.00 ± 1.12 29.57 ± 1.15*
Lipase activity (U g prot
−1
) 25.54 ± 1.59 27.12 ± 0.57
The asterisk (*) means significant difference at Pb0.05 level.
3Y. Zhou et al. / Aquaculture 416–417 (2013) 1–7
3.4. Phylogenetic analysis
To better define the microbial communities in grass carp intestines,
prominent DGGE bands (Fig. 1) were excised and sequenced. All the
16S rDNA gene sequences have been deposited in the GenBank nucleo-
tide sequence database under accession numbers from KC146687 to
KC146703. The relative identification obtained by alignment in GenBank
and accession numbers for the submitted sequences are reported in
Table 4. The phylogenetic distributions of the bacterial operational tax-
onomic units (OTUs) based on a threshold of 95% similarity were
shown in Fig. 3. Proteobacteria are the dominant groups, including
Alphaproteobacteria, Betaproteobacteria and Gammaproteobacteria.
Besides, the other OTUs were Firmicutes.
4. Discussion
Although grass carp aquaculture largely relies on formula feed, this
study chooses duckweed as feedstuff according to the research focus,
specific as follows. Duckweed, as a natural food of grass carp, has a bet-
ter array of essential amino acids than most other vegetable proteins
and more closely resembles animal protein (Hasan and Chakrabarti,
2009; Hillman and Culley, 1978; Yılmaz et al., 2004). Duckweed
grown on nutrient-rich water has a high concentration of trace min-
erals, potassium (K), phosphorus (P), and pigments, particularly caro-
tene and xanthophyll, which make duckweed meal an especially
valuable dietary supplement for fish (Kabir et al., 2009).However, duck-
weed also contains abundant carbohydrates that cannot be utilized effi-
ciently by fish, especially complex carbohydrates including cellulose.
Research has shown that the cellulase activity of grass carp fed with
the L.minor was higher than that of fish fed with other artificial and
natural diets (Das and Tripathi, 1991). Meanwhile, our preliminary
study also shows that different foods (duckweed or rotifer) fed during
the eating habit conversion period cause the significant differences in
the intestinal development and digestive enzyme activities of grass
carp (unpublished data). These results indicate that the grass carp has
the adaptability to food, and can adjust theintestinal activity to different
food. However, this adaptation is limited, and the fish need to rely on
exogenous enzymes to help digestion (Drew et al., 2005; Wang and
Liu, 2006). Therefore, duckweed was selected to investigate the effect
of the exogenous cellulase on the utility of such a high-fiber feed and
provide data for the development of new protein sources. In addition,
the nutritional composition of the duckweed basically meets thegrowth
of grass carp.
The cellulase promoted the growth of the grass carp and led to the
significant increase in the cellulase activity, amylase activity and prote-
ase activity. In general, enzyme supplemented diets exhibited a signifi-
cant increase in weight gain in Penaeus monodon (Buchanan etal., 1997)
and Pangasius pangasius (Debnath et al., 2005), but contradicted by the
results of Yan et al. (2002) with channel catfish Ictalurus punctatus.
Studies on poultry, pigs and ruminants show that cellulases can im-
prove feed value and performance of animals (Karmakar and Ray,
2011; Kuhad et al., 2011; Titi and Tabbaa, 2004). Cellulases supplied in
the high-fiber compound diet improve the feed utilization in
Megalobrama amblycephala (Yu et al., 2001)andCyprinus carpio (Gao
et al., 2006). However, adding cellulase enzymes in different ratios to
canola diets has no effect on growth parameters and nutrient digestibil-
ity in the angel fish (Pterophyllum scalare)(Erdogan and Olmez, 2009).
Cellulases produced by different kinds of fungi and bacteria had differ-
ent optimum pH and temperature. In addition, even the same enzyme
had different cellulolytic abilities to different diets. In previous studies,
the cellulases were obtained from different manufacturers, and used
in different additional doses, making it difficult to make a comparative
analysis. Moreover, most researches did not indicate the accurate en-
zyme activity. However, at least in terms of grass carp, supplement of
exogenous cellulase to enhance growth performance and improve the
nutritional value of feeds was effective. And this effect is related to the
increased intestinal digestive enzyme activities.
Grass carp is a stomachless fish. Digestion takes place in the intes-
tine, in which various intestinal enzymes are involved in digestive and
absorptive processes, such as amylase, pepsin, trypsin, esterases and al-
kaline phosphatase (Das and Tripathi, 1991). Previousstudies suggested
that amylase activity in the intestine of herbivorous carp is much more
intensethanincarnivorousfish (Bairagi et al., 2002; Dhage, 1968;
Phillips, 1969). And the herbivorous fish demonstrated a lesser lipase
activity compared to carnivorous and omnivorous fish (Das and
Tripathi, 1991; Opuszynski and Shireman, 1995). The high protease
and amylase activities were noted in the intestinal tract of grass carp
in this study, which were significantly higher in the intestine of fish
fed with cellulase-supplied diet than that of control group. Similarly,
the cellulase activity of fish in the cellulase group was much higher,
while lipase activities of both groups were relatively low and not signif-
icantly different. The similar trends have been demonstrated by some
other studies (Li et al., 2005; Lin et al., 2007), in which the activities of
protease or amylase of fish fed diet with enzyme supplementation
(the commercial enzymecomplex) significantly increased with increas-
ing dietary enzyme levels. These results indicated that the exogenous
enzyme supplementation could promote the secretion of endogenous
enzymes. Moreover, digestive enzyme activity generally correlates
with the growth rate of fish (Hidalgo et al., 1999), and similar result
was also observed in the present study in grass carp as above.
It is well established that dietary manipulation modulates the gut
microbiota of fish (Burr et al., 2005; He et al., 2013; Navarrete et al.,
2009; Ringø et al., 2006). On the other hand, the intestinal microbiota
has been suggested to play an important role in nutrient digestion and
absorption (Dimitroglou et al., 2011; Merrifield et al., 2010; Ramirez
and Dixon, 2003). In the present investigation, although there were
Fig. 1. DGGE profiles for total microbial DNAs extracted from intestine of control group
(lane 1, lane 2) and cellulase group (lane 3, lane 4).
4Y. Zhou et al. / Aquaculture 416–417 (2013) 1–7
some differences between the two replicates of the cellulase group due
to the individual variation, UPGMA and MDS analyses showed intestinal
microbiota of cellulase group tended to cluster together and segregate
from the control group. In ad dition, the result (Fig. 1) suggested that cel-
lulase obviously changed the intestinal microbiota of grass carp in bac-
teria species and density. Previous studies have identified the different
bacterial genera in intestinal microbiota and their association with nu-
trient intake (Thillaimaharani et al., 2012). Thus it is speculated that
the change of microbiota may be due to the intestinal nutrition, which
is altered because of the digestive enzymes improved by the supple-
mental cellulase. In addition, gastrointestinal microbiota was confirmed
to influence immune status, disease resistance, survival, and feed utili-
zation (Denev et al., 2009). Consequently,the exogenous enzyme affects
the intestinal microbiota, which in turn improved digestive enzyme ac-
tivities and growth performance of grass carp.
Fish are unable to produce cellulase endogenously but they harbor
microbial populations in their digestive tracts which help in the diges-
tion of plant materials (Bairagi et al., 2002; Lesel et al., 1986; Lindsay
and Harris, 1980; Saha and Ray, 1998). Saha et al. (2006) and He et al.
(2009) isolated cellulase-producing microbes from the intestine of
grass carp. Moreover, there were some unique OTUs (14, 15, 19, 20,
21, 24 and 25) in samples of the cellulase group, which were members
of the Sphingomonas, Bacillus, and Leptothrix groups identified by 16S
rRNA sequencing. Although these bacteria were not confirmed to have
cellulolytic activity in this study, certain strains of Bacilli and
Sphingomonas were proved to be able to produce cellulase in moderate
1.0 0.5 0.0 -0.5 -1.0
PCA 1(43.06%)
1.0
0.5
0.0
-0.5
-1.0
PCA 2(68.73%)
Cellulase2
Cellulase1
Control2
Control1
Control 1
Control 2
Cellulase 2
Cellulase 1
0.000.020.040.060.080.100.12
a
b
Fig. 2. Comparison of similarity based on DGGE fingerprints of 16S rDNA. (a) Unweighted pair group method with arithmetic mean (UPGMA)clustering assay.(b) Multidimensional scal-
ing (MDS) ordination plot.
Table 4
Strains and DGGE bands identified in this study by means of 16S rDNA sequencing.
Phylogenetic group DGGE band Expressional diets Nearest type strain (accession no.) Sequence identity %
Control group Cellulase group
Streptococcus 1+ −Streptococcus sp. SCA22 (AB602935)99
Sphingomonas 2+ −Sphingomonas sp. M16 (GU086440)99
Proteobacteria 5 + + Proteobacterium symbiont TM85-82 (FJ774970)99
Pseudomonas 9+ −Pseudomonas sp. RM2-2001 (AF331664)100
Alphaproteobacteria 17 + −Alpha proteobact erium OR-114(HM163221)98
Aquabacterium 18 + −Aquabacterium sp. ARUP UnID 125 (JQ259321)100
Sphingomonas 19 −+Sphingomonas echinoides DSM 1805-T (AJ012461)100
Bacillus 20 −+Bacillus sp. CE2 (JQ435699.1)99
Sphingomonadaceae 21 −+Sphingomonadaceae bacterium PB136 (AB220113)97
Burkholderiales 22 + −Burkholderiales bacterium YT0099 (AB362826)95
Sphingomonas 23 + −Sphingomonas rhizogenes strain BW59UT1570 (JF276901)99
Leptothrix 24 −+Leptothrix sp . AV011a (AF385528)99
Unknown bacteria 25 −+ Iron-reducing bacterium enrichment HN54 (FJ269061)99
Ideonella 26 + −Uncultured Ideonella sp. PM6_−2.9–45 (JQ178142)99
5Y. Zhou et al. / Aquaculture 416–417 (2013) 1–7
quantities and also be very good producers of protease and amylase
(Ghosh et al., 2002; Haichar et al., 2007; He et al., 2009; Saha et al.,
2006). From these results, it can be inferred that changes of intestinal
microbiota in the cellulase group, especially the emergence of certain
bacterial strains including Bacilli and Sphingomonas, contributed to
the digestion of cellulose. However, the role that individual microbes
play in the health and nutrition of fish is still poorly understood, there-
fore further investigations of the intestinal microbiota are important for
aquaculture.
The herbivorous including herbivorous fish can synthesize the cellu-
lase enzyme not by the animals themselves but by certain microorgan-
ism (He et al., 2009; Saha et al., 2006).However,theenzymeistoo
limited to digest and absorb crude fiber sufficiently. Therefore exogenous
cellulase is needed to supplement in the fish diets especially when using
plant ingredients. Furthermore, omnivorous and carnivorous fish may
need more enzymes. Based on the previous and our results, the cellulase
is recommended to apply in aquaculture as feed additive. In addition,
now available commercial cellulase is near acidic, and the optimum-pH
is lower than the digestive tract pH of fish. Thus the reaction conditions,
substrate selections, processing methods should be considered to pro-
duce the cellulase suitable for physiological environment of fish digestive
tract and the multiple enzyme system for a variety of fish feed in the
practical application of cellulase.
5. Conclusions
As a typical herbivorous fish, the grass carp fed with duckweed was
selected to study the effect of exogenous cellulase on the growth. The
results show that the cellulase increases the digestive enzyme activities,
improves the intestinal flora, and promotes the growth. The endoge-
nous cellulase is far from sufficient to fully digest the ingested fiber, so
cellulase should be developed as a kind of aquatic additive.
Acknowledgments
This work was financially supported by the National Basic Research
Program of China (2014CB138601, 2009CB118702), the National
Natural Science Foundation of China (31172420), the China Postdoctor-
al Science Foundation (2013 M531708) and the Special Fund for Agro-
Scientific Research in the Public Interest of China (201003020).
References
AOAC, 2000. Association of Official Analytical Chemists: Official Methods of Analysis, 16th
edn. (Washington, DC, USA).
Bairagi,A., Sarkar, G.K., Sen,S.K., Ray, A.K., 2002.Enzyme producing bacterial floraisolated
from fish digestive tracts. Aquacult. Int. 10, 109–121.
Baker, G.C., Smith, J.J., Cowan, D.A., 2003. Review and re-analysis of domain-specific16S
primers. J. Microbiol. Methods 55, 541–555.
Barr, B., Hsieh, Y.L., Ganem, B.W., 1996. Identification of two functionally different classes
of exocellulases. Biochemistry 35, 586–592.
Buchanan, J., Sarac, H.Z., Poppi, D., Cowan, R.T., 1997. Effects of enzyme addition to canola
meal in prawn diets. Aquaculture 151, 29–35.
Burr, G., Gatlin, D., Ricke, S., 2005. Microbial ecology of the gastrointestinal tract of fish
and the potential application of prebiotics and probiotics in finfish aquaculture.
J. World Aquacult. Soc. 36, 425–436.
Das, K.M., Tripathi, S.D., 1991. Studies on the digestive enzymes of grass carp,
Ctenopharyngodon idella (Val.).Aquaculture92,21–32.
De Silva, S., 2003. Carps. In: Lucas,J.S., Southgate, P.C.(Eds.), Aquaculture: farming aquatic
animals and plants. Blackwell Publishing, Oxford, pp. 276–294.
5
Sphingomonadaceae bacterium PB136(AB220113.1)
Proteobacterium symbiont TM85-82(FJ774970.1)
25
9
Iron-reducing bacterium enrichment HN54(FJ269061.1)
Pseudomonas sp. RM2-2001(AF331664.1)
Alpha proteobacterium OR-114(HM163221.1)
Sphingomonas sp.M16(GU086440.1)
Sphingomonas echinoides DSM 1805-T(AJ012461.1)
19
23
22
24
18
20
Bacillus sp. CE2(JQ435699.1)
Leptothrix sp. AV011a(AF385528.1)
Aquabacterium sp. ARUP UnID 125(JQ259321.1)
Burkholderiales bacterium YT0099(AB362826.1)
26
Uncultured Ideonella sp.PM6-2.9-45(JQ178142.1)
2
17
21
1
Streptococcus sp.SCA22(AB602935.1)
Sphingomonas rhizogenes strain BW59UT1570(JF276901)
80
68
14
81
3
3
3
3
3
2
2
2
2
4
1
1
19
99
97
1
43
0
0
2
0
Fig. 3. Neighbor-joining dendrogram derived from 16S rRNA gene sequences of predominant bands in DGGE gels. For each tree entry from this study, the number represents the band
excised from DGGE gels.
6Y. Zhou et al. / Aquaculture 416–417 (2013) 1–7
Debnath,D., Pal, A.K., Sahu, N.P.,Jain, K.K., Yengkokpam, S., Mukherjee, S.C., 2005. Effect of
dietary microbial phytase supplementation on growth and nutrient digestibility of
Pangasius pangasius (Hamilton) fingerlings. Aquacult. Res. 36, 180–187.
Denev, S., Staykov, Y., Moutafchieva, R., Beev, G., 2009. Microbial ecology of the gastroin-
testinal tract of fish and the potential application of probiotics and prebiotics in fin-
fish aquaculture. Int. Aquat. Res. 1, 1–29.
Dhage, K.P.,1968. Studies of the digestive enzymes in the three species of the major carps
of India. I. Biol. Sci. 11, 63–74.
Dimitroglou, A., Merrifield, D.L.,Carnevali, O., Picchietti, S.M.,Avella, M., Daniels,C., Güroy,
D., Davies,S.J., 2011. Microbial manipulations to improvefish health and production—
a Mediterranean perspective. Fish. Shellfish. Immunol. 30, 1–16.
Drew, M.D., Racz, V.J., Gauthier, R., Thiessen, D.L., 2005. Effect of adding protease to
coextruded flax: pea or canola: pea productson nutrient digestibility and growth perfor-
mance of rainbow trout (Oncorhynchus mykiss). Anim. Feed. Sci. Technol. 119, 117–128.
Erdogan, F., Olmez, M., 2009. Effects of enzyme supplementation in diets on growth and
feed utilization in Angel fish, Pterophyllum scalare. J. Anim. Vet. Adv. 8, 1740–1745.
FAO, 2004. Ctenopharyngodon idellus. Cultured Aquatic Species Information Programme.
FAO Fisheries and Aquaculture Department [online]. http://www.fao.org/fishery/
culturedspecies/Ctenopharyngodon_idella/en.
Gao, C.S., Cheng, H.C., Huo, J., Xiao, C.B., 2006. An experiment for application of cellulase in
carp feed. Cereal Feed Ind. 9, 32–33 (in Chinese with English abstract).
Ghosh,K., Sen, S.K., Ray, A.K.,2002. Characterization of Bacilliisolated from the gut of rohu,
Labeo rohita,fingerlings and its significance in digestion. J. Appl. Aquac. 12, 33–42.
Goodenough, S., Goodenough, P., 1993. Who needs cellulase? J. Biol. Educ. 27, 97–102.
Haichar, F.Z., Berge,O., Heulin, T., Marol, C., Marais, M.F., Mougel,C., Ranjard, L., Balesdent,
J., 2007. Identification of cellulolytic bacteria in soil by stable isotope probing. Envi-
ron. Microbiol. 9, 625–634.
Hasan, M.R., Chakrabarti, R., 2009. Floating aquatic macrophytes —duckweeds. In: Hasan,
M.R., Chakrabarty , R. (Eds.), Use of Algae and Aquatic Macrophytes as Feed in Small
Scale Aquaculture —A Review. FAO Fisheries and Aquaculture Technical Paper,
Rome, pp. 29–52.
He, L., Zhang, Z., Xie,C.X., Hao, B., Wang,C.Y., He, G., 2009.Isolation of cellulose —producing
microbes from the intestine of grass carp (Ctenopharyngodon idellus). Environ. Biol.
Fish. 86, 131–135.
He, S., Wu, Z., Liu, Y., Wu, N., Tao, Y., Xu, L., Zhou, Z., Yao, B., Ringø, E., 2013. Effects of di-
etary 60 g kg
−1
dried distiller's grains in least-cost practical diets on production and
gut allochthonous bacterial composition of cage-cultured fish: comparison among
fish species with different natural food habits. Aquacult. Nutr. http://dx.doi.org/
10.1111/anu.12023.
Hidalgo, M.C., Urea, E., Sanz, A., 1999. Comparativestudy of digestive enzymes in fish with dif-
ferent nutritional habits. Proteolytic and amylase activities. Aquaculture 170, 267–283.
Hillman, W.S., Culley, D.D., 1978. The uses of duckweed. Am. Sci. 66, 442–451.
Kabir, A.N.M.A., Hossain, M.A., Rahman, M.S., 2009. Use of duckweed as feed for fishes in
polyculture. J. Agric. Rural. Dev. 7, 157–160.
Karmakar, M., Ray, R.R., 2011. Current trends in research and application of microbial cel-
lulases. Res. J. Microbiol. 6, 41–53.
Kuhad, R.C., Gupta, R., Singh, A., 2011. Microbial cellulases and their industrial applica-
tions. Enzyme Res. http://dx.doi.org/10.4061/2011/280696.
Lesel, R., Fromageot, C., Lesel, M., 1986. Cellulose dig estibility in grass carp, Ctenopharyngodon
idella and in goldfish, Carassius auratus. Aquaculture 54, 11–17.
Li, J.S., Li, J.L., Wu, T.T., 2005. Effects of exogenous enzyme and citric acid on activities of
endogenous digestive enzyme of tilapia (Oreochromis niloticus ×O.aureus).
J. Nanjing Agric. Univ. 28, 97–101 (in Chinese with English abstract).
Lin, S.M., Mai, K.S., Tan, B.P., 2007. Effects of exogenous enzyme supplementation in diets
on growth and feed utilization in tilapia, Oreochromis niloticus ×O.aureus.Aquac.
Res. 38, 1645–1653.
Lindsay, G.J.H., Harris, J.E., 1980. Carboxymethylcellulase activity in the digestive tracts of
fish. J. Fish Biol. 16, 219–233.
Martin, M.M., 1983. Cellulose digestion in insects. Comp. Biochem. Physiol. 75, 313–324.
Merrifield, D.L., Dimitroglou, A., Bradley, G., Baker, R.T.M., Davies, S.J., 2010. Probiotic ap-
plication for rainbow trout (Oncorhynchus mykiss Walbaum) I. Effects on growth per-
formance, feed utilization, intestinal microbiota and related health criteria. Aquacult.
Nutr. 16, 504–510.
Muyzer, G., DeWaal, E.C., Uitterlinden, A.G., 1993. Profiling of complex microbial popula-
tions by denaturing gradient gel electrophoresis analysis of polymerase chain
reaction-amplified genes codingfor 16S rRNA. Appl. Environ. Microbiol. 59, 695–700.
Navarrete, P., Espejo, R.T., Romero, J., 2009. Molecular analysis of microbiota along the di-
gestive tract of juvenile Atlantic salmon (Salmo salar L.). Microb. Ecol. 57, 550–561.
New, M.B., Wijkstrom, U.N., 2002. Use of fishmeal and fish oil in aquafeeds: further
thoughts on the fish-meal trap. FAO Fisheries Circular (975). FAO, Rome, p. 61.
Opuszynski, K., Shireman, J.V., 1995. Digestive mechanisms. In: Opuszynski, K., Shireman,
J.V. (Eds.), Herbivorous Fishes: Culture and Use for Weed Management. CRC Press,
Boca Raton, pp. 21–31.
Péreza, S., Samain, D., 2010. Structure and engineering of celluloses. Adv. Carbohydr.
Chem. Biochem. 64, 25–116.
Phillips, A.M., 1969. Nutrition, digestion and energy utilization. In: Hoar, W.S., Randall, D.J.
(Eds.), Fish Physiology. Academic Press Inc., New York, pp. 391–432.
Ramirez, R.F., Dixon, B.A., 2003. Enzyme production by obligate intestinal anaerobic bac-
teria isolated from oscars (Astronotus ocellatus), angelfish (Pterophyllum scalare)and
southern flounder (Paralichthys lethostigma). Aquaculture 227, 417–426.
Ringø, E., Sperstad, S., Myklebust,R., Refstie, S., Krogdahl, A., 2006. Characterisation of the
microbiota associated with intestine of Atlantic cod (Gadus morhua L.) The effect of
fish meal, standard soybean meal and a bioprocessed soybean meal. Aquaculture
261, 829–841.
Saha, A.K., Ray, A.K., 1998. Cellulase activity in rohu fingerlings. Aquacult. Int. 6, 281–291.
Saha, S., Roy,R.N., Sen, S.K., Ray, A.K., 2006. Characterization of cellulase-producing bacte-
ria from the digestive tract of tilapia, Oreochromis mossambica (Peters) and grass carp,
Ctenopharyngodon idella (Valenciennes). Aquac. Res. 37, 380–388.
Sugita,H., Miyajima, C., Deguchi, Y., 1991.The vitamin-B 12-producing ability of the intes-
tinal microflora of fresh-water fish. Aquaculture 92, 267–276.
Thillaimaharani, K.A., Logesh, A.R., Sharmila, K., Kaja, B., Magdoom, M., 2012. Studies on
the intestinal bacterial flora of tilapia Oreochromis mossambicus (Peters, 1852) and
optimization of alkaline protease by Virgibacillus pantothenticus. JMA 4, 79–87.
Titi, H.H., Tabbaa, M.J., 2004. Efficacy of exogenous cellulase on digestibility in lambs and
growth of dairy calves. Livest. Prod. Sci. 87, 207–214.
Tomme, P., Warren, R.A.J., Gilkes, N.R., 1995. Cellulose hydrolysis by bacteria and fungi.
Adv. Microb. Physiol. 37, 1–81.
Vielma, J., Koskela, J., Ruohonen, K., Jokinen, I., Kettunen, J., 2003. Optimal diet composi-
tion for European whitefish (Coregonus lavaretus): carbohydrate stress and immune
parameter responses. Aquaculture 225, 3–16.
Wang, A.M., Liu, W.B., 2006. Effects of exogenous enzymes on the growth and apparent
digestivibilityof allogynogeneticcruciancarp fingerlings. Feed Ind. 2,26–29 (in Chinese
with English abstract).
Yan, W., Reigh,R.C., Xu, Z., 2002. Effects of fungal phytase on utilization of dietary protein
and minerals and dephosphorylation of phytic acid in the alimentary tractof channel
catfish (Ictalurus punctatus) fed an all plant protein diet. J. World Aquac. Soc. 33,
10–22.
Yılmaz, E.,Akyurt, İ., Günal, G., 2004. Useof duckweed, Lemna minor,as a protein feedstuff
in practical diets for common carp, Cyprinus carpio, fry. Turk. J. Fish. Aquat. Sci. 4,
105–110.
Yu, F.N., Wang, D.Z., Xu, H.J., 2001. Influence of addition dietary cellulase on growth and
feed utilization of fingerling Megalobrama amblycephala. J. Shanghai Fish. Univ. 10,
90–92 (in Chinese with English abstract).
Zhang, Y.H.P., Hong, J., Ye, X., 2009. Cellulase assays. Methods Mol. Biol. 581, 213–231.
Zinkler, D., Gotze, M., 1987. Cellulose digestion by the firebrat Thermobia domestica.
Comp. Biochem. Physiol. B 88, 661–666.
7Y. Zhou et al. / Aquaculture 416–417 (2013) 1–7
