Content uploaded by Xiao Zhao
Author content
All content in this area was uploaded by Xiao Zhao on Jul 06, 2015
Content may be subject to copyright.
RESEARCH ARTICLE
SCF, Regulated by HIF-1α, Promotes
Pancreatic Ductal Adenocarcinoma Cell
Progression
Chuntao Gao
☯
, Shasha Li
☯
, Tiansuo Zhao
☯
, Jing Chen, He Ren, Huan Zhang,
Xiuchao Wang, Mingxiao Lang, Jingcheng Liu, Song Gao, Xiao Zhao, Jun Sheng,
Zhanna Yuan, Jihui Hao*
Tianjin Medical University Cancer Institute and Hospital, National Clinical Research Center for Cancer, Key
Laboratory of Cancer Prevention and Therapy, Department of Pancreatic Cancer, Tianjin, 300060, China
☯These authors contributed equally to this work.
*haojihui@tjmuch.com
Abstract
Stem cell factor (SCF) and hypoxia-inducible factor-1α(HIF-1α) both have important func-
tions in pancreatic ductal adenocarcinoma (PDAC). This study aims to analyze the expres-
sion and clinicopathological significance of SCF and HIF-1αin PDAC specimens and
explore the molecular mechanism at PDAC cells in vitro and in vivo. We showed that the ex-
pression of SCF was significantly correlated with HIF-1αexpression via Western blot, PCR,
chromatin immunoprecipitation (ChIP) assay, and luciferase assay analysis. The SCF level
was also correlated with lymph node metastasis and the pathological tumor node metasta-
sis (pTNM) stage in PDAC samples. The SCF higher-expression group had significantly
lower survival rates than the SCF lower-expression group (p<0.05). Hypoxia up-regulated
the expression of SCF through the hypoxia-inducible factor (HIF)-1αin PDAC cells at the
protein and RNA levels. When HIF-1αwas knocked down by RNA interference, the SCF
level decreased significantly. Additionally, ChIP and luciferase results demonstrated that
HIF-1αcan directly bind to the hypoxia response element (HRE) region of the SCF promoter
and activate the SCF transcription under hypoxia. The results of colony formation, cell
scratch, and transwell migration assay showed that SCF promoted the proliferation and in-
vasion of PANC-1 cells under hypoxia. Furthermore, the down-regulated ability of cell prolif-
eration and invasion following HIF-1αknockdown was rescued by adding exogenous SCF
under hypoxia in vitro. Finally, when the HIF-1αexpression was inhibited by digoxin, the
tumor volume and the SCF level decreased, thereby proving the relationship between HIF-
1αand SCF in vivo. In conclusion, SCF is an important factor for the growth of PDAC. In our
experiments, we proved that SCF, a downstream gene of HIF-1α, can promote the develop-
ment of PDAC under hypoxia. Thus, SCF might be a potential therapeutic target for PDAC.
PLOS ONE | DOI:10.1371/journal.pone.0121338 March 23, 2015 1/14
OPEN ACCESS
Citation: Gao C, Li S, Zhao T, Chen J, Ren H, Zhang
H, et al. (2015) SCF, Regulated by HIF-1α, Promotes
Pancreatic Ductal Adenocarcinoma Cell Progression.
PLoS ONE 10(3): e0121338. doi:10.1371/journal.
pone.0121338
Academic Editor: Surinder K. Batra, University of
Nebraska Medical Center, UNITED STATES
Received: August 12, 2014
Accepted: January 30, 2015
Published: March 23, 2015
Copyright: © 2015 Gao et al. This is an open access
article distributed under the terms of the Creative
Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are
credited.
Data Availability Statement: All relevant data are
within the paper and its Supporting Information files.
Funding: This work was supported by grants as
follows: National Natural Science Foundation of
China (grant No. 81302082, 81272685, 31301151,
81172355); Key Program of Natural Science
Foundation of Tianjin (grant No. 11JCZDJC18400,
13YCYBYC37400); Major Anticancer Technologies R
& D Program of Tianjin (grant No. 12ZCDZSY16700).
The funders had no role in study design, data
collection and analysis, decision to publish, or
preparation of the manuscript.
Introduction
Pancreatic ductal adenocarcinoma (PDAC) is a highly malignant tumor with poor prognosis.
Understanding the molecular basis of the disease is highly desirable for developing new strate-
gies to prevent and treat PDAC [1].
Stem cell factor (SCF), also known as a mast cell growth factor, steel factor, and kit ligand
[2], is a multifunctional cytokine involved in tumor progression. SCF and its receptor, c-kit li-
gand (KL), are up-regulated in particular human malignancies including gastrointestinal stro-
mal tumor (GISTs) [3], breast cancer [4,5], hematopoietic cell [6], myeloid leukaemia [7], and
glioma [8]. The binding of SCF to c-kit causes receptor dimerization and protein kinase activa-
tion and mediates a variety of biological effects in tumor by many signal transduction pathways
[9,10]. Recently, more and more studies showed that the SCF/c-kit system has an important
function in angiogenesis, proliferation, and invasion in tumor cells [11]. Moreover, the SCF/c-
kit binding has been reported to increase hypoxia-inducible factor-1α(HIF-1α) protein syn-
thesis by the PI3K and Ras/MEK/ERK pathways in pancreatic cancer cells under normoxia,
and hypoxia up-regulated SCF gene expression in breast cancer cells through HIF-1α[5].
However, the interaction between HIF-1αand SCF in pancreatic cancer remains unclear.
As an important transcription factor, HIF-1αhas important functions in cancerous trans-
formation, chemoradiotherapy resistance, and tumor progression [12]. Tumor cells increase
the expression of HIF-1αby activating AKT under normoxia [13]. HIF-1αregulates many
downstream genes, such as erythropoietin, VEGF, heme oxygenase-1, enolase, lactate dehydro-
genase A, and aldolase [14,15]. The HIF-1αexpression level was high in pancreatic cancer, and
HIF-1αwas related to clinical stage and lymph node metastasis [16]. Therefore, HIF-1αhad
been considered as a new therapeutic target for pancreatic cancer, and targeted therapy against
HIF-1 expression in PDAC was recently investigated [17–19].
In the present study, we investigated the prognostic value of HIF-1αand SCF protein ex-
pression in primary PDAC tissues. The correlation between HIF-1αand SCF was explored and
verified both in vitro and in vivo. Moreover, the biological effects of SCF on PDAC were inves-
tigated in vitro.
Materials and Methods
Cell cultures and treatments
BxPC-3 and PANC-1 cell lines were chosen for this experiment. They were obtained from the
Committee of Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China).
PANC-1 was maintained in Dulbecco's modified Eagle's medium (Hyclone, USA) supple-
mented with 10% fetal bovine serum (Gibco, USA). BxPC-3 cells were maintained in RPMI-
1640 medium (Hyclone, USA) supplemented with 10% fetal bovine serum (Gibco, USA). The
cells were incubated at 37°C in a humidified atmosphere of 95% air and 5% CO
2
. For the hyp-
oxia treatment, the cells were placed in a modular incubator (Thermo Electron Co, Forma,
MA) consisting of 94% N
2
,5%CO
2
and 1% O
2
.
Reagents and antibodies
For IHC analysis: mouse monoclonal SCF antibody (sc-13126, 1:100 dilution) and mouse
monoclonal HIF-1αantibody (sc-13515, 1:100 dilution) were obtained from Santa Cruz
Biotechnology.
For western blot analysis: mouse monoclonal HIF-1αantibody (sc-13515, 1:500 dilution),
mouse monoclonal β-actin antibody (sc-8432, 1:2500 dilution), and rabbit polyclonal SCF
SCF Promotes Pancreatic Ductal Adenocarcinoma Cell Progression
PLOS ONE | DOI:10.1371/journal.pone.0121338 March 23, 2015 2/14
Competing Interests: The authors have declared
that no competing interests exist.
antibody (sc-9132, 1:1000 dilution) were obtained from Santa Cruz Biotechnology. The sec-
ondary antibodies preparation was either anti-rabbit (1:5000) or anti-mouse (1:5000).
For cell functional experiments: rabbit polyclonal neutralizing SCF antibody (ab9716,
0.01 μg/mL) was obtained from Abcam.
Ethics statement
The use of human samples in this study was approved by the Ethics Committee of Tianjin Can-
cer Hospital. The research involving human participants and animal experiments had been ap-
proved by our hospital and our equivalent committee. The participants provided their written
informed consents to participate in this study, but these cannot be included in the report be-
cause of the large volume and the consents were written in Chinese.
All animal experiments were conducted according to relevant national and international
guidelines.
This study was carried out in strict accordance with the recommendations in the Guide for
the Care and Use of Laboratory Animals of the National Institutes of Health (Tianjin Cancer
Hospital). The protocol was approved by the Committee on the Ethics of Animal Experiments
of the Tianjin Cancer Hospital. All surgery was performed under sodium pentobarbital anes-
thesia, and all efforts were made to minimize suffering.
Immunohistochemistry (IHC)
After obtaining the approval from the Ethics Committee, PDAC tumor samples were obtained
from 95 patients (ages, 36–79 y) undergoing surgical resection, with IHC diagnosis of PDAC at
the Tianjin Cancer Institute & Hospital between July 1997 and April 2010. Specimens were cut,
deparaffinized, and rehydrated with xylene and graded alcohols. Antigen retrieval was carried
out in 5 mM citrate buffer. After the inactivation of endogenous peroxidase with 3% H
2
O
2
, the
sections were blocked with goat serum and incubated with either HIF-1αantibody (1:100) or
SCF antibody (1:100) overnight at 4°C. The sections were first rinsed in phosphate buffered sa-
line (PBS), incubated with biotinylated secondary antibody at 37°C for 20 min, and then
washed with PBS three times. Diaminobenzidine was used as a chromogen substrate. Finally,
the sections were counterstained with haematoxylin. The results of IHC staining were evaluat-
ed as follows: the intensity of tissue staining was graded as low shading (1), medium shading
(2), and high shading (3). The proportion of positive cells was assessed as 1 (1%-33% cells
stained), 2 (33%-67% cells stained), and 3 (>67% cells stained). The cases were classified into
positive groups (2–3. low; 4–6. medium; >6. high) by the product of the intensity and propor-
tion of the immunostained cancer cells for HIF-1αor SCF. Two independent pathologists
evaluated the slides, and all cases with discrepant interpretations were discussed using a dou-
ble-headed microscope until a consensus was reached. The clinicopathologic data and patient
outcomes were not given to both pathologists.
Western blotting
Total cell extracts were lysed using a RIPA lysis buffer (Beyotime, China) supplemented with
proteinase inhibitors cocktail (Sigma, USA). The protein concentration was measured using
the BCA assay kit (Sigma, USA). First, 20 μg of protein from total cell lysates was separated by
10% SDS–polyacrylamide gel electrophoresis then transferred to PVDF membranes (Invitro-
gen, USA). The membranes were then incubated in a blocking buffer containing 5% nonfat dry
milk for 1 hr at room temperature and were incubated with the different primary antibodies
overnight at 4°C. The membrane samples were then washed with TBS-T 3 times and incubated
with the corresponding secondary antibodies for 1 hr at room temperature. We used ECL
SCF Promotes Pancreatic Ductal Adenocarcinoma Cell Progression
PLOS ONE | DOI:10.1371/journal.pone.0121338 March 23, 2015 3/14
western blotting substrate (Pierce, USA) to test the immunoblotted bands. The primary anti-
body preparations were as follows: HIF-1αantibody, SCF antibody, and β-actin antibody.
Real-time PCR analysis
Total RNA was extracted from the two pancreatic cancer cell lines by using a TRIzol reagent
(Invitrogen, USA). Total RNA aliquots (1μg) were reverse transcribed with oligo (dT) primers
at 70°C for 10 mins. They were then placed on ice for 2 min, and they were added to the 8U Re-
verse Transcriptase reaction liquid (TaKaRa, China). The mixture was then incubated at 42°C
for 60 mins then at 70°C for 10 mins. Reaction mixture aliquots (cDNA) (2μl) were used as
templates for RT-PCR. PCR cycling conditions were 95°C for 15 min and 40 cycles of 95°C for
15 s, 60°C for 30 s, and 72°C for 30 s, followed by the final melting curve program. β-actin
RNA was used as the loading control. Each sample was done in triplicate, and the mean values
were used for quantization. The primers for HIF-1α, SCF, and β-actin were as follows: forward
5'-GCAAGCCCTGAAAGCG-3' and reverse 5'-GGCTGT CCGACTTTGA-3' (HIF-1α); for-
ward 5'-CTGCTCCTATTTAATCCTCTCGTCA-3' and reverse 5'-ATTGTACTACCATCTC
GCTTATCCA-3' (SCF); forward 5'-CAGAGCAAGAGAGGCATCC-3' and reverse 5'-CTGG
GGTGTTGA AGGTCTC (β-actin).
Chromatin immunoprecipitation assay (ChIP)
A commercial chip assay kit (Upstate Biotechnology, Waltham, USA) was used following the
manufacturer’s instructions. After treatment, each sample group was incubated with 1% form-
aldehyde to cross-link the DNA-protein complexes. The cross-links were heated at 37°C for
10 min. After being washed with cold PBS, the cells were collected and lysed with SDS lysis buffer
(1% SDS, 10 mM EDTA, 50 mM Tris, pH 8.1) containing protease inhibitors. Lysate was sonicat-
ed to shear the DNA to lengths between 200 and 1000 bp. The cross-linked protein was then im-
munoprecipitated using mouse anti-human HIF-1αmonoclonal antibody (1:100) or non-
specific IgG antibody (as the negative control of the antibody, Sigma, USA). The DNA was ex-
tracted via the phenol chloroform method and precipitated by ethanol for PCR amplification.
Primers flanking the hypoxia response element (HRE) of the VEGF promoter were used as the
positive control. Meanwhile, primers that do not include HRE were used as a negative control.
Additionally, the input and anti-RNA polymerase were used as the other positive controls of
the experiment [5]. The forward and reverse primers were as follows: 5'-GCCTGCTTCTCGC
CTACC-3' and 5'-GAGCTCCAGCATATTGCACG-3' (SCF), amplified the following sequence
of genomic DNA: GCCTGCTTCTCGCCTACCCCGGGCTCCGGAAGGGAAGGAGGCGTG
TCCGGAGCAGGCGGGCGGGAACTGTATAAAAGCGCCGGCGGCTCAGCAGCCGGG
CTTCGCTCGCCGCCTCGCGCCGAGACTAGAAGCGCTGCGGGAAGCAGGGACAGTG
GAGAGGGCGCTGCGCTCGGGCTACCCAATGCGTGGACTATCTGCCGCCGCTGTTC
GTGCAATATGCTGGAGCTC (228bp); 5'-GCCTCTGTCTGCCCAGCTGC-3' and 5'-GTGG
AGCTGAGAACGGGAAGC-3' (VEGF). The sequences of the negative primers were as follows
(not including HRE): forward: 5'-CGAGACCGGCGGGAGG-3', reverse: 5’-CGGAGCC
CGGGGTAGG-3'. The PCR products were separated using 1% agarose.
Transient transfection and luciferase assay
The cells were plated at a density of 5×10
5
cells/well in 6-well plates. The pcDNA3.1-HIF-1α
plasmids were prepared as previously described. The full-length SCF luciferase promoter
plasmids containing the lengths of SCF 5’-flanking sequences (spanning from +184 to-2185)
were constructed and named pGL3-SCF. Mutant SCF promoter was constructed and named
pGL3-SCF-M. The constructs were mutated from GCGTG to GTAGA that contained the SCF
SCF Promotes Pancreatic Ductal Adenocarcinoma Cell Progression
PLOS ONE | DOI:10.1371/journal.pone.0121338 March 23, 2015 4/14
promoters but without the HRE site. We then transfected the pcDNA3.1-HIF-1αplasmids
(1 μg) with either pGL3-SCF (1 μg) or pGL3-SCF-M (1 μg) into PANC-1 cells. Renilla lucifer-
ase construct (10 ng) (pRL-SV40, Promega, USA) was co-transfected as the internal reference.
PGL3-Basic (Promega, USA) and pGL3-VEGF were chosen as the negative and positive con-
trol, respectively. After transfection for 48 hrs, the cells were incubated in hypoxia for 12 hrs.
The luciferase activity was then determined using the Dual-Luciferase Reporter Assay System
(Promega, USA). All data was normalized to Renilla luciferase expression. VEGF luciferase re-
porter construction (pGL3-VEGF) was used as the positive control for the HIF-1αresponse.
Colony formation assay
The cells were seeded in six-well plates at a density of 200 cells per well and cultured at 37°C
for two weeks. At the end of the incubation period, colonies were stained with a three-step
stain set (Thermo Scientific) and counted using an optical microscope. Each measurement was
performed in triplicate, and each experiment was conducted at least three times.
Cell scratch assays
The pancreatic cells with different treatment were seeded to full confluency in 6-well plates
overnight. The following day, a scratch was introduced in the middle of the well by using a ster-
ile pipette tip. The medium was discarded and replaced with a fresh one. The rate of migration
towards the center of the wound was determined after 12 hrs.
Cell invasion assays
The invasion assays were performed with an 8.0 μm pore inserts in a 24-well Trans-well cham-
bers (Costar, USA). For this assay, 1×10
5
cells were isolated and added to the upper chamber of
a trans-well with DMEM. The invasion assay was performed using 1/6 diluted matrigel (BD
Bioscience)-coated filters. The DMEM with 10% fetal bovine serum was added to the lower
chamber and incubated for 24 hours. Cells that had migrated to the bottom of the filter were
stained with a three-step stain set (Thermo Scientific). Each experiment was repeated at least
three times.
Animal experiments
PANC-1 cells (1×10
6
) were injected subcutaneously into the right flank of female nude mice.
Digoxin and saline for injection were obtained from Tianjin Medical University Cancer Insti-
tute and Hospital. The cells were harvested by trypsinization, washed in PBS, resuspended at a
1:1 solution of PBS: Matrigel, and injected subcutaneously into the right flank of nude nu/nu
mice. When the tumors had grown to 200 mm
3
, the mice were randomized into two treatment
groups (n = 8 for each group): saline control and digoxin groups. The mice received daily intra-
peritoneal injections of either saline or digoxin (2 mg/kg) to inhibit HIF activity [20–22]. The
tumor was palpable 5 days after inoculation, and all of the mice had developed tumors by the
end of the experiment. The physical condition of the animals, including fur-roughing, shed-
ding, and local trauma at the site of injection, as well as decrements in general animal activity
were regularly monitored. Tumor volume was calculated using the following formula: V = π/
6 × length × width
2
. The mice were immediately euthanized after the tumor samples were iso-
lated and photographed. All tumor samples were paraffin-embedded for IHC analysis.
SCF Promotes Pancreatic Ductal Adenocarcinoma Cell Progression
PLOS ONE | DOI:10.1371/journal.pone.0121338 March 23, 2015 5/14
Statistical analysis
All data analyses were performed using the SPSS13.0 statistical analysis software. Differences
between two samples were analyzed via unpaired t test. Multiple group comparisons were per-
formed via χ
2
test. Grade material related analysis was performed via Spearman's rank. Survival
analysis were performed via Kaplan-Meier and log-rank test. Differences were considered sta-
tistically significant at p <0.05.
Results
SCF and HIF-1αare over-expressed in PDAC and their expression
levels predict poor outcome
To investigate the relationship between HIF-1αand SCF in PDAC, we examined their expres-
sion pattern in human pancreatic adenocarcinoma tissue. IHC was performed on serial sec-
tions of 95 PDAC samples. We observed that HIF-1αand SCF have higher expression in
cancer samples (Fig. 1A). The Spearman analysis showed that an obvious correlation exists be-
tween SCF and HIF-1α(r = 0.728, p<0.001: S1 Table). The SCF level was correlated with the
lymph node metastasis (r = 0.281, p<0.05: Table 1) and the pathological tumor node metastasis
(pTNM) stages (r = 0.353, p<0.05) in these cancer samples. The results showed that HIF-1αor
SCF higher-expression group had significantly lower survival rate than the HIF-1αor SCF
lower-expression group (p<0.05, respectively: Fig. 1B and C).
These results indicate that SCF and HIF-1αwere over-expressed in PDAC, and their expres-
sion levels can predict poor outcome.
Fig 1. HIF-1αand SCF expression in pancreatic adenocarcinoma tissue and the cumulative survival analysis. (A): The IHC results of HIF-lαand SCF.
SCF protein expression was significantly correlated with HIF-lα, as detected by immunohistochemical staining on PDAC. Left panels: various expression
levels of HIF-lαprotein. Right panels: expression of SCF protein of the same samples in the adjacent section. (B): The results of survivalanalysis on HIF-lα.
PDAC patients (n = 95) with high positive HIF-lαprotein expression had significantly worse total survival than those with low or medium positive expression.
(C): The results of survival analysis on SCF. The same PDAC patients (n = 95) with high positive SCF protein expression had significantly worse total survival
than those with low or medium positive expression.
doi:10.1371/journal.pone.0121338.g001
SCF Promotes Pancreatic Ductal Adenocarcinoma Cell Progression
PLOS ONE | DOI:10.1371/journal.pone.0121338 March 23, 2015 6/14
Expression of HIF-1αand SCF in pancreatic cancer cells under hypoxia
The relationship between SCF and HIF-1αwas further investigated under hypoxia in vitro.
The results revealed that two pancreatic cancer cell lines, PANC-1 and BxPC-3, expressed little
HIF-1αand SCF protein under normoxia, and their expressions were obviously increased after
hypoxia treatment, especially at 12 hrs (Fig. 2A and B). As a positive control, VEGF expression
increased correspondingly (data not show). This result indicates that hypoxia up-regulated the
HIF-1αand SCF protein expression in PANC-1 and BxPC-3 pancreatic cancer cell lines. To in-
vestigate whether HIF-1αregulate the expression of SCF, siRNA targeting HIF-1αwas used.
The two pancreatic cancer cell lines were transfected with siRNA targeting HIF-1αand cul-
tured under hypoxia (1% O
2
) for 12 hrs (defined as Hsi, the same below), and the two cell lines
only cultured under hypoxia (1% O
2
) for 12 hrs were used as the control sample (defined as
HC, the same below), as shown in Fig. 2C and D. After interference in PANC-1 and BxPC-3
cell lines, HIF-1αand SCF protein levels decreased evidently compared with those of control
groups. The results indicate that siRNA targeting of HIF-1αpartially or completely block the
expression of SCF under hypoxia. The SCF and HIF-1αmRNA expressions were then tested
via quantitative RT-PCR after hypoxia treatment or siRNA targeting HIF-1αtransfection cul-
ture. The results indicate that both mRNA levels of HIF-1αand SCF increased or decreased
with the same trend (Fig. 2E, F, G and H): In PANC-1 cells, compared with normoxia control,
HIF-1αexpression was increased for 8.1 fold and SCF was increased for 10.2 fold because of
hypoxia treatment, and in BxPC-3 cells, HIF-1αexpression was increased for 10.5 fold and
SCF was increased for 7.3 fold because of hypoxia treatment. After HIF-1αknockdown at hyp-
oxia environment in PANC-1 cells, HIF-1αexpression was reduced to 84% and SCF was re-
duced to 80%. In BxPC-3 cells, HIF-1αexpression was reduced to 78% and SCF was reduced to
81%. These results indicate that the up-regulation or suppression of SCF expression is directly
related on the regulation of HIF-lα.
Table 1. Correlations between clinicopathological features and SCF expression in PDAC.
SCF
Low Medium High r
s
p-values
Age
a
59 (36–79) 5.747
a
0.06
Tumor size (cm)
b
3.649±1.67 4.435±1.359 6.107±2.99 10.809
b
<0.001
Histological grade 0.073 0.48
G1 16 13 10
G2 9 6 6
G3 14 7 14
LN metastasis 0.281 0.006
N 0 22 11 7
N 1 17 15 23
pTNM stage 0.353 0
I,II 23 13 6
III 9 5 8
IV 7 8 16
*p-values were calculated by Spearman's Rank-Correlation test (n = 95)
Age
a
: Expressed as median (range), χ
2
= 5.747, p = 0.060 (kruskal-wallis test)
Tumor size (cm)
b
: Expressed as mean, F = 10.809, p<0.001 (anova test)
doi:10.1371/journal.pone.0121338.t001
SCF Promotes Pancreatic Ductal Adenocarcinoma Cell Progression
PLOS ONE | DOI:10.1371/journal.pone.0121338 March 23, 2015 7/14
HIF-1αdirectly binds to the SCF promoter and up-regulated the SCF
promoter activity
After the screening the 5’-flanking region of the SCF gene, we found a potential HIF-1 binding
site(-68 *-64)near the start site of transcription (Fig. 3A). To further investigate the relation-
ship between SCF and HIF-1αin PDAC cell lines and to validate the binding of HIF-lαto the
SCF promoter, an independent ChIP assay was performed after 12 hrs of hypoxia treatment.
The promoter fragment was specially co-immunoprecipitated by HIF-lαantibody but not the
negative controls (Fig. 3B). Furthermore, the SCF promoter region (-1163 to-955), which did
not contain HRE, cannot be pulled down by the HIF-1αantibody, thereby suggesting that
HIF-1αdirectly binds to the HRE region of the SCF promoter in vitro. To determine whether
Fig 2. Expression of HIF-1αand SCF protein and mRNA after different treatment. (A, B): Expression of HIF-1αand SCF protein after hypoxia treatment.
Two pancreatic cancer cell lines, PANC-1 and BxPC-3, were incubated under hypoxia at different time points (0, 3, 6, 12 hrs). Both of the protein expression
of HIF-1αand SCF were determined via Western blot. β-actin expression was used as the control. (C, D): Expression of HIF-1αand SCF protein after
transfected with siRNA targeting HIF-1α. The PANC-1 and BxPC-3 cancer cells were transfected with siRNA targeting HIF-1αfor 48 hrs and incubated under
hypoxia for 12 hrs. The protein expressions of HIF-1αand SCF were then determined via Western blot. (E, F, G, H): Expression of HIF-1αand SCF mRNA
after different treatments. After hypoxia treatment or interference of siRNA-HIF-1αtreatment in PANC-1 and BxPC-3 cancer cells, the mRNA expressions
were quantified via real-time PCR. Data from three experimental determinations and bars indicate the SD, p <0.05 vs. control.
doi:10.1371/journal.pone.0121338.g002
SCF Promotes Pancreatic Ductal Adenocarcinoma Cell Progression
PLOS ONE | DOI:10.1371/journal.pone.0121338 March 23, 2015 8/14
the binding of HIF-1αto the promoter can activate SCF, transient transfection and dual lucif-
erase assay was performed to detect the SCF promoter activity after HIF-1αover-expression.
The results show that the full-length SCF promoter activity (pGL3-SCF) was increased
12.8-fold after the over expression of HIF-1αcompared to that treated with plasmids alone,
but the mutation of SCF promoters (pGL3-SCFM) did not increase (p<0.05: Fig. 3C). Over-ex-
pression of HIF-1αwas increased 11.6-fold of the VEGF promoter activity compared to the
controls (p<0.05: Fig. 3C). Thus, HIF-1αdirectly transactivates SCF expression.
Influence of SCF on the biological behaviors of PDAC cell lines
To investigate the influence of SCF on the biological behaviors of PDAC cell lines, exogenous
SCF (150 ng/ml, the same below) or SCF neutralizing antibody (10 ng/ml, the same below) and
siRNA was used to increase or decrease the expression of SCF in PANC-1 cell lines. Colony for-
mation was used to detect cell proliferation ability and cell scratch or/and transwell chambers
experiments were used to detect cell invasion.
After applying the interference of exogenous SCF and SCF neutralizing antibody or siRNA
into PANC-1 cells, the proliferative ability in the interference groups significantly increased
and decreased compared with those of the control groups, respectively (p<0.05, respectively:
Fig. 4A and B). Similarly, after the interference of exogenous SCF and anti-SCF neutralizing
antibody, the scratch space at 12 hrs of PANC-1 cells was detected. The widths in the SCF or
anti-SCF groups were smaller or bigger than those in the NC or HC control group (p <0.05,
respectively: Fig. 4C). Moreover, after the interference of exogenous SCF and anti-SCF
Fig 3. HIF-1αdirectly binds to the HRE region of SCF promoter and up-regulates the activity. (A): The DNA sequence of the SCF promoter. A potential
HIF-1αbinding site is located at −68 to −64 near the start site of transcription. (B): Chromatin immunoprecipitation analysis. PANC-1 cells were cultured
under normoxia and hypoxia for 12 h and then analyzed. The PCR products of SCF promoter were only detected in the samples that were precipitated by
HIF-1αantibodies but not in control IgG samples. The SCF promoter region (-1163 to-955) that do not contain HRE (non-HRE) cannot be precipitated by HIF-
1αantibodies. (C): Dual luciferase results in different groups. After transfected with pcDNA3.1-HIF-1αplasmids (1 μg) with pGL3-SCF (1μg) or
(pGL3-SCF-M) (1μg), pGL3-VEGF was used as the positive control. After transfection incubation for 48 h and incubated under hypoxia for 12 hrs, the cells
were harvested for dual luciferase assay. The results showed that the full-length SCF promoter activity (pGL3-SCF) was increased for 12.8 fold after over
expression of HIF-1αcompared to that treated with plasmids alone, but the mutation of SCF promoters (pGL3-SCF-M) did not increase. Over-expression of
HIF-1αwas increased for 11.6 fold of the VEGF promoter activity compared to the controls.
doi:10.1371/journal.pone.0121338.g003
SCF Promotes Pancreatic Ductal Adenocarcinoma Cell Progression
PLOS ONE | DOI:10.1371/journal.pone.0121338 March 23, 2015 9/14
neutralizing antibody, the number of cells coming through the membrane was significantly
more and less than that of the control group, respectively (p<0.05, respectively: Fig. 4D).
HIF-1αpromote the development of PDAC by regulating SCF
The results described above pointed out a possibility that HIF-1a may promote PDAC progres-
sion by regulating SCF. We rescued the cell proliferation and invasion abilities by adding exog-
enous SCF when transfected with siRNA targeting HIF-1αat the same time (Fig. 5A). Colony
formation results showed that the decreased tumor cells growth rate following HIF-1αknock-
down can be rescued by the up-regulation of SCF (p<0.05, Fig. 5B). Similarly, both cell scratch
and transwell chambers results showed that the decreased tumor cell invasion rate following
HIF-1αknockdown can be rescued by adding exogenous SCF (p<0.05, respectively: Fig. 5C
and D).
Fig 4. Influence of SCF on the biological behavior of PDAC cell. (A) and (B): Colony formation results showed the SCF effect on cell proliferation. After
applying the interference of exogenous SCF or anti-SCF antibody in PANC-1 cells, the proliferative ability in the interference groups significantly increased or
decreased compared with those of the control groups (p<0.05, respectively). *stands for p<0.05 (mark group VS control group). (C): The scratch results
showed the SCF effect on cell invasion. After the interference of exogenous SCF and anti-SCFantibody, the widths in the SCF or anti-SCF groups were
smaller or bigger than those in the NC or HC control group (p <0.05, respectively). (D): The transwell chambers results showed the SCF effect on cell
invasion. After the interference of exogenous SCF or anti-SCF, the cell number through the membrane was significantly more or less than the control group
(p <0.05, respectively). *stands for p<0.05 (N+SCF group VS NC group), and # stands for p<0.05 (H +anti-SCF group VS HC group).
doi:10.1371/journal.pone.0121338.g004
SCF Promotes Pancreatic Ductal Adenocarcinoma Cell Progression
PLOS ONE | DOI:10.1371/journal.pone.0121338 March 23, 2015 10 / 14
Taken together, these results indicate that SCF, a downstream gene of HIF-1α, can promote
the development of PDAC in vitro.
Inhibiting effect of digoxin against PDAC in vivo
To determine whether HIF-1αregulate SCF expression in vivo, we injected PANC-1 cells sub-
cutaneously into the right flank of nude nu/nu mice. The results were as follows: compared
with the saline control group, the average tumor volume in digoxin group was reduced signifi-
cantly (p<0.05, Fig. 6A). Next, we evaluated the correlation between HIF-1αand SCF in the
mice tumors by IHC, and the results suggest that expression of SCF was decreased as a result of
the HIF-1αlevel reduction by digoxin (Fig. 6B). Treatment with digoxin resulted in no signifi-
cant difference in the body weight of treated mice, none of the tested mice manifested signs of
other adverse effects as specified in the method section, and no toxicity on the blood count or
hepatic and renal function was observed with digoxin treatment (data not shown). These re-
sults indicate the anti-tumor effect and safety of digoxin in vivo.
Fig 5. PDAC cells proliferation and invasion abilities can be rescued by up-regulation SCF followingHIF-1αknockdown. (A): The levels of HIF-1α
and SCF protein were tested via Western blot in different groups: The SCF protein level can be rescued by adding exogenous SCF when transfected with
siRNA targeting HIF-1αat the same time. (B): Colony formation results in different groups: the decreased tumor cells proliferation rate following HIF-1α
knockdown can be rescued by up-regulation of SCF (p<0.05, respectively). (C): The scratch results in different groups: the decreased tumor cells
proliferation rate following HIF-1αknockdown can be rescued by up-regulation of SCF (p<0.05, respectively). (D): Transwell chambers results in different
groups: the decreased tumor cells through the membrane following HIF-1αknockdown can be rescued by up-regulation of SCF (p<0.05, respectively). *
stands for p<0.05 (siRNA-HIF-1αgroup VS control group), and
#
stands for p<0.05 (siRNA-HIF-1α+SCF group VS siRNA-HIF-1αgroup).
doi:10.1371/journal.pone.0121338.g005
SCF Promotes Pancreatic Ductal Adenocarcinoma Cell Progression
PLOS ONE | DOI:10.1371/journal.pone.0121338 March 23, 2015 11 / 14
Discussion
In this report, we proved that HIF-1αand SCF were prognostic factors in PDAC by examining
the expression of SCF and HIF-1αin pancreatic cancer tissues and analyzing the clinical fea-
tures and prognosis. A strong correlation was observed between the expressions of these two
factors in primary PDAC tissues. We also found that HIF-1αpromoted the development of
PDAC by trans-activating SCF under hypoxia in vitro. Furthermore, SCF promoted PDAC cell
proliferation and invasion, and the decreased tumor cell proliferation and invasion abilities fol-
lowing HIF-1αknockdown can be rescued by the up-regulation of SCF under hypoxia. SCF
has been suggested as a direct target gene of HIF-1 in MCF-7 cells through in vitro analysis [5].
We extended this effect in pancreatic cancers with more consolidated evidence including clini-
cal data as well as in vitro and in vivo analysis, thereby suggesting that the regulatory role of
HIF-1 on SCF is general in cancer cells. Interestingly, we recently identified SCF as an indepen-
dent predictor for poor prognosis of patients with hepatocellular carcinoma [23]. In accor-
dance with this study, SCF expression was associated with a shorter survival rate in resected
patients. For those patients with high SCF expression, strengthened adjuvant therapy should
be given to achieve a better outcome. Another study reported that serum analysis of PDAC
also showed elevated levels of SCF in pretreated patients with pancreatic cancer [24], thereby
suggesting that SCF could also be used as a diagnostic marker for pancreatic cancer. Accumu-
lating evidences have confirmed that HIF-1 had crucial functions in the pathogenesis of pan-
creatic cancer. The present study further demonstrated that the proliferative and invasive effect
of HIF-1 was, at least in part, mediated by SCF. Previous studies have shown that SCF activated
the expression of HIF-1 in pancreatic cancer [11]. We postulate that a positive feedback loop
exists between SCF and HIF. The loop may function to maintain the constitutive expression of
HIF-1 under normoxia and strengthen the pathogenic effect of SCF under hypoxia.
SCF exerted its biological functions through binding to a specific ligand, c-kit. C-kit appears
in embryonic tissues of human beings but was silenced in adult tissues. Recent clinical evidence
showed that c-kit was negative in normal pancreatic tissues but is over-expressed in malignant
pancreatic tissues, including cancerous duct, exocrine pancreas and βcells of islet, thereby sug-
gesting that the SCF/c-kit pathway might be involved in the malignant transformation of pan-
creatic cells [25]. As shown in the present study, SCF mainly promoted invasion and
proliferation of pancreatic cancer cells. The hypoxia-induced SCF expression might further
Fig 6. Inhibiting effect of digoxin against PDAC in vivo. (A): The mice tumors’volume in different groups. After six weeks of treatment, digoxin therapy
decreased the tumors’volume, which was significantly smaller than those in the saline control group (p<0.05). (B): IHC results in different groups.
Additionally, the IHC results confirmed the effect of digoxin: Digoxin therapy decreased the HIF-lαand SCF positive tumor cells compared to the saline
control group, respectively.
doi:10.1371/journal.pone.0121338.g006
SCF Promotes Pancreatic Ductal Adenocarcinoma Cell Progression
PLOS ONE | DOI:10.1371/journal.pone.0121338 March 23, 2015 12 / 14
accelerate the progression of pancreatic cancer because hypoxia is a typical microenvironment
of pancreatic cancer. Another interesting function of SCF is to regulate the differentiation of
PANC-1 pancreatic cancer cells into insulin-producing cells. We postulate that hypoxia might
contribute to the maintenance of endocrine function of malignant pancreatic tissues through
SCF/c-kit pathway.
Based on the findings of this study, we suggest that the SCF/c-kit pathway may be a poten-
tial target for the treatment of pancreatic cancer. Thus far, several c-kit inhibitors such as Ima-
tinib and Sunitinib have been approved by FDA to the treatment of leukemia, renal cancer cell,
and gastrointestinal stromal tumors [26]. Further clinical trial should be performed to use
these reagents, alone or in combination with gemcitabine, as new strategies for the treatment of
pancreatic cancer.
In conclusion, we identified SCF as a direct target of HIF-1 in pancreatic cancer. SCF/c-kit
promoted invasion and proliferation of pancreatic cancer cells and may be a new target for the
treatment of pancreatic cancer.
Supporting Information
S1 Table. Correlations between HIF-1αand SCF expression in pancreatic cancer. Statistical
analysis of immunohistochemical results of HIF-1αand SCF expression in human PDAC sur-
gical samples. p values were analyzed by Spearman’s rank-correlation test.
(DOC)
Author Contributions
Conceived and designed the experiments: CG SL TZ JC HR JH. Performed the experiments:
CG SL TZ JC HR HZ XW ML. Analyzed the data: CG SL TZ JC HR HZ XW ML JL SG XZ JS
ZY JH. Contributed reagents/materials/analysis tools: CG SL TZ JC HR HZ XW ML JL SG XZ
JS ZY JH. Wrote the paper: CG SL TZ JC HR ML JH.
References
1. Siegel R, Naishadham D, Jemal A. Cancer statistics, 2013. CA Cancer J Clin. 2013; 63:11–30. doi: 10.
3322/caac.21166 PMID: 23335087
2. Gu Y, Runyan C, Shoemaker A, Surani MA, Wylie C. Membrane-bound steel factor maintains a high
local concentration for mouse primordial germ cell motility, and defines the region of their migration.
PloS one. 2011; 6:e25984. doi: 10.1371/journal.pone.0025984 PMID: 21998739
3. Bai CG, Hou XW, Wang F, Qiu C, Zhu Y, Huang L, et al. Stem cell factor-mediated wild-type KIT recep-
tor activation is critical for gastrointestinal stromal tumor cell growth. World journal of gastroenterology:
WJG. 2012; 18:2929–2937. doi: 10.3748/wjg.v18.i23.2929 PMID: 22736916
4. Talaiezadeh A, Jazayeri SN, Nateghi J. Expression of c-kit protein in cancer vs. normal breast tissue.
Contemporary oncology. 2012; 16:306–309. doi: 10.5114/wo.2012.30058 PMID: 23788899
5. Han ZB, Ren H, Zhao H, Chi Y, Chen K, Zhou B, et al. Hypoxia-inducible factor (HIF)-1 alpha directly
enhances the transcriptional activity of stem cell factor (SCF) in response to hypoxia and epidermal
growth factor (EGF). Carcinogenesis. 2008; 29:1853–1861. doi: 10.1093/carcin/bgn066 PMID:
18339685
6. Pedersen M, Lofstedt T, Sun J, Holmquist-Mengelbier L, Pahlman S, Ronnstrand L. Stem cell factor in-
duces HIF-1alpha at normoxia in hematopoietic cells. Biochemical and biophysical research communi-
cations. 2008; 377:98–103. doi: 10.1016/j.bbrc.2008.09.102 PMID: 18834862
7. Gibbs BF, Yasinska IM, Oniku AE, Sumbayev VV. Effects of stem cell factor on hypoxia-inducible factor
1 alpha accumulation in human acute myeloid leukaemia and LAD2 mast cells. PloS one. 2011; 6:
e22502. doi: 10.1371/journal.pone.0022502 PMID: 21799876
8. Arko L, Katsyv I, Park GE, Luan WP, Park JK. Experimental approaches for the treatment of malignant
gliomas. Pharmacology & therapeutics. 2010; 128:1–36.
SCF Promotes Pancreatic Ductal Adenocarcinoma Cell Progression
PLOS ONE | DOI:10.1371/journal.pone.0121338 March 23, 2015 13 / 14
9. Heissig B, Werb Z, Rafii S, Hattori K. Role of c-kit/Kit ligand signaling in regulating vasculogenesis.
Thrombosis and haemostasis. 2003; 90:570–576. PMID: 14515175
10. Lennartsson J, Jelacic T, Linnekin D, Shivakrupa R. Normal and oncogenic forms of the receptor tyro-
sine kinase kit. Stem cells. 2005; 23:16–43. PMID: 15625120
11. Zhang M, Ma Q, Hu H, Zhang D, Li J, Ma G, et al. Stem cell factor/c-kit signaling enhancesinvasion of
pancreatic cancer cells via HIF-1alpha under normoxic condition. Cancer letters. 2011; 303:108–117.
doi: 10.1016/j.canlet.2011.01.017 PMID: 21320746
12. Nogueira V, Park Y, Chen CC, Xu PZ, Chen ML, Tonic I, et al. Akt determines replicative senescence
and oxidative or oncogenic premature senescence and sensitizes cells to oxidative apoptosis. Cancer
cell. 2008; 14:458–470. doi: 10.1016/j.ccr.2008.11.003 PMID: 19061837
13. Krock BL, Skuli N, Simon MC. Hypoxia-induced angiogenesis: good and evil. Genes & cancer. 2011;
2:1117–1133.
14. Miyake K, Yoshizumi T, Imura S, Sugimoto K, Batmunkh E, Kanemura H, et al. Expression of hypoxia-
inducible factor-1alpha, histone deacetylase 1, and metastasis-associated protein 1 in pancreaticcarci-
noma: correlation with poor prognosis with possible regulation. Pancreas. 2008; 36:e1–9. doi: 10.1097/
MPA.0b013e3181675010 PMID: 18437073
15. Zhu Z, Wang Y, Liu Z, Wang F, Zhao Q. Inhibitory effects of epigallocatechin-3-gallate on cell prolifera-
tion and the expression of HIF-1alpha and P-gp in the human pancreatic carcinoma cell line PANC-1.
Oncology reports. 2012; 27:1567–1572. doi: 10.3892/or.2012.1697 PMID: 22367292
16. Miyake K, Nishioka M, Imura S, Batmunkh E, Uto Y, Nagasawa H, et al. The novel hypoxic cytotoxin,
TX-2098 has antitumor effect in pancreatic cancer; possible mechanism through inhibiting VEGF and
hypoxia inducible factor-1alpha targeted gene expression. Experimental cell research. 2012;
318:1554–1563. doi: 10.1016/j.yexcr.2012.03.013 PMID: 22472348
17. Knaup KX, Jozefowski K, Schmidt R, Bernhardt WM, Weidemann A, Juergensen JS, et al. Mutual regu-
lation of hypoxia-inducible factor and mammalian target of rapamycin as a function of oxygen availabili-
ty. Molecular cancer research: MCR. 2009; 7:88–98. doi: 10.1158/1541-7786.MCR-08-0288 PMID:
19147540
18. Seenath MM, Roberts D, Cawthorne C, Saunders MP, Armstrong GR, O'Dwyer ST, et al. Reciprocal re-
lationship between expression of hypoxia inducible factor 1alpha (HIF-1alpha) and the pro-apoptotic
protein bid in ex vivo colorectal cancer. British journal of cancer. 2008; 99:459–463. doi: 10.1038/sj.bjc.
6604474 PMID: 18648372
19. Hoffmann AC, Mori R, Vallbohmer D, Brabender J, Klein E, Drebber U, et al. High expression of HIF1a
is a predictor of clinical outcome in patients with pancreatic ductal adenocarcinomas and correlated to
PDGFA, VEGF, and bFGF. Neoplasia. 2008; 10:674–679. PMID: 18592007
20. Chaturvedi P, Gilkes DM, Wong CC, Kshitiz, Luo W, Zhang H, et al. Hypoxia-inducible factor-depen-
dent breast cancer-mesenchymal stem cell bidirectional signaling promotes metastasis. The Journal of
clinical investigation. 2013; 123:189–205. doi: 10.1172/JCI64993 PMID: 23318994
21. Fujisawa T, Joshi BH, Puri RK. Histone modification enhances the effectiveness of IL-13 receptor tar-
geted immunotoxin in murine models of human pancreatic cancer. Journal of translational medicine.
2011; 9:37. doi: 10.1186/1479-5876-9-37 PMID: 21477288
22. Zhang H, Wong CC, Wei H, Gilkes DM, Korangath P, Chaturvedi P, et al. HIF-1-dependent expression
of angiopoietin-like 4 and L1CAM mediates vascular metastasis of hypoxic breast cancer cells to the
lungs. Oncogene. 2012; 31:1757–1770. doi: 10.1038/onc.2011.365 PMID: 21860410
23. Wang X, Ren H, Zhao T, Chen J, Sun W, Sun Y, et al. Stem cell factor is a novel independent prognos-
tic biomarker for hepatocellular carcinoma after curative resection. Carcinogenesis. 2014; 35:2283–
2290. doi: 10.1093/carcin/bgu162 PMID: 25086759
24. Torres C, Perales S, Alejandre MJ, Iglesias J, Palomino RJ, Martin M, et al. Serum cytokine profile in
patients with pancreatic cancer. Pancreas. 2014; 43:1042–1049. doi: 10.1097/MPA.
0000000000000155 PMID: 24979617
25. Amsterdam A, Raanan C, Polin N, Melzer E, Givol D, Schreiber L. Modulation of c-kit expression in pan-
creatic adenocarcinoma: a novel stem cell marker responsible for the progression of the disease.Acta
histochemica. 2014; 116:197–203. doi: 10.1016/j.acthis.2013.07.002 PMID: 23978330
26. Schallier D, Trullemans F, Fontaine C, Decoster L, De Greve J. Tyrosine kinase inhibitor-induced mac-
rocytosis. Anticancer research. 2009; 29:5225–5228. PMID: 20044640
SCF Promotes Pancreatic Ductal Adenocarcinoma Cell Progression
PLOS ONE | DOI:10.1371/journal.pone.0121338 March 23, 2015 14 / 14
