PreprintPDF Available

Targeted genome editing restores auditory function in adult mice with progressive hearing loss caused by a human microRNA mutation

October 2023

October 2023

DOI:10.1101/2023.10.26.564008

Authors:

Wenliang Zhu

Massachusetts Eye and Ear Infirmary

Show all 12 authorsHide

Preprints and early-stage research may not have been peer reviewed yet.

Mutations in microRNA-96 (MIR96) cause dominant delayed onset hearing loss DFNA50 without treatment. Genome editing has shown efficacy in hearing recovery by intervention in neonatal mice, yet editing in the adult inner ear is necessary for clinical applications. Here, we developed an editing therapy for a C>A point mutation in the seed region of the Mir96 gene, Mir9614C>A associated with hearing loss by screening gRNAs for genome editors and optimizing Cas9 and sgRNA scaffold for efficient and specific mutation editing in vitro. By AAV delivery in pre-symptomatic (3-week-old) and symptomatic (6-week-old) adult Mir9614C>A mutant mice, hair cell on-target editing significantly improved hearing long-term, with an efficacy inversely correlated with injection age. We achieved transient Cas9 expression without the evidence of AAV genomic integration to significantly reduce the safety concerns associated with editing. We developed an AAV-sgmiR96-master system capable of targeting all known human MIR96 mutations. As mouse and human MIR96 sequences share 100% homology, our approach and sgRNA selection for efficient and specific hair cell editing for long-term hearing recovery lays the foundation for future treatment of DFNA50 caused by MIR96 mutations.

Content uploaded by Wenliang Zhu

Content may be subject to copyright.

Targeted genome editing restores auditory function in adult mice with 1

progressive hearing loss caused by a human microRNA mutation 2

Wenliang Zhu1,2,8, Wan Du1,2,8, Arun Prabhu Rameshbabu1,2, Ariel Miura Armstrong1,2, 4

Stewart Silver1,2, Yehree Kim1,2, Wei Wei1,2, Yilai Shu3,4,5, Xuezhong Liu6, Morag A 5

Lewis7, Karen P. Steel7, Zheng-Yi Chen1, 2 * 6

1 Department of Otolaryngology-Head and Neck Surgery, Graduate Program in Speech 8

and Hearing Bioscience and Technology and Program in Neuroscience, Harvard 9

Medical School, Boston, USA. 10

2 Eaton-Peabody Laboratory, Massachusetts Eye and Ear Infirmary, Boston, USA. 11

3 ENT Institute and Otorhinolaryngology Department of Eye & ENT Hospital, State Key 12

Laboratory of Medical Neurobiology and MOE Frontiers Center for Brain Science, 13

Fudan University, Shanghai, 200031, China. 14

4 Institutes of Biomedical Science, Fudan University, Shanghai, 200032, China. 15

5 NHC Key Laboratory of Hearing Medicine, Fudan University, Shanghai, 200031, 16

China. 17

6 Department of Otolaryngology, University of Miami School of Medicine, Miami, FL, 18

33136, USA. 19

7 Wolfson Sensory, Pain and Regeneration Centre, King’s College London, London, UK. 20

8 These authors contributed equally: Wenliang Zhu, Wan Du 21

* Corresponding author. Email: zheng-yi_chen@meei.harvard.edu (Z.C.) 22

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

Abstract 23

Mutations in microRNA-96 (MIR96) cause dominant delayed onset hearing loss 25

DFNA50 without treatment. Genome editing has shown efficacy in hearing recovery by 26

intervention in neonatal mice, yet editing in the adult inner ear is necessary for clinical 27

applications. Here, we developed an editing therapy for a C>A point mutation in the 28

seed region of the Mir96 gene, Mir9614C>A associated with hearing loss by screening 29

gRNAs for genome editors and optimizing Cas9 and sgRNA scaffold for efficient and 30

specific mutation editing in vitro. By AAV delivery in pre-symptomatic (3-week-old) and 31

symptomatic (6-week-old) adult Mir9614C>A mutant mice, hair cell on-target editing 32

significantly improved hearing long-term, with an efficacy inversely correlated with 33

injection age. We achieved transient Cas9 expression without the evidence of AAV 34

genomic integration to significantly reduce the safety concerns associated with editing. 35

We developed an AAV-sgmiR96-master system capable of targeting all known human 36

MIR96 mutations. As mouse and human MIR96 sequences share 100% homology, our 37

approach and sgRNA selection for efficient and specific hair cell editing for long-term 38

hearing recovery lays the foundation for future treatment of DFNA50 caused by MIR96 39

mutations. 40

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

INTRODUCTION 41

Hearing loss is a multi-factorial condition affecting a significant portion of the global 43

population (World Health Organization, http://www.who.int/en/). Single genetic 44

mutations causing hearing loss account for more than 50% of all congenital 45

sensorineural hearing loss (SNHL)1, yet no pharmaceutical drug or biological treatment 46

is available to slow down or reverse genetic deafness2-4. Among these deafness genes, 47

microRNAs (miRNAs), which are short (~20–24nt) endogenous non-coding RNAs that 48

play a crucial role in the regulation of the expression of protein-coding genes, are 49

considered important factors in the development of the inner ear and are required for 50

normal hearing5,6. Specifically, mutations in MIR96 (microRNA-96; miR-96) have been 51

identified as causative factors for non-syndromic progressive hearing loss DFNA50 in 52

humans and mice7-11. This mutation in the seed region of the human MIR96 is the first 53

example of point mutations in the mature sequence of a miRNA with an etiopathogenic 54

role in a human Mendelian disease6,11,12. 55

MIR96 is specifically expressed in the sensory cells of the inner ear13 and plays a critical 56

role in cochlear development and the maintenance of hearing by reducing expression of 57

the mRNAs of multiple target genes8,14-16. Point mutations in the seed region of MIR96 58

lead to late onset progressive hearing loss with dominant inheritance patterns in human 59

families10,11. Mice carrying an ENU-induced mutation, diminuendo (Dmdo), exhibit the 60

phenotype of progressive hearing loss17. Homozygous Dmdo mice (Mir96Dmdo/Dmdo) and 61

homozygous null mice (knockout of both Mir96 and Mir183, Mir96dko/dko) are completely 62

deaf, displaying abnormal hair cell stereocilia bundles and early-onset reduced hair cell 63

numbers, demonstrating the requirement for Mir96 in normal hair cell developmental8,18. 64

In contrast, heterozygous Mir96 null mice (Mir96/dko-) maintain normal hearing, while 65

heterozygous Dmdo mice (Mir96Dmdo/+ ) develop adult-onset non-syndromic progressive 66

hearing loss, suggesting that the hearing loss phenotype arises from the gain of novel 67

target genes rather than loss of function18. In humans, heterozygous MIR96 mutations 68

also result in late onset non-syndromic progressive hearing loss, suggesting a similar 69

gain of function due to the mutation. Delayed onset and progressive hearing loss offers 70

a window of opportunity for intervention for hearing rescue. 71

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

In addition to its dominant inheritance pattern, overexpression of Mir96 has been found 72

to cause cochlear defects leading to hearing loss, rendering traditional gene therapy via 73

ectopic Mir96 expression unsuitable9. However, genome editing technologies that target 74

the dominant MIR96 mutations hold great promise to treat DFNA50. In vivo Cas9 75

nuclease delivery has demonstrated effectiveness in disrupting dominant alleles in 76

multiple hearing loss disease models, including Lipofectamine RNP delivery19,20 or 77

adeno-associated virus (AAV)-mediated delivery21-26. Inner ear base editing has also 78

been employed to repair a Tmc1 dominant mutation in mice27. In all the editing studies 79

of genetic hearing loss, the interventions were done in neonatal mice with an immature 80

cochlea28. In contrast, newborn human inner ears are fully developed29. The mouse 81

cochlea undergoes significant developmental changes from the neonatal to adult 82

stages, including changes in size, structure, and function28. This distinction highlights 83

the need to evaluate the efficacy, safety, and time window of genome editing treatment 84

in the mature cochlea to establish the feasibility of intervention for potential clinical 85

applications. 86

In this study, we performed editing by NHEJ to target a dominant Mir96 mutation 87

(Mir96tm3.1Wtsi, referred to as Mir9614C>A in this report; equivalent of human rs587776523, 88

g.7:129414596G>T in GRCh38) by AAV-mediated adult delivery in mice with hearing 89

loss. We showed that AAV-mediated adult delivery of the editing complex was well-90

tolerated without impairing normal hearing. We screened sgRNAs for different editors 91

and identified one for KKH-saCas9 for further modification, resulting in efficient and 92

specific editing in vitro and in vivo. We tested interventions before and after the onset of 93

hearing loss and established a time window when the treatment results in sustained and 94

significant hearing preservation. To improve the safety profile of the editing strategy, we 95

established the dosing without detectable AAV integrations and showed the lack of 96

KKH-saCas9 expression 12 weeks post injection. As human and mouse Mir96 share 97

100% sequences in the seed region, we developed a dual AAV system capable of 98

targeting multiple human MIR96 mutations. We successfully demonstrated the 99

efficiency and specificity of this dual AAV system in MIR96 mutant human cell lines, 100

providing evidence for its potential generalization and broad utility. In conclusion, our 101

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

study establishes the feasibility of in vivo genome editing as a viable approach for 102

treating hearing loss caused by genetic mutations in adult animals. 103

104

RESULTS 105

106

A human microRNA-96 mutation Mir9614C>A causes dominant adult-onset 107

progressive hearing loss in mice. MiR-96 is highly expressed in mammalian sensory 108

cells, including the inner ear, retina, and dorsal root ganglia, and functions as a master 109

regulator controlling expression of many genes8,17. Mir96 is super conserved across 110

vertebrates, from zebrafish to humans, with the nucleotides within the Mir96 seed region 111

showing 100% identity in DNA sequence (Fig.1a). 112

Two mutations in the seed region, +13G >A (rs587776522) and +14C >A 113

(rs587776523), have been identified as the cause of autosomal dominant non-114

syndromic progressive hearing loss DFNA5011. Our mouse model carries the Mir9614C>A 115

mutation, which substitutes the fourteenth nucleotide of cytosine in the conserved seed 116

region with adenine30 (Fig.1a, b). To evaluate how hearing is affected by the mutation, 117

we performed auditory brain stem response (ABR) and distortion product otoacoustic 118

emission (DPOAE) tests on Mir9614C>A mice (Fig. 1c-h). Mir9614C>A/14C>A mice exhibited 119

complete hearing loss across all frequencies and age groups by ABR and DPOAE at 4 120

weeks of age (Fig. 1c, f). Mir9614C>A/+ mice at 4 weeks of age, we observed a 30 dB 121

elevation in ABR and a 19 dB elevation in DPOAE at the frequency of 32 kHz but no 122

significant changes in ABR/DPOAE thresholds at other frequencies compared to wild-123

type (WT) ears (Fig. 1c, f), indicating the onset of hearing loss starting at 4 weeks at 32 124

kHz. By 8 weeks, the ABR thresholds were significantly elevated from 16 to 32 kHz, 125

with an average increase of 20 dB in Mir9614C>A/+ ears compared to WT ears. Similarly, 126

DPOAE thresholds were significantly elevated by an average of 16 dB from 11.3 to 22.6 127

kHz frequencies Mir9614C>A/+ ears compared to WT ears (Fig. 1g). At 12 weeks, the 128

hearing loss became more severe, as ABR thresholds were significantly elevated 129

across all frequencies when compared to WT ears, with an average elevation of 15 dB. 130

Additionally, DPOAE thresholds were significantly elevated 15 dB on average compared 131

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

to WT ears, particularly at 11.3 and 16 kHz (Fig. 1h). These results showed that 132

Mir9614C>A/+ mice exhibit adult-onset hearing loss starting at 4 weeks at the high 133

frequency of 32kHz, which becomes progressive with further elevation of ABR/DPOAE 134

thresholds at 8 and 12 weeks across other frequencies. 135

136

Screening of genome editing systems in mouse and human cells. To specifically 137

disrupt the Mir9614C>A allele, sgRNAs were designed to target the allele for each of five 138

types of CRISPR nucleases: spCas931, scCas9++32, KKH-saCas933, sauriCas934, LZ3 139

Cas935 (Fig. 2a). All Cas9/sgRNA combinations were in the same pMAX-Cas9/sgRNA 140

backbone with three nuclear localization signals (NLSs) to ensure consistency in 141

plasmid structure (Fig. 2b and Extended Data Fig. 1a). Using primary Mir9614C>A/+ 142

fibroblasts, spCas9/sgRNA-1 exhibited the highest editing efficiency (14.3± 2.3%) (Fig. 143

2c, d). LZ3 Cas9/sgRNA-1 and KKH-saCas9/sgRNA-4 also showed comparable editing 144

efficiency (12.7± 2.0% and 10.1± 2.1%), while scCas9++/sgRNA-1, scCas9++/sgRNA-2 145

and sauriCas9/sgRNA-4 displayed modest indel frequency (Fig. 2c, d). spCas9/sgRNA-146

1 and KKH-saCas9/sgRNA-4 exhibited high specificity in targeting the Mir9614C>A allele, 147

shown by next generation sequencing (NGS) analysis that all the indels occurred 148

exclusively at the mutant allele and were undetectable in Mir96+/+ cells (less than 149

0.03%) (Fig. 2d-f and Extended Data Fig. 1b). We compared the editing efficiency of 150

Cas9/sgRNA ribonucleoprotein (RNP) and plasmids in primary fibroblasts of Mir9614C>A/+ 151

mice. RNP nucleofection yielded the highest editing efficiency, while lipofectamine-152

mediated RNP delivery was less efficient (Extended Data Fig. 1c). The AAV systems 153

with spCas9/sgRNA1 dual AAV plasmids (7.3± 1.5%) and KKH-saCas9/sgRNA4 (10.4± 154

1.8%) single AAV plasmid exhibited editing frequencies comparable to the pMAX-Cas9 155

plasmid transfection (14.3± 2.3%) (Extended Data Fig. 1c). 156

Due to 100% homology in the Mir96 seed region across species, the sgRNAs design 157

targeting the Mir9614C>A allele in mice can be used in the human MIR96 with the same 158

mutation. To validate the editing systems in human cells, we generated human and 159

mouse cell lines carrying the Mir9614C>A mutation using the PiggyBac transposon 160

system (Fig. 2g). In cells transfected with spCas9/sgRNA-1 and KKH-saCas9/sgRNA-4, 161

NGS analysis showed a high level of indel formation in both human and mouse Mir96 162

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

+14C>A cell lines, where negligible indels were observed in the Mir96 wild-type cell 163

lines (Fig. 2h). The indel profile showed various types of indels for spCas9/sgRNA-1 164

and KKH-saCas9/sgRNA-4, with single nucleotide deletions (-1 and +1) being the most 165

common type for spCas9/sgRNA-1, and a six-nucleotide deletion being the most 166

common for KKH-saCas9/sgRNA-4 (Fig. 2i, j). 167

In addition to disrupting the mutated allele with CRISPR nucleases, we also attempted 168

to correct the Mir9614C>A mutation using prime editing36-38(Extended Data Fig. 2a). We 169

designed a pegRNA located upstream of the mutate nucleotide, containing pegRNA-170

extensions with 13 bp primer binding sites (PBSs) and 16 bp RT-templates harboring 171

the corrected sequence (Extended Data Fig. 2b). We transfected HEI-OC1 cells 172

carrying the Mir96 +14C>A mutation with plasmids encoding primer editors and 173

pegRNA. NGS analysis showed that prime editing successfully corrected the mutation 174

in Mir9614C>A cells with an efficiency of 2.8±1.4% (Extended Data Fig. 2c, d). However, 175

due to the modest efficiency of prime editing at this locus and the lack of an efficient in 176

vivo delivery system for the inner ear, CRISPR nuclease-mediated knock-out of the 177

mutated allele is a more suitable choice for treating hearing loss caused by the Mir96 178

mutation. 179

180

Optimization of CRISPR/sgRNA delivery system for mature cochlea in adult mice. 181

We chose AAV serotype 2 (AAV2), which has demonstrated high efficiency and 182

specificity in transducing both mature inner hair cells (IHCs) and outer hair cells (OHCs) 183

compared to other AAV serotypes39,40, making AAV2 an excellent candidate vehicle for 184

delivering Cas9/sgRNA to hair cells. To further assess the delivery efficiency of AAV2, 185

we initially delivered AAV2 carrying a GFP cassette into the adult cochlea through round 186

window membrane and canal fenestration (RWM+CF) injection in 18-week-old mice 187

(Extended Data Fig. 3a). Four weeks after injection, robust GFP expression was 188

observed in nearly all IHCs throughout the cochlear turns and robust OHC transduction 189

with an apex-to-base gradient (Extended Data Fig. 3a-d). Importantly, the majority of 190

GFP-positive cells were hair cells, with only limited GFP+ cells observed in other cell 191

types, including supporting cells, indicating that AAV2 specifically and efficiently targets 192

auditory hair cells in adult mice. 193

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

To maximize editing efficiency in vivo to improve hearing rescue, we modified AAV 194

Cas9/sgRNA construction by incorporating a bipartite nuclear localization signal 195

(bpNLS), an sv40 NLS at the N-termini, and another bpNLS at the C-termini (Fig. 3a) to 196

enhance nuclear import and their access to genomic DNA41,42. The KKH-saCas9 197

sgRNAs were optimized by using an 84 nt sgRNA (crRNA-tracrRNA duplex extension) 198

which exhibits higher activity than the canonical full length sgRNA33. Additionally, we 199

introduced a 3rd A-U flip in the stem loop to remove a putative RNA Pol III terminator 200

sequence (4 consecutive U’s), further enhancing expression levels under the U6 201

promoter43 (Fig. 3b, c). The optimized construct was tested in the primary fibroblasts 202

derived from Ai14 mice, which contain “CAG-STOP-tdTomato” cassette44. In the cells 203

transfected with the optimized KKH-saCas9/sgRNA constructs, an increase in editing 204

efficiency of approximately 3.05-fold and 1.98-fold was detected for KKH-saCas9/sgtdT-205

1 and KKH-saCas9/sgtdT-2 compared to the original designs, respectively, shown by 206

the tdT+ cells (Fig. 3d, e). The editing efficiency was also evaluated in HEK-GFP cells 207

using KKH-Cas9/sgGFP targeting GFP, and the ratio of GFP-negative cells showed 208

significantly higher efficiency when using the optimized AAV constructions compared to 209

the original design (Extended Data Fig. 3e, f). The optimized AAV plasmid design and 210

gRNA modifications were used for the production of AAV-KKH-saCas9/sgRNA-4 for the 211

in vivo editing study. 212

213

In vivo genome editing of Mir9614C>A allele in mature cochlea. KKH-saCas9/sgRNA-214

4 was packaged into AAV2 (Fig. 4a) and delivered to adult Mir9614C>A/+ cochlea (6 215

weeks old) via round window membrane and canal fenestration (RWM+CF) injection at 216

a dose of 6×109 vg (Fig. 4a). Cochleae were collected 4- and 8-weeks post-injection for 217

NGS (Fig. 4b). In vivo NGS of cochlear tissue detected the presence of indels at the 218

Mir96 mutant locus in the injected ear at 4 and 8 weeks, while no indels were detected 219

in the contralateral uninjected ears (Fig. 4c, d and Extended Data Fig. 4a-c). 220

Importantly, AAV2-KHH-SaCas9-sgRNA-4 specifically edited the Mir9614C>A allele, as 221

no indels were observed in AAV2-KKH-saCas9/sgRNA-4 treated wild-type (WT) mice or 222

AAV2-KKH-saCas9/sgCtrl treated Mir9614C>A/+ mice (Fig. 4d and Extended Data Fig. 4a-223

c). After 8 weeks of injection, the indel rate was determined to be 0.76 ± 0.13%, slightly 224

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

higher than the rate observed 1 month after injection (0.63 ± 0.14%) (Fig. 4d). However, 225

the indel frequency from organ of Corti samples does not accurately reflect the editing 226

efficiency in hair cells, which constitutes less than 5% of cochlear cells. 227

To obtain a precise measurement of editing efficiency in hair cells, we performed 228

injection and assessed isolated hair cells after labeling hair cells with the FM1-43 229

uptake assay for NGS assay. FM1-43 and its fixable analog FM1-43FX can specifically 230

label hair cells by passing through open mechanotransduction channels45,46 (Extended 231

Data Fig. 4d). The labeled cells were hand-picked under an inverted fluorescent 232

microscope, lysed, with DNA extracted for PCR and NGS to study indels (Fig. 4e). 233

Indel-containing Mir96 sequencing reads from injected Mir9614C>A/+ mice allowed us to 234

directly assess the allele specificity of Mir9614C>A allele in vivo. Robust indel formation 235

was observed in isolated hair cells from injected animals 8 weeks after treatment, with 236

an indel frequency of 16.3-25.73% in the Mir9614C>A allele and a wider range of indel 237

types including -2bp, -4bp, +1bp, -1bp, compared to the indels observed in cochlear 238

samples (Fig. 4f, g), indicating efficient targeted genome editing in hair cells. From three 239

independent experiments, the ratio of Mir96 wild-type allele reads to Mir9614C>A allele 240

reads was analyzed based on NGS results after editing. In the injected ear, the ratio 241

between the Mir9614C>A allele that combined unedited with indel-containing reads and 242

that of Mir96 wild-type reads was 52.3%:47.7% (Fig. 4h), similar to that observed in 243

uninjected ears (Extended Data Fig. 4e), indicating no noticeable chromatin lesion, 244

insertion or large deletions caused by genome editing. 245

246

In vivo genome editing improved short- and long-term hearing preservation. We 247

injected AAV2-KKH-saCas9-sgRNA-4 into the cochlea of 6-week-old (P40-P45) 248

Mir9614C>A/+ mice through the round window membrane (RWM) with canal fenestration, 249

with the contralateral uninjected ears serving as controls. 10 weeks after the injection, at 250

16 weeks of age, the injected ears showed overall lower auditory brainstem response 251

(ABR) thresholds compared to the uninjected control ears, at frequencies from 5.6 to 16 252

kHz (Fig. 5b). The ABR threshold reduction ranged from 12 dB at 5.6 kHz to 18 dB at 16 253

kHz for frequencies below 22.6 kHz, with an average reduction of 13 dB. Additionally, 254

lower distortion product otoacoustic emission (DPOAE) thresholds were observed in the 255

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

injected ears compared to the control ears at frequencies of 11.3 and 16 kHz, with 256

reductions of 14 dB to 21 dB, respectively (Fig. 5c). 257

To assess long-term auditory function following hair cell-targeted genome editing, 258

hearing tests were conducted over an extended period. 14 weeks after injection (i.e., 20 259

weeks of age), significantly lower ABR thresholds were detected in injected ears 260

compared to the uninjected control ears at frequencies of 5.6, 8, 11.3, and 16 kHz, with 261

an average reduction of 21 dB in ABR thresholds. At the frequencies of 8 and 11.3 kHz, 262

the reduction is 21 and 26 dB, respectively (Fig. 5d). Significant reductions in DPOAE 263

thresholds were observed in the injected ears compared to the uninjected control ears 264

at the frequencies of 11.3 and 16 kHz, with reductions at 15 dB and 19 dB, respectively 265

(Fig. 5e). 20 weeks post injection (26 weeks age), more dramatic lower ABR thresholds 266

were detected in the injected ears compared to the uninjected control ears from 5.6 to 267

16 kHz, with an average reduction of 28 dB in ABT thresholds (Fig. 5f). For the 268

frequencies of 5.6 and 8 kHz, the ABR thresholds were reduced by 33 dB and 34 dB, 269

respectively. Similarly, dramatic lower DPOAE thresholds were detected in injected ears 270

compared with uninjected control ears at frequencies of 11.3 and 16 kHz, with 271

reductions of 27 dB and 7 dB at respectively (Fig. 5g). Representative ABR waveforms 272

recorded from an AAV2-KKH-saCas9-sgRNA-4 injected ear (Fig. 5h-j) and the 273

contralateral uninjected ear (Fig. 5i-k) 14 weeks post injection using 11.3 kHz (Fig. 5h-i) 274

and 16 kHz (Fir. 5j-k) tone bursts at incrementally increasing sound pressure levels 275

(SPLs) from 20 to 100 dB (Fig. 5h-k) further illustrated the improved hearing 276

preservation. Collectively, these results demonstrate that AAV2-mediated genome 277

editing effectively abolished the expression of the mutant Mir96, leading to improved 278

short- and long-term hearing preservation. 279

Delayed onset progressive hearing loss caused by MIR96 mutations offers a window of 280

opportunity for intervention. To determine the optimal time window for genome editing 281

treatment in Mir9614C>A/+ mice, we further performed AAV2-KKH-saCas9-sgRNA-4 282

injections in 3-week-old mice in which initial hearing loss was detected only at the high 283

frequency and in 16-week-old mice in which severe hearing loss was detected in all 284

frequencies (Fig. 1c, f; Extended Data Fig. 5a). For 3-week-old injection, significantly 285

lower ABR thresholds were detected 13 weeks post injection in AAV2-KKH-saCas9-286

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

sgRNA-4 treated ears compared to the untreated control ears, with an average ABR 287

threshold reduction of 19 dB from 5.6 to 16 kHz (Extended Data Fig. 5b). A lower ABR 288

threshold of 8 dB was seen at 22.6 kHz although the reduction is not statistically 289

significant. The average ABR threshold reduction in 3-week-old Mir9614C>A/+ mouse 290

injection was greater than that in 6-week-old Mir9614C>A/+ mouse injection, 19 dB vs. 13 291

dB. Significantly lower DPOAE thresholds were also detected in the AAV2-KKH-292

saCas9-sgRNA-4 treated ears compared to the contralateral control ears at frequencies 293

of 11.3 and 16 kHz, with a reduction of 31 dB at 11.3 kHz and 24 dB at 16 kHz. Lower 294

DPOAE threshold of 9 dB was detected at 22.6 kHz; however, it is not statistically 295

different (Extended Data Fig. 5c). Again, the DPOAE threshold reduction in Mir9614C>A/+

296

mice injected at 3-week-old was greater than that in Mir9614C>A/+ mice injected at 6-297

week-old, 27 dB vs. 18 dB. 298

In the 16-week-old mice injection group, no difference in ABR and DPOAE thresholds 299

was detected between AAV2-KKH-saCas9-sgRNA-4 treated and contralateral control 300

ears at 26 weeks age (Extended Data Fig. 5d-e). The data demonstrate that at the later 301

stage with severe hearing loss deterioration, genome editing therapy is no longer an 302

effective treatment. Combined with the data from 3-, 6- and 16-week injections, the 303

results highlight the importance of early intervention for more effective outcomes before 304

substantial hearing loss has initiated. 305

306

In vivo genome editing preserves hair cell survival. To test the effect of editing on 307

HCs in vivo, we injected the AAV2-KKH-saCas9-sgRNA-4 into the inner ear of 6-week-308

old Mir9614C>A/+ mice. Cochleae were harvested 10 weeks after the injection for hair cell 309

labeling using an anti-MYO7A antibody and confocal imaging (Fig. 6a). In the uninjected 310

Mir9614C>A/+ inner ears, outer hair cell (OHC) loss across cochlear turns was observed 311

with the most severe loss in the basal turn (Fig. 6c, e, f). A slight loss of the inner hair 312

cells (IHC) was detected in the basal turn only (Fig. 6c, e, f). In the injected Mir9614C>A/+ 313

ears, improved OHC survival was seen across all frequency regions compared to the 314

control group (Fig. 6b, d, f); whereas a slight reduction in the IHC number was seen in 315

the base similar to uninjected ears (Fig. 6g). To further examine hair cell structure, 316

scanning electron microscopy (SEM) was performed to visualize the details of OHC and 317

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

IHC stereocilia. Cochleae from uninjected and AAV2-KKH-saCas9-sgRNA-4 injected 318

Mir9614C>A/+ mice were harvested at 14 weeks after injection and imaged by SEM (Fig. 319

6a). Hair cells from the uninjected Mir9614C>A/+ mice cochleae showed signs of 320

degeneration, including missing stereocilia in the outer hair cells and disorganized 321

stereocilia in the inner hair cells (Fig. 6i, k). In contrast, the hair cells of injected 322

Mir9614C>A/+ mouse cochlea had organized and well-preserved stereocilia (Fig. 6h, j). 323

These findings demonstrate that in vivo genome editing by AAV2-KKH-saCas9-sgRNA-324

4 rescues hair cells in Mir9614C>A/+ mice by promoting their survival and maintaining the 325

structure of stereocilia. 326

Safety assessment of AAV-mediated genome editing treatment in cochleae of 327

adult mice. Development of editing therapy for hearing loss requires safety 328

assessment. To address potential safety concerns about AAV-delivered CRISPR 329

genome editing in vivo, the chronic expression of saCas9 and the risk of AAV vector 330

integration were evaluated. RT-PCR analysis revealed that KKH-saCas9 RNA levels 331

peaked at 4 weeks, decreased at 8 weeks, and became undetectable after 12 weeks in 332

the injected ear (Fig. 7a). Only trace levels of KKH-saCas9 mRNA were detected in the 333

contralateral uninjected ear at 4 weeks post-injection (Fig. 7a). By Western blotting, we 334

confirmed the presence of KKH-saCas9 protein at 4 weeks post-injection and its 335

absence after 12 weeks (Fig. 7b). These findings collectively show that the expression 336

of KKH-saCas9 expression was effectively shut off within three months after injection, 337

likely due to the silencing of the CMV promoter, which is known to undergo silencing 338

over time in vivo47-49. 339

Another concern is the risk of AAV vector integration into CRISPR-induced DNA 340

breaks50,51. To assess AAV vector integration, specific primers were designed for PCR 341

and NGS analysis to detect the integration of Mir96 and AAV ITR (Fig. 7c). In cultured 342

HEK-293T-Mir9614C>A cells treated with different AAV dosages, AAV vector integration 343

at the double-strand break locus became detectable at a dosage of 103 vg/cell (Fig. 7d 344

and Extended Data Fig. 6a, b). The indel frequency and the integration ratio were 345

correlated with the increasing AAV dosage. By varying AAV dosages, we identified an 346

optimal dosage range from 102 vg/cell to 104 vg/cell, where the indel frequency was 347

near its peak while maintaining low levels of AAV vector integration in HEK cells (Fig. 7d 348

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

and Extended Data Fig. 6a, b). These results suggest that by fine-tuning the AAV 349

dosage, the potential risk of AAV vector integration can be greatly reduced while 350

maintaining efficient genome editing. 351

We further performed in vivo injection and integration assay. We did not detect any 352

integration in the whole cochlear samples (Fig. 7e), but detected minimal integration in 353

isolated hair cells (Fig. 7f). NGS revealed that out of a total of 82,453 reads, the Mir96 354

wild-type allele had 42,991 reads, while the remaining reads were associated with 355

Mir9614C>A reads. Among the Mir9614C>A reads, indel-containing reads accounted for 356

25.7% (Fig. 7g). Additionally, there were 102 integration reads, making up 0.26% of the 357

total reads (Fig. 7g). Measurement of miR96 levels using qPCR showed a decrease in 358

miR96 levels in the injected ear (89.2± 3.0%) compared to the uninjected ear (Fig. 7h), 359

likely due to RNA degradation after genome editing. No significant change was 360

observed in qRNA analysis using miR96-specific and ITR-R primers (Fig. 7i), which 361

were used to measure the miR96-ITR mRNA, indicating the absence of miR96-ITR 362

chimera transcripts after genome editing. These results demonstrate that AAV2-363

mediated genome editing in the mature cochlea exhibits minimal or negligible vector 364

integration. To further explore the possibility of eliminating AAV vector integration, a 365

reduced dose of AAV2-KKH-saCas9-sgRNA4 (1×109 vg per cochlea) was 366

administered. After a 10-week period following the injection, no integration of ITR was 367

detected in isolated hair cells (Extended Data Fig. 7a), as evidenced by NGS data with 368

an average indel frequency of 12.05% (n=3) and ITR integration reads ratio below the 369

background error (Extended Data Fig. 7b, c). These findings demonstrate that AAV 370

vector integration rate is correlated with the administrated AAV dosage, and the dosage 371

we used achieve the therapeutic threshold for genome editing therapy while minimize 372

the AAV vector integration. 373

To assess off-target editing, CIRCLEseq was performed to identify potential off-target 374

sites52. Only two off-target sites were identified from the mouse genomic DNA (Fig. 7j). 375

Computational predictions were also used to identify potential off-target loci53,54. We 376

analyzed the top ten off-target hits in mouse genome according to the cutting frequency 377

determination (CFD) score53 after KKH-saCas9/sgRNA-4 editing (Extended Data Fig. 378

6c, d), which includes the two off-target sites identified by CIRCLEseq analysis. NGS 379

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

analysis identified one off-target site with low level of indels (1.97%), while the on-target 380

editing efficiency is up to 84.6% (Fig. 7k). The off-target editing was in the intergenic 381

region (Gm19782-Fam135b), which means unlikely to disrupt any gene function. Using 382

the isolated hair cells from injected mice, we did not detect any off-target indels (Fig. 7l). 383

Together, these results show that the delivery of AAV2-KKH-saCas9-sgRNA-4 into 384

Mir9614C>A/+ cells results in minimal off-target modification, and the hearing-related 385

phenotypes are the result from on-target editing. 386

387

A dual AAV2 system enables targeting multiple human MIR96 mutations. As the 388

Mir96 seed sequence is 100% conserved across mammalian species, the gRNA 389

designs that target mouse mutations can be directly used to target orthologous human 390

mutations. In addition to the +14C>A mutation, there are two known dominant 391

mutations in the MIR96 seed region, MIR96 13G>A and MIR96 15A>T, in humans11,17. 392

We designed gRNAs for each of the two mutations (Fig. 8a). Cas9 and multiple sgRNA 393

cassettes are too big to fit in single AAV, we then created a dual AAV set consisting of 394

AAV-U1A-spCas9-polyA with three nuclear localization signals (NLSs) and sgRNA 395

cassettes to target all three mutations (14C>A, 13G>A and 15A>T), AAV-sgmiR96-396

master (Fig. 8b, c). To validate the dual AAV set, human cell lines containing the three 397

MIR96 mutations were generated using the PiggyBac system, and each cell line was 398

transfected with AAV-U1A-spCas9-polyA/AAV-sgmiR96-master. NGS revealed robust 399

indel formation in all three MIR96 mutation lines, with a similar editing efficiency (Fig. 400

8d-g and Extended Data Fig. 8a-f). Less than 1% of the reads had indels detected at 401

the MIR96 locus (Fig. 8e). The data support specific disruption of each mutant allele by 402

its corresponding gRNA. We also analyzed top 10 potential off-target sites in human 403

genome and NGS showed no indels after Cas9/sgRNA transfection (Fig. 8h, j and 404

Extended Data Fig. 8g). These findings suggest that the combination of AAV-U1A-405

spCas9-polyA/AAV-sgmiR96-master can effectively target each of the three known 406

human MIR96 mutations and holds promise for treating dominant hearing loss caused 407

by MIR96-related mutations. The design of the AAV-sgmiR96-master system expands 408

the targeting scope and simplifies the efficacy and safety evaluation of the AAV delivery 409

system. 410

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

411

DISCUSSION 412

413

With the goal of developing a clinical treatment for human genetic hearing loss of 414

DFNA50, we conducted genome editing in adult Mir9614C>A/+ cochleae and successfully 415

improved auditory function in the long term. miRNAs are involved in multiple 416

physiological and pathological inner ear processes55, and have been linked to different 417

types of hearing loss, including deafness related to hair cell development 8,56, age-418

related hearing loss57, noise-induced hearing loss58, and inner ear inflammation59. In 419

humans, heterozygous MIR96 mutations result in late onset non-syndromic progressive 420

hearing loss, indicating the potential loss of sensory hair cell identity and subsequent 421

dysfunction in the mature cochlea, thereby offering an opportunity for genetic 422

intervention in adult patients. 423

Specific and efficient sgRNAs and genome editors, spCas9-sgRNA-1 and KKH-saCas9-424

sgRNA-4 were identified and optimized for targeting the Mir9614C>A mutation. AAV2 was 425

chosen as the delivery vehicle for its efficient transduction in inner and outer hair cells. 426

Genetic disruption of the Mir9614C>A allele leads to improved survival of hair cells and the 427

preservation of auditory function in Mir9614C>A/+ mice. We conducted injections of AAV2 428

into adult mice across various age groups. The therapy was effective in improving long-429

term hearing preservation in both pre-symptomatic and symptomatic stages of hearing 430

loss in Mir9614C>A/+ mice. Notably, we observed transient expression of KKH-saCas9 in 431

the inner ear, as the CMV promoter became silenced over time in vivo. This temporary 432

expression provides a controlled and regulated editing process, which enhances the 433

safety and precision of the therapy. Additionally, we demonstrated that fine-tuning the 434

dosage of AAV helps minimize the risk of AAV-mediated integration and improves the 435

safety profile of the therapy. These findings greatly enhance the safety profile of in vivo 436

genome editing therapy. The study also introduces a dual-AAV system capable of 437

targeting all known human MIR96 seed region mutations, making it a promising 438

candidate for treating various MIR96 dominant mutation-caused genetic hearing loss 439

conditions. Our study highlights the editing efficiency, safety, long-term therapeutic 440

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

efficacy of genome editing in treating hearing loss due to Mir96 mutations in adult 441

animal models and provides a promising path for clinical applications. 442

The selection of the most suitable editor and delivery vehicle is crucial in developing a 443

genome editing therapy for specific genetic disorders. In this study, we chose Cas9 444

nucleases to disrupt the mutated allele of Mir9614C>A/+ due to its gain-of-function 445

inheritance pattern18 meaning that the resulting indels would disable the expression of 446

the disease-causing mutant Mir96. While prime editing has the potential to correct the 447

Mir96 mutation, our in vitro data showed modest efficiency at the Mir96 locus, requiring 448

further optimization. AAV2 was selected as the preferred delivery vehicle for CRISPR 449

due to due to its specific targeting of inner and outer hair cells in the cochlea of adult 450

animals39. Besides, AAV2 serotype remains the most used throughout the study period 451

and has the most safety and efficacy evidence, with the most completed clinical trials60. 452

One of the major concerns associated with AAV-mediated CRISPR genome editing in 453

vivo is the potential for off-target editing caused by prolonged expression of 454

Cas9/sgRNA61. High-fidelity versions of CRISPR systems35,62,63 can be applied to 455

improve specificity. For example, we have demonstrated LZ3 Cas9 can target the 456

Mir9614C>A allele robustly and specifically. In addition, minimizing genome editing in 457

unintended tissues and cell types is also an important way to enhance the safety of 458

CRISPR-based therapeutics. AAV2 can specifically deliver Cas9/sgRNA into hair cells 459

through local injection, reducing the likelihood of editing unwanted cells or tissues. 460

Besides, the use of the CMV promoter for KKH-saCas9 expression helps minimize off-461

target editing as it tends to become silenced over time in vivo47-49,64-66. We 462

demonstrated that CMV-driven KKH-Cas9 was only transiently expressed and silenced 463

in 3 months in the cochlea. Another concern is the risk of vector integration at DNA 464

double-stranded breaks (DSBs)50,51. The integration ratio of AAV varies across different 465

genomic loci, tissues, and cell types50. By focusing on hair cell-limited genome editing, 466

we were able to reduce the occurrence of vector integration, as demonstrated in our 467

results. Furthermore, we found that a higher dose of AAV increased the chance of 468

vector integration, underscoring the importance of carefully fine-tuning the dosage. To 469

advance clinical studies, it will be necessary to dissect the AAV injection dosage to 470

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

identify the threshold for achieving robust genome editing while minimizing AAV vector 471

integration. 472

MicroRNA-96 serves as a key regulator and plays a crucial role in hair cell development 473

and hearing maintenance. Our study demonstrated in vivo genome editing in adult 474

Mir9614C>A/+ mice, in both pre-symptomatic and symptomatic stages of hearing loss, can 475

improve auditory function and prevent long-term deterioration. Moreover, our study 476

highlights the importance of genetic intervention in adult mice of different age groups to 477

determine the optimal treatment window, which has implications for future clinical 478

studies. Moving forward, it will be necessary to conduct further investigations in large 479

animals such as non-human primates to evaluate the efficacy of targeted genome 480

editing, determine the ideal AAV administration dosage, and identify the most effective 481

intervention time window for maximum therapeutic benefit. Our work holds significant 482

potential in advancing the clinical application of genome editing therapy for treating 483

genetic inherited hearing loss. 484

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

Methods 485

486

Animals and surgery. The Mir9614C>A allele (official symbol Mir96tm3.1Wtsi, referred to 487

here as Mir9614C>A) was generated at the Wellcome Sanger Institute as part of the 488

Mouse Genetics Project, by targeting of the BEPD0003_D07 ES cell of C57BL/6N origin 489

and was maintained on the same genetic background. The selection cassette was 490

removed by FLP recombinase, leaving a single downstream FRT site. All procedures for 491

generating the mutant mouse were carried out in accordance with UK Home Office 492

regulations and the UK Animals (Scientific Procedures) Act of 1986 (ASPA) under UK 493

Home Office licences, and the study was approved by the Wellcome Sanger Institute 494

Ethical Review Committee. After shipping, all animals were bred and housed in Mass 495

Eye and Ear Infirmary. All studies involving animals were approved by the HMS 496

Standing Committee on Animals and the Mass Eye and Ear Infirmary Animal Care and 497

Use Committee. All mice were housed in a room maintained on a 12h light and dark 498

cycle with ad libitum access to standard rodent diet. 499

Mir9614C>A/+ and wild type (WT) mice of either sex were anesthetized using 500

intraperitoneal (i.p.) injection of ketamine (100mg/kg) and xylazine (10mg/kg). The post-501

auricular incision was exposed by shaving and disinfected using 10% povidone iodine. 502

The AAV2-CMV-KKH-saCas9-sgRNA4 of two titers was injected into the inner ears of 503

Mir9614C>A/+ mice. The AAV2-GFP was injected into the inner ears of WT mice. The total 504

volume for each injection was 1~1.2 μl virus per cochlea. 505

Plasmid construction. pMax-spCas9 is obtained from previous article67, U6-sgRNA 506

sequence was also obtained from PX458 (Addgene 48138)68, other Cas9 nuclease, 507

including scCas9++ (Addgene 155011)32, KKH-saCas9 (Addgene 70707)33, sauriCas9 508

(Addgene 135964)34, LZ3 Cas9 (Addgene 140561)35 cDNA are acquired from addgene. 509

Vectors for in vitro screening were constructed via Gibson assembly (NEB, E2611S). 510

KKH-saCAs9 AAV vectors are based on PX601 (Addgene 61591)69. AAV-U1a-opti-511

spCas9-PA (Supplementary Fig. 2) is based on Addgene 12150770. AAV-sgmir96-512

Master (Supplementary Fig. 3) is based on pAAV-U6-sgRNA-CMV-GFP (Addgene 513

85451)71. Plasmids encoding recombinant AAV (rAAV) genomes were cloned by Gibson 514

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

assembly. All plasmids were purified using Plasmid Plus Miniprep or Maxiprep kits 515

(Qiagen). 516

AAV production. AAV vectors were produced by Mass eye and ear infirmary vector 517

core (Boston, MA, USA). AAV plasmids containing “CMV-KKH-SaCas9-PA” cassette, 518

“U6-sgRNA-4” or “U6-sgCtrl” cassette was sequenced before packaging (MGH DNA 519

Core, complete plasmid sequencing) into AAV2/2 (Supplementary Fig. 1). Vector titer 520

was 5.76 × 1012 vg/ml for KKH-saCas9/sgRNA-4 and 4.55× 1012 vg/ml for KKH-521

saCas9/sgCtrl as determined by qPCR specific for the inverted terminal repeat of the 522

virus. 523

Isolation and culture of Primary Fibroblasts from Mice. Mir9614C>A/+, Ai14 (CAG-524

STOP-tdTomato) and wild type mice were euthanized and cleaned with 70% ethanol. 525

The dorsal skin (~1 cm diameter) of the mice was collected and rinsed with DPBS, 526

subcutaneous fat was removed by forceps. Subsequently, the samples were cut into 527

small fragments and incubated with Dispase II (Sigma-Aldrich, USA) for overnight at 528

4 °C. The dermal layers of the skin were separated using forceps and further subjected 529

to incubation with type I collagenase (1 mg/ml Gibco, USA) for 2 hours at 37 degrees. 530

The resulting cell suspension was strained using a 40-micron strainer and centrifuged at 531

950 rpm to obtain the cell pellet. The cell pellet was seeded in T-75 flask containing 532

DMEM high glucose media (Gibco, USA) containing 10 % FBS (Gibco, USA). 533

Fibroblasts were cultured for about 2–3 days to reach ~90% confluence, then passaged 534

in T75 flasks with TrypLE Express and cultured in DMEM: F12 medium (ThermoFisher) 535

with 10% fetal bovine serum (FBS) supplemented with GlutaMax (ThermoFisher). 536

Construction of Mir9614C>A cell line using PiggyBac. Mouse Mir9614C>A (~0.6 kb) 537

harboring the +14C>A mutation was amplified by PCR from Mir9614C>A/14C>A mouse 538

genomic DNA. The PCR products were cloned into the PiggyBac donor backbone (PB-539

CAG-mNeonGreen-P2A-BSD-polyA) using Gibson Assembly. The constructed donor 540

plasmid was co-transfected with PiggyBac transposon vector (PB210PA, System 541

Biosciences) into HEI-OC1 cells. Cells were cultured and selected in the medium 542

containing 10 µg/mL Blasticidin for 2 weeks. For human MIR96 +14C>A fragment, 543

mutation was introduced by PCR and cloned into the same PiggyBac donor backbone 544

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

using Gibson Assembly. Cells were transfected by PiggyBac plasmids and selected by 545

Blasticidin for 2 weeks. Successful insertion was confirmed by PCR and sequencing 546

analysis. Clones from the positive Mir9614C>A selection were expanded for subsequent 547

studies. 548

Genome editing in vitro. We performed nucleofection using LONZA 4D-Nucleofector. 549

Cells were digested by Trypsin-EDTA (0.05%) (Thermo Fisher) and future dispersed 550

into single cells. 100,000 cells were resuspended in 20μl P3 reagent of the P3 Primary 551

Cell 4D-Nucleofector® X Kit S (Lonza V4XP-3032). 1 μg total plasmid was used for a 552

single nucleofection event and nucleofected by program EH-100. Cells were not sorted. 553

5 days after the nucleofection, cells were lysed by QuickExtract™ DNA Extraction 554

Solution (Lucigen) to extract genomic DNA. Genomic PCR was carried out using 555

NEBNext® Ultra™ II Q5® Master Mix (NEB, M0544S) to amply Mir96 loci, 400~800 ng 556

of purified PCR product were used for next generation sequencing (NGS), samples 557

were sequenced and analyzed to detect CRISPR variants from NGS reads using 558

CRISPResso2 (http://crispresso.pinellolab.org/submission) as instructed72. The sgRNA 559

protospacer sequences can be found in Supplementary Table 3. 560

Hair cells isolation and NGS analysis. Cochleae were harvested with the sensory 561

epithelia dissociated using needles under the microscope (Axiovert 200M, Carl Zeiss). 562

Inner ear tissue was immersed in 1 μM FM 1-43FX (ThermoFisher, F35355) dissolved 563

in DPBS (ThermoFisher) for 15s at room temperature in the dark, then washed by 564

DPBS. The sensory epithelia were treated with 100μl 0.05% trypsin-EDTA 565

(ThermoFisher, 25300054) for 10-20 min. During incubation, the tissue was carefully 566

dispersed into small cell clusters or single cells using a 200μl Eppendorf pipette tip. 567

Cells were then transferred into 6-well plate and placed under a fluorescent microscope 568

(ZEISS) equipped with a camera. Cells with FM 1-43FX dye were collected by a 10μl 569

Eppendorf pipette tip. Above 300 cells were collected from single cochlea. Hair cells 570

were transferred into 200μl PCR tube, and centrifuged for 5 min, 200 rcf. Supernatant 571

were carefully discarded and the isolated hair cells were lysed by 5μl QuickExtract™ 572

DNA Extraction Solution (Lucigen) and incubated in 65°C for 6 min then 98°C 3 min. All 573

5μl of the cell lysis were used for each Genomic PCR amplification using NEBNext® 574

Ultra™ II Q5® Master Mix (NEB, M0544S). PCR program is 1 cycle: 98°C 5min; 42 575

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

cycles: 98°C 15s, 60°C 20s, 72°C 10s; 1 cycle: 72°C 4min; 4°C. PCR products 576

visualization, purification and NGS analysis are the same with that described above. 577

Hearing Function Testing. Mir9614C>A/+ mice of either sex were anesthetized using 578

intraperitoneal (i.p.) injection of ketamine (100mg/kg) and xylazine (10mg/kg). For ABR 579

measurements, subcutaneous needle electrodes were inserted at the vertex, ventral 580

edge of the pinna (active electrode), and a ground reference near the tail. The mice 581

were placed in a sound-proof chamber and exposed to 5-ms tone pips delivered at a 582

rate of 35/s. The response was amplified 10,000-fold, filtered with a band-pass of 100 583

Hz to 3 kHz, digitized, and averaged using 1,024 responses at each sound pressure 584

level (SPL). The sound level was elevated in 5 dB steps from 20dB up to 90dB SPL, 585

with stimuli ranging from 5.66-45.24 kHz frequencies (in half-octave steps). The 586

“threshold” and wave 1 amplitude were identified as described previously19,20. During 587

the same recording session, DPOAEs were measured under the same conditions as for 588

ABRs. Briefly, two primary tones (f2/f1=1.2) were set with f2 varied between 5.66 and 589

45.24 kHz in half-octave steps. Primaries were swept from 20dB SPL to 80dB SPL (for 590

f2) in 5-dB steps. Thresholds required to produce a DPOAE at 5dB SPL were computed 591

by interpolation as f2 level. 592

Immunofluorescence staining. Cochleae, both injected and non-injected, were 593

harvested following CO2 inhalation as a means of animal euthanasia. Temporal bones 594

were fixed in 4% paraformaldehyde at 4°C overnight and subsequently decalcified in 595

120 mM EDTA for a week. Then the organ of Corti was dissected for whole-mount 596

immunofluorescence. The dissected tissues were blocked with a blocking solution (PBS 597

with 8% donkey serum and 0.3-1% Triton X-100) for 1 hour at room temperature. 598

Subsequently, the specimens were subjected to overnight incubation with the primary 599

antibodies: anti-MYO7A (#25-6790, Proteus BioSciences), anti-GFP (ab13970, Abcam). 600

After three rinses with PBS, the tissues were incubated with the corresponding 601

secondary antibodies for 1 hour. Finally, all specimens were mounted with 602

VECTASHIELD antifade mounting medium containing DAPI (VECTOR 603

LABORATORIES, #H-1200). Images were taken with a Leica SP8 confocal laser 604

scanning microscope (Leica Microsystems, Germany). For hair cell counting, MYO7A-605

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

positive hair cells per 100μm length were calculated in the apex, middle, and middle-606

base turns of cochleae. We counted from three independent cochleae. 607

Scanning Electron Microscopy. Following cochlea dissection, the harvested tissues 608

were placed in 2.5% glutaraldehyde solution in 0.1 M cacodylate buffer (EMS) 609

supplemented with 2 mM CaCl2. The immersion was performed for 1.5-2 hours at room 610

temperature on a tissue rotator. Subsequently, the samples were rinsed three times with 611

distilled water. The samples underwent three 10-minute rinses with 0.1 M sodium 612

cacodylate buffer. Next, they were treated with 1% osmium tetroxide for a duration of 613

one hour, followed by another three 10-minute rinses with distilled water. The samples 614

were then subjected to treatment with saturated thiocarbohydrazide in distilled water for 615

30 minutes. This cycle of treatments (one-two-one-two-one) was repeated. 616

For dehydration, the samples were transferred to 20 ml scintillation vials containing 2 ml 617

of distilled water. The vials were supplemented with 50 µL of 100% ethanol, with the 618

volume doubled every 10 minutes until the vial was full. At that point, the samples were 619

transferred to 100% ethanol. Subsequently, the samples were dried using liquid CO2 in 620

a Tousimis Autosamdri 815 to reach the critical point. Finally, the samples were 621

mounted onto aluminum specimen stubs using carbon tape, spatter-coated with a 4.5 622

nm layer of platinum using a Leica EM ACE600 and analyzed using a Hitachi S-4700 623

scanning electron microscope (SEM). 624

RNA isolation and qRT-PCR. Total RNA was extracted from inner ear tissue using the 625

ReliaPrep RNA Tissue Miniprep System (Promega, z6111). Then first-strand cDNA was 626

produced using ProtoScript® II First Strand cDNA Synthesis Kit (NEB, E6560s) with 627

random primers, following the manufacturer’s instructions. STEM-LOOP qRT-PCR were 628

used to measure Mir96 level, first-strand cDNA was produced using Mir96 specific 629

primers (rtmri96: 630

CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCAAAAATGTG). Real time 631

quantitative PCR was performed using Power SYBR Green PCR Master Mix (Applied 632

Biosystems, 4368708) on the ABI QuantStudio 3 Flex Real-Time PCR System (Applied 633

Biosystems). qmiR96-F: TCGGCAGGTTTGGAACTAGCAC; qmiR96-R: 634

CTCAACTGGTGTCGTGGA. 635

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

Western blotting. After dissection of cochleae, inner ear tissue samples were lysed 636

using by RIPA Lysis and Extraction buffer (ThermoFisher, 89900) containing protease 637

inhibitor (ThermoFisher) for 30 min on ice. Protein was quantified and 80 μg of each 638

lysate were loaded per lane of a NuPAGE™ 4-12% Bis-Tris Protein Gel (Thermo Fisher 639

Scientiﬁc, NP0335PK2). Samples were separated on 200V for 35 min in the mini gel 640

tank (ThermoFisher). Protein were then transferred to Nitrocellulose Blotting 641

Membranes (PALL, P66485) at 200 mA for 2 hours. The membranes were blocked in 642

5% evaporated milk in Tris-based saline with Tween 20 (0.05% TBST) for 1 hour and 643

followed by incubating with primary antibodies overnight at 4 ºC (Anti-HA: Cell Signaling 644

Technology, 3724S; anti-GAPDH: Thermo, MA5-15738). After three rinses with TBST, 645

NC membranes were incubated with HRP conjugated secondary antibodies (Thermo 646

Fisher Scientiﬁc) for 2 hours at RT. Protein bands were visualized using SuperSignal 647

West Pico PLUS Chemiluminescent Substrate (ThermoFisher, 34577) and blot image 648

were captured by ChemiDoc Imaging system (BioRad). Uncropped images can be 649

found in Supplementary Fig. 4. 650

AAV vector integration assay. HEK 293T-Mir9614C>A cells were treated with AAV2-651

CMV-KKH-saCas9-sgRNA4 of different dosages from 1 to 107 genomic copies per cell. 652

Control cells were transduced with AAV2-CMV-KKH-saCas9-sgCtrl, 105 genomic copies 653

per cell. Cells were collected 7 days later and genomic DNA was isolated. Primers P1-654

F/ITR-R were used for detecting of AAV vector integration. For in vivo integration 655

detection, Primers P1-F/P2-R and primers P1-F/ITR-R were used to amply genomic 656

fragment from isolated hair cells, then PCR products were merged together for NGS 657

analysis. Primers premir96-F/ITR-R were used in the qRT-PCR study to detect mir96-658

ITR transcription. All primers used for AAV vector integration assay were listed in 659

Supplementary Table. 1. 660

Off-target analysis. To identify off-target sites, the CIRCLE-seq was performed 661

essentially as previously described with the minor modifications. Briefly, 50 μg genomic 662

DNA were purified from HEI-OC1 cells. Genomic DNA was sheared (NEB Ultra II FS kit, 663

E7805) and circularized. In vitro cleavage reaction of circularized genomic DNA is 664

performed with KKH-saCas9/sgRNA-4. Then the sequencing libraries were prepared 665

and sequenced on an Illumina Miseq as previously described52. Off-target sites were 666

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

identified with the standard pipeline. The negative control sample were treated with the 667

Cas9 alone to assess background. 668

Besides, we listed top10 potential off-target sites according to the cutting frequency 669

determination (CFD) score53. We designed PCR primers on the two flanks of each 670

sgRNA target sequences for amplifying 250-280 bp DNA fragments. Then amplified 671

fragments were purified for NGS to identify whether there is any off-target mutation. All 672

primers used for off-target analysis were listed in Supplementary Table. 2. 673

Statistical analysis. The number of biological and technical replicates, and parameters 674

are indicated in corresponding Figure legends. Data acquisition were performed by 675

investigators blinded to experimental groups. Statistical analysis were performed using 676

GraphPad Prism 8. The student’s t test was used to calculate statistical signiﬁcance 677

between two groups. The p values < 0.05 were considered as signiﬁcantly different. **** 678

p < 0.0001, *** p < 0.001, ** p < 0.01, * p < 0.05. 679

Reporting summary. Further information on research design is available in the Nature 680

Research Reporting Summary linked to this article. 681

Data availability 682

The data supporting the results in this study are available within the paper and its 683

Supplementary Information. AAV genome sequences are provided in the Supplemental 684

Data. All data are available within this study are available from the corresponding author 685

upon reasonable request. The mutant mice are available from the European Mutant 686

Mouse Archive (EMMA). 687

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

References 688

1 Angeli, S., Lin, X. & Liu, X. Z. Genetics of hearing and deafness. Anat Rec (Hoboken) 295, 689

1812-1829, doi:10.1002/ar.22579 (2012). 690

2 Géléoc, G. S. & Holt, J. R. Sound strategies for hearing restoration. Science 344, 1241062, 691

doi:10.1126/science.1241062 (2014). 692

3 Müller, U. & Barr-Gillespie, P. G. New treatment options for hearing loss. Nat Rev Drug 693

Discov 14, 346-365, doi:10.1038/nrd4533 (2015). 694

4 Omichi, R., Shibata, S. B., Morton, C. C. & Smith, R. J. H. Gene therapy for hearing loss. 695

Hum Mol Genet 28, R65-r79, doi:10.1093/hmg/ddz129 (2019). 696

5 Mahmoudian-Sani, M. R. et al. MicroRNAs: effective elements in ear-related diseases 697

and hearing loss. Eur Arch Otorhinolaryngol 274, 2373-2380, doi:10.1007/s00405-017-698

4470-6 (2017). 699

6 Mendell, J. T. & Olson, E. N. MicroRNAs in stress signaling and human disease. Cell 148, 700

1172-1187, doi:10.1016/j.cell.2012.02.005 (2012). 701

7 Xiang, L. et al. miR-183/96 plays a pivotal regulatory role in mouse photoreceptor 702

maturation and maintenance. Proc Natl Acad Sci U S A 114, 6376-6381, 703

doi:10.1073/pnas.1618757114 (2017). 704

8 Kuhn, S. et al. miR-96 regulates the progression of differentiation in mammalian 705

cochlear inner and outer hair cells. Proc Natl Acad Sci U S A 108, 2355-2360, 706

doi:10.1073/pnas.1016646108 (2011). 707

9 Weston, M. D. et al. A mouse model of miR-96, miR-182 and miR-183 misexpression 708

implicates miRNAs in cochlear cell fate and homeostasis. Sci Rep 8, 3569, 709

doi:10.1038/s41598-018-21811-1 (2018). 710

10 Soldà, G. et al. A novel mutation within the MIR96 gene causes non-syndromic inherited 711

hearing loss in an Italian family by altering pre-miRNA processing. Hum Mol Genet 21, 712

577-585, doi:10.1093/hmg/ddr493 (2012). 713

11 Mencía, A. et al. Mutations in the seed region of human miR-96 are responsible for 714

nonsyndromic progressive hearing loss. Nat Genet 41, 609-613, doi:10.1038/ng.355 715

(2009). 716

12 Meola, N., Gennarino, V. A. & Banfi, S. microRNAs and genetic diseases. PathoGenetics 717

2, 7, doi:10.1186/1755-8417-2-7 (2009). 718

13 Weston, M. D., Pierce, M. L., Rocha-Sanchez, S., Beisel, K. W. & Soukup, G. A. MicroRNA 719

gene expression in the mouse inner ear. Brain Res 1111, 95-104, 720

doi:10.1016/j.brainres.2006.07.006 (2006). 721

14 Schlüter, T. et al. miR-96 is required for normal development of the auditory hindbrain. 722

Hum Mol Genet 27, 860-874, doi:10.1093/hmg/ddy007 (2018). 723

15 Xu, S., Witmer, P. D., Lumayag, S., Kovacs, B. & Valle, D. MicroRNA (miRNA) 724

transcriptome of mouse retina and identification of a sensory organ-specific miRNA 725

cluster. J Biol Chem 282, 25053-25066, doi:10.1074/jbc.M700501200 (2007). 726

16 Wienholds, E. et al. MicroRNA expression in zebrafish embryonic development. Science 727

309, 310-311, doi:10.1126/science.1114519 (2005). 728

17 Lewis, M. A. et al. An ENU-induced mutation of miR-96 associated with progressive 729

hearing loss in mice. Nat Genet 41, 614-618, doi:10.1038/ng.369 (2009). 730

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

18 Lewis, M. A., Di Domenico, F., Ingham, N. J., Prosser, H. M. & Steel, K. P. Hearing 731

impairment due to Mir183/96/182 mutations suggests both loss and gain of function 732

effects. Dis Model Mech 14, doi:10.1242/dmm.047225 (2020). 733

19 Gao, X. et al. Treatment of autosomal dominant hearing loss by in vivo delivery of 734

genome editing agents. Nature 553, 217-221, doi:10.1038/nature25164 (2018). 735

20 Tao, Y. et al. Treatment of monogenic and digenic dominant genetic hearing loss by 736

CRISPR-Cas9 ribonucleoprotein delivery in vivo. Nat Commun 14, 4928, 737

doi:10.1038/s41467-023-40476-7 (2023). 738

21 György, B. et al. Allele-specific gene editing prevents deafness in a model of dominant 739

progressive hearing loss. Nat Med 25, 1123-1130, doi:10.1038/s41591-019-0500-9 740

(2019). 741

22 Wu, J. et al. Single and Dual Vector Gene Therapy with AAV9-PHP.B Rescues Hearing in 742

Tmc1 Mutant Mice. Mol Ther 29, 973-988, doi:10.1016/j.ymthe.2020.11.016 (2021). 743

23 Gu, X. et al. Prevention of acquired sensorineural hearing loss in mice by in vivo Htra2 744

gene editing. Genome Biol 22, 86, doi:10.1186/s13059-021-02311-4 (2021). 745

24 Xue, Y. et al. Gene editing in a Myo6 semi-dominant mouse model rescues auditory 746

function. Mol Ther 30, 105-118, doi:10.1016/j.ymthe.2021.06.015 (2022). 747

25 Noh, B. et al. In vivo outer hair cell gene editing ameliorates progressive hearing loss in 748

dominant-negative Kcnq4 murine model. Theranostics 12, 2465-2482, 749

doi:10.7150/thno.67781 (2022). 750

26 Cui, C. et al. Precise detection of CRISPR-Cas9 editing in hair cells in the treatment of 751

autosomal dominant hearing loss. Mol Ther Nucleic Acids 29, 400-412, 752

doi:10.1016/j.omtn.2022.07.016 (2022). 753

27 Yeh, W. H. et al. In vivo base editing restores sensory transduction and transiently 754

improves auditory function in a mouse model of recessive deafness. Sci Transl Med 12, 755

doi:10.1126/scitranslmed.aay9101 (2020). 756

28 Jiang, L., Wang, D., He, Y. & Shu, Y. Advances in gene therapy hold promise for treating 757

hereditary hearing loss. Mol Ther 31, 934-950, doi:10.1016/j.ymthe.2023.02.001 (2023). 758

29 Yoshimura, H., Shibata, S. B., Ranum, P. T., Moteki, H. & Smith, R. J. H. Targeted Allele 759

Suppression Prevents Progressive Hearing Loss in the Mature Murine Model of Human 760

TMC1 Deafness. Mol Ther 27, 681-690, doi:10.1016/j.ymthe.2018.12.014 (2019). 761

30 Morag A. Lewis, M. L., Miguel Angel Moreno-Pelayo and Karen P. Steel. in Association 762

for Research in Otolaryngology midwinter meeting abstracts (2020). 763

31 Jinek, M. et al. A programmable dual-RNA-guided DNA endonuclease in adaptive 764

bacterial immunity. Science 337, 816-821, doi:10.1126/science.1225829 (2012). 765

32 Chatterjee, P. et al. An engineered ScCas9 with broad PAM range and high specificity 766

and activity. Nat Biotechnol 38, 1154-1158, doi:10.1038/s41587-020-0517-0 (2020). 767

33 Kleinstiver, B. P. et al. Broadening the targeting range of Staphylococcus aureus CRISPR-768

Cas9 by modifying PAM recognition. Nat. Biotechnol. 33, 1293-1298, 769

doi:10.1038/nbt.3404 (2015). 770

34 Hu, Z. et al. A compact Cas9 ortholog from Staphylococcus Auricularis (SauriCas9) 771

expands the DNA targeting scope. PLoS Biol 18, e3000686, 772

doi:10.1371/journal.pbio.3000686 (2020). 773

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

35 Schmid-Burgk, J. L. et al. Highly Parallel Profiling of Cas9 Variant Specificity. Mol Cell 78, 774

794-800.e798, doi:10.1016/j.molcel.2020.02.023 (2020). 775

36 Anzalone, A. V. et al. Search-and-replace genome editing without double-strand breaks 776

or donor DNA. Nature 576, 149-157, doi:10.1038/s41586-019-1711-4 (2019). 777

37 Chen, P. J. & Liu, D. R. Prime editing for precise and highly versatile genome 778

manipulation. Nat Rev Genet 24, 161-177, doi:10.1038/s41576-022-00541-1 (2023). 779

38 Nelson, J. W. et al. Engineered pegRNAs improve prime editing efficiency. Nat 780

Biotechnol 40, 402-410, doi:10.1038/s41587-021-01039-7 (2022). 781

39 Omichi, R., Yoshimura, H., Shibata, S. B., Vandenberghe, L. H. & Smith, R. J. H. Hair Cell 782

Transduction Efficiency of Single- and Dual-AAV Serotypes in Adult Murine Cochleae. 783

Mol Ther Methods Clin Dev 17, 1167-1177, doi:10.1016/j.omtm.2020.05.007 (2020). 784

40 Du, W. et al. Rescue of auditory function by a single administration of AAV-TMPRSS3 785

gene therapy in aged mice of human recessive deafness DFNB8. Mol Ther, 786

doi:10.1016/j.ymthe.2023.05.005 (2023). 787

41 Wu, Y. et al. Highly efficient therapeutic gene editing of human hematopoietic stem 788

cells. Nat Med 25, 776-783, doi:10.1038/s41591-019-0401-y (2019). 789

42 Koblan, L. W. et al. Improving cytidine and adenine base editors by expression 790

optimization and ancestral reconstruction. Nat Biotechnol 36, 843-846, 791

doi:10.1038/nbt.4172 (2018). 792

43 Chen, B. et al. Expanding the CRISPR imaging toolset with Staphylococcus aureus Cas9 793

for simultaneous imaging of multiple genomic loci. Nucleic Acids Res 44, e75, 794

doi:10.1093/nar/gkv1533 (2016). 795

44 Staahl, B. T. et al. Efficient genome editing in the mouse brain by local delivery of 796

engineered Cas9 ribonucleoprotein complexes. Nat Biotechnol 35, 431-434, 797

doi:10.1038/nbt.3806 (2017). 798

45 Meyers, J. R. et al. Lighting up the senses: FM1-43 loading of sensory cells through 799

nonselective ion channels. J Neurosci 23, 4054-4065, doi:10.1523/jneurosci.23-10-800

04054.2003 (2003). 801

46 Shu, Y. et al. Renewed proliferation in adult mouse cochlea and regeneration of hair 802

cells. Nat Commun 10, 5530, doi:10.1038/s41467-019-13157-7 (2019). 803

47 Brooks, A. R. et al. Transcriptional silencing is associated with extensive methylation of 804

the CMV promoter following adenoviral gene delivery to muscle. J Gene Med 6, 395-805

404, doi:10.1002/jgm.516 (2004). 806

48 Levy, J. M. et al. Cytosine and adenine base editing of the brain, liver, retina, heart and 807

skeletal muscle of mice via adeno-associated viruses. Nat Biomed Eng 4, 97-110, 808

doi:10.1038/s41551-019-0501-5 (2020). 809

49 Gray, S. J. et al. Optimizing promoters for recombinant adeno-associated virus-mediated 810

gene expression in the peripheral and central nervous system using self-complementary 811

vectors. Hum Gene Ther 22, 1143-1153, doi:10.1089/hum.2010.245 (2011). 812

50 Hanlon, K. S. et al. High levels of AAV vector integration into CRISPR-induced DNA 813

breaks. Nat Commun 10, 4439, doi:10.1038/s41467-019-12449-2 (2019). 814

51 Nelson, C. E. et al. Long-term evaluation of AAV-CRISPR genome editing for Duchenne 815

muscular dystrophy. Nat Med 25, 427-432, doi:10.1038/s41591-019-0344-3 (2019). 816

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

52 Tsai, S. Q. et al. CIRCLE-seq: a highly sensitive in vitro screen for genome-wide CRISPR-817

Cas9 nuclease off-targets. Nat Methods 14, 607-614, doi:10.1038/nmeth.4278 (2017). 818

53 Doench, J. G. et al. Optimized sgRNA design to maximize activity and minimize off-target 819

effects of CRISPR-Cas9. Nat Biotechnol 34, 184-191, doi:10.1038/nbt.3437 (2016). 820

54 Tycko, J. et al. Pairwise library screen systematically interrogates Staphylococcus aureus 821

Cas9 specificity in human cells. Nat Commun 9, 2962, doi:10.1038/s41467-018-05391-2 822

(2018). 823

55 Rudnicki, A. & Avraham, K. B. microRNAs: the art of silencing in the ear. EMBO Mol Med 824

4, 849-859, doi:10.1002/emmm.201100922 (2012). 825

56 Li, H., Kloosterman, W. & Fekete, D. M. MicroRNA-183 family members regulate 826

sensorineural fates in the inner ear. J Neurosci 30, 3254-3263, 827

doi:10.1523/jneurosci.4948-09.2010 (2010). 828

57 Xiong, H. et al. Modulation of miR-34a/SIRT1 signaling protects cochlear hair cells 829

against oxidative stress and delays age-related hearing loss through coordinated 830

regulation of mitophagy and mitochondrial biogenesis. Neurobiol Aging 79, 30-42, 831

doi:10.1016/j.neurobiolaging.2019.03.013 (2019). 832

58 Miguel, V. et al. The Role of MicroRNAs in Environmental Risk Factors, Noise-Induced 833

Hearing Loss, and Mental Stress. Antioxidants & Redox Signaling 28, 773-796, 834

doi:10.1089/ars.2017.7175 (2017). 835

59 Tan, P. X. et al. MicroRNA-207 enhances radiation-induced apoptosis by directly 836

targeting Akt3 in cochlea hair cells. Cell Death Dis 5, e1433, doi:10.1038/cddis.2014.407 837

(2014). 838

60 Kuzmin, D. A. et al. The clinical landscape for AAV gene therapies. Nat Rev Drug Discov 839

20, 173-174, doi:10.1038/d41573-021-00017-7 (2021). 840

61 Wang, D., Zhang, F. & Gao, G. CRISPR-Based Therapeutic Genome Editing: Strategies and 841

In Vivo Delivery by AAV Vectors. Cell 181, 136-150, doi:10.1016/j.cell.2020.03.023 842

(2020). 843

62 Yuen, C. T. L. et al. High-fidelity KKH variant of Staphylococcus aureus Cas9 nucleases 844

with improved base mismatch discrimination. Nucleic Acids Res 50, 1650-1660, 845

doi:10.1093/nar/gkab1291 (2022). 846

63 Akcakaya, P. et al. In vivo CRISPR editing with no detectable genome-wide off-target 847

mutations. Nature 561, 416-419, doi:10.1038/s41586-018-0500-9 (2018). 848

64 Davis, K. M., Pattanayak, V., Thompson, D. B., Zuris, J. A. & Liu, D. R. Small molecule-849

triggered Cas9 protein with improved genome-editing specificity. Nat Chem Biol 11, 316-850

318, doi:10.1038/nchembio.1793 (2015). 851

65 McCown, T. J., Xiao, X., Li, J., Breese, G. R. & Samulski, R. J. Differential and persistent 852

expression patterns of CNS gene transfer by an adeno-associated virus (AAV) vector. 853

Brain Res 713, 99-107, doi:10.1016/0006-8993(95)01488-8 (1996). 854

66 Paterna, J. C., Moccetti, T., Mura, A., Feldon, J. & Büeler, H. Influence of promoter and 855

WHV post-transcriptional regulatory element on AAV-mediated transgene expression in 856

the rat brain. Gene Ther 7, 1304-1311, doi:10.1038/sj.gt.3301221 (2000). 857

67 Zhu, W. et al. Precisely controlling endogenous protein dosage in hPSCs and derivatives 858

to model FOXG1 syndrome. Nat Commun 10, 928, doi:10.1038/s41467-019-08841-7 859

(2019). 860

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

68 Ran, F. A. et al. Genome engineering using the CRISPR-Cas9 system. Nat. Protoc. 8, 861

2281-2308, doi:10.1038/nprot.2013.143 (2013). 862

69 Ran, F. A. et al. In vivo genome editing using Staphylococcus aureus Cas9. Nature 520, 863

186-191, doi:10.1038/nature14299 (2015). 864

70 Wang, D. et al. Cas9-mediated allelic exchange repairs compound heterozygous 865

recessive mutations in mice. Nat Biotechnol 36, 839-842, doi:10.1038/nbt.4219 (2018). 866

71 Duan, Y. et al. The Clustered, Regularly Interspaced, Short Palindromic Repeats-867

associated Endonuclease 9 (CRISPR/Cas9)-created MDM2 T309G Mutation Enhances 868

Vitreous-induced Expression of MDM2 and Proliferation and Survival of Cells. J Biol 869

Chem 291, 16339-16347, doi:10.1074/jbc.M116.729467 (2016). 870

72 Clement, K. et al. CRISPResso2 provides accurate and rapid genome editing sequence 871

analysis. Nat Biotechnol 37, 224-226, doi:10.1038/s41587-019-0032-3 (2019). 872

873

874

875

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

Acknowledgments 876

877

Funding: This work was supported by U.S. NIH R01 DC016875, R01 DC019404, 878

UG3TR002636, U24HG010423, UH3TR002636, Curing Kids Massachusetts Eye & Ear 879

and Ines-Fredrick Yeatts Fund (to Z.-Y.C.), NIH R01 DC019404 (to X.L. and Z.-Y.C.), 880

R01DC012115, R01DC005575, and DOD RH220053 (to X.L.). This work was funded in 881

part by the Wellcome Trust (098051, 100669, 089622; KPS). For the purpose of Open 882

Access, the author has applied a CC BY public copyright license to any Author Accepted 883

Manuscript (AAM) version arising from this submission. 884

We thank the Wellcome Sanger Institute Mouse Genetics Project for generating and 885

providing the Mir96 14C>A mutant mouse. 886

We thank the Harvard Medical School Electron Microscopy Facility for their help on the 887

Scanning Electron Microscopy Imaging. 888

889

890

Author contributions: 891

Conceptualization: ZYC, WZ, WD 892

Methodology: WZ, WD 893

Experiment: WZ, WD, APR, AA, SS, YK, WW 894

Data analysis: all authors 895

Supervision: ZYC 896

Manuscript writing: WZ, WD, ZYC 897

Manuscript review and editing: WZ, WD, APR, AA, SS, YK, WW, YS, XL, MAL, KPS, 898

ZYC 899

900

Competing interests: 901

Z-Y.C is a cofounder of Salubritas Therapeutics Inc. ZY. C, W. Z. and W. D. have filed 902

patent applications based on this work, PCT/US2023/023052. X.L. is a SAB member of 903

Rescue Hearing Inc, and a SAB member of Salubritas Therapeutics. The other authors 904

declare no competing interests. 905

906

907

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

908

909

910

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

911

Main Figures 912

913

Fig. 1. Mir9614C>A mutant mice present adult onset progressive hearing loss. a, 914

Mir96 sequence in human, mouse, macaque and zebrafish and 14C>A mutation. The 915

blue text region shows 100% conservation. The mutation nucleotide in Mir9614C>A is 916

displayed in red. b, Representative Sanger sequencing results showed the Mir96 917

mutation locus in WT mice, Mir9614C>A/+, Mir9614C>A/14C>A. The red arrow indicates the 918

mutated nucleotide. c-e, ABR thresholds in Mir9614C>A/+ ears (red), compared to wild-919

type ears (blue) and Mir9614C>A/14C>A ears (black) at 4 weeks (c), 8 weeks (d), and 12 920

weeks (e), respectively. f-h, DPOAE thresholds in Mir9614C>A/+ ears (red), compared to 921

wild-type ears (blue) and Mir9614C>A/14C>A ears (black) at 4 weeks (f), 8 weeks (g), and 922

12 weeks (h), respectively. i-n, ABR thresholds in Mir9614C>A/+ ears (red), compared to 923

wild-type ears (blue) and Mir9614C>A/14C>A ears (black) at 5.6 kHz (i), 8 kHz (j), 11.3 kHz 924

(k), 16 kHz (l), 22.6 kHz (m) and 32 kHz (n), respectively. Significant hearing loss, 925

shown by the elevated ABR and DPOAE thresholds, was seen at 8 weeks, which 926

became more severe at 12 weeks. N=8. Values and error bars reflect mean ± SD. 927

Statistical analyses were performed by two-way ANOVA with Bonferroni correction for 928

multiple comparisons: P value style, <0.05 (*), <0.01 (**), <0.001(***), <0.0001(****). 929

930

Fig. 2. Mir96 14C>A allele specific genome editing using different CRISPR 931

systems in mouse and human cells. a, Sequence of the Mir96 +14 C>A mutation loci 932

and the sgRNAs designs. The mutated nucleotide in the Mir9614C>A allele is displayed in 933

red. The protospacer adjacent motifs (PAMs) nucleotides are displayed in blue. b, 934

Schematic overview of plasmid constructions for different CRISPR systems used for in 935

vitro screening. c, Experiments design of preparation and genome editing of primary 936

fibroblasts from Mir9614C>A/+ mice. d, Bar chart of the indel frequency in Mir9614C>A/+ and 937

wild-type primary fibroblast after genome editing using different Cas9/sgRNA 938

combinations. n=3. Each dot represents a unique sequencing reaction. Values and error 939

bars reflect mean ± SD. e, f, Representative NGS results from KKH-saCas9/sgRNA-4 940

edited Mir9614C>A/+ and wild-type primary fibroblasts. The red arrow indicates the double-941

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

stranded DNA cutting site. g, Schematic overview of establishment of human MIR96 942

+14 C>A HEK-293T cell line and mouse Mir9614C>A NIH-3T3 cell line using PiggyBac 943

system and genome editing procedure. h, Bar chart showing the editing efficiency of 944

Mir96 mutation locus and wild-type locus using spCas9/sgRNA-1 and KKH-945

saCas9/sgRNA-4 in human MIR96 +14 C>A HEK-293T cells and mice Mir96 +14 C>A 946

NIH-3T3 cells. n=3. Each dot represents a unique sequencing reaction. Values and 947

error bars reflect mean ± SD. i, j, Indel profiles from spCas9/sgRNA-1 and KKH-948

saCas9/sgRNA-4 edited Mir96 +14C>A HEK-293T cells. Minus numbers represent 949

deletions, plus numbers represent insertions. 950

951

Fig. 3. Optimization of CRISPR constructs for inner ear delivery. a, The design of 952

the optimized AAV structure of KKH-saCas9/sgRNA vector with multiple NLS sites. b, c, 953

Sequence of unmodified and optimized KKH-saCas9 sgRNA, with sequence changes in 954

bold. d, Schematic view and representative fluorescence images of tdTomato reporter 955

from primary fibroblasts after editing by unmodified and optimized KKH-saCas9/sgRNA 956

systems. tdTomato+ cells are edited. e, Bar chart showing the editing efficiency by the 957

quantification of tdTomato+ cells after editing. Values and error bars reflect mean ± SD. 958

Each dot represents one independent experiment. 959

960

Fig. 4. AAV2-CRISPR mediated targeted genome editing at Mir9614C>A locus in hair 961

cells of adult Mir9614C>A/+ mice. a, Schematic view of the construction and packaging of 962

AAV2-CMV-KKH-saCas9-sgRNA4 for genome editing in adult mice. b, Experimental 963

overview for in vivo studies. AAV2 was injected in the inner ear of 6-week-old mice, and 964

one group was used for sequencing 4 and 8 weeks later. c, Representative NGS results 965

of cochlea samples from AAV2-KKH-saCas9-sgRNA-4 injected and the contralateral 966

uninjected ears of Mir9614C>A/+ mice. d, Quantification of indel frequency of the NGS 967

results from AAV2-KKH-saCas9-sgRNA-4 injected, AAV2-KKH-saCas9-sgCtrl injected 968

and uninjected ears from Mir9614C>A/+ mice, as well as AAV2-KKH-saCas9-sgRNA-4 969

injected ears from wild-type mice (n=9). Cochleae were collected 4 weeks and 8 weeks 970

after AAV injection. In uninjected mice, background indel frequencies ranged between 971

0% and 0.05%. Each dot represents a unique sequencing reaction from a combination 972

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

of 3 cochleae. Values and error bars reflect mean ± SD. e, Schematic overview of the 973

experimental protocol of hair cell isolation, cell lysis and NGS. f, Representative NGS 974

result of isolated hair cells from AAV2-KKH-saCas9-sgRNA-4 injected cochlea. g, 975

Quantification of Mir9614C>A allele-specific indel frequency from NGS of hair cell and 976

cochlea samples after AAV2-KKH-saCas9-sgRNA-4 injection (n=3 for each). Each dot 977

represents a unique sequencing reaction from 3 cochleae combination. Values and 978

error bars reflect mean ± SD. h, Percentage of Mir96 wild-type allele reads, 14C>A 979

reads, and indel-containing reads in the NGS results from AAV2-KKH-saCas9-sgRNA-4 980

injected hair cells from 3 independent experiments. 981

982

Fig. 5. Sustained hearing rescue by AAV2-KKH-saCas9-sgRNA-4 in adult 983

Mir9614C>A/+ mice. a. Schematic view of workflow of AAV2-KKH-saCas9-sgRNA-4 984

constructions for auditory function assay with the editing complex delivered into adult 985

Mir9614C>A/+ mouse cochleae. b-g. After AAV2-CMV-KKH-saCas9-sgRNA-4 injection 986

into 6-week-old Mir9614C>A/+ ears, significant reductions in ABR (b, d, f) and DPOAE (c, 987

e, g) thresholds were detected in injected (blue) vs. uninjected contralateral ears (red), 988

at 16 weeks age (b-c), 20 weeks age (d-e), and 26 weeks age (f-g). n=10. h-k. 989

Representative ABR waveforms recorded from an injected (left) and an uninjected ear 990

(right) of a mouse of 20 weeks of age at the frequencies of 11.3 kHz (h-i) and 16 kHz (j-991

k). The thresholds were determined by the detection of peak 1 (green color traces). 992

Values and error bars reflect mean ± SEM. Statistical analyses were performed by two-993

way ANOVA with Bonferroni correction for multiple comparisons: P value style, <0.05 994

(*), <0.01 (**), <0.001(***), <0.0001(****). 995

996

Fig. 6. AAV2-KKH-saCas9-sgRNA-4 editing on hair cell survival and maintains 997

stereocilia intergity in Mir9614C>A/+ mice. a, Schematic diagram of experimental 998

design, with confocal analysis and SEM study of the ears harvested 10 weeks and 14 999

weeks post injection, respectively. b-e, Representative confocal z-stack images of 1000

whole mount cochleae from uninjected (c, e) and AAV2-KKH-saCas9-sgRNA-4 injected 1001

(b, d) Mir9614C>A/+ mice. Hair cells were stained for MYO7A (green). Asterisks point to 1002

missing hair cells (i). Scale bar, 20μm. f, g, Quantification and comparison of the 1003

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

number of OHCs (f) and IHCs (g) across the cochlear turns from injected and uninjected 1004

Mir9614C>A/+ mice 10 weeks post injection. Error bar represents SD. h, i, Images of 1005

scanning electron microscopy (SEM) of injected (h) uninjected (i) Mir9614C>A/+ outer hair 1006

cell bundles at the apical turn. The asterisks indicate the missing stereocilia in an outer 1007

hair cell from an uninjected ear. j, k, Images of SEM of injected (j) and uninjected (k) 1008

Mir9614C>A/+ inner hair cell bundles at the apex turn. Scale bar, 2µm. 1009

1010

Fig. 7. Safety assessment of AAV delivery of genome complex in adult mice. a, 1011

qPCR analysis of KKH-saCas9 mRNA level in the injected cochlea and the contralateral 1012

uninjected cochlea (n=6). Each dot represents an independent result from 2 cochleae 1013

combined Values and error bars reflect mean ± SD. b, Western blotting of KKH-saCas9 1014

protein in injected cochlea and the contralateral uninjected cochlea, showing KKH-1015

saCas9 protein level. c, Schematic diagram of the primers and design of AAV vector 1016

integration assay. d, Quantification of indel frequency by NGS results and AAV vector 1017

ITR integration ratio from AAV2-KKH-saCas9-sgRNA-4 edited cells. HEK-293T-miR96-1018

14C>A cells were treated with different doses of AAV for 7 days before analysis. e, Gel 1019

image of the PCR from AAV2-KKH-saCas9-sgRNA-4 edited cochlea, showing the 1020

bands of the Mir96 locus, AAV vector DNA and miR96-ITR integration. f, Gel image of 1021

the PCR products, showing the bands of Mir96 locus, AAV vectors and miR96-ITR 1022

integration of isolated hair cells from injected ears. Asterisk indicates the putative 1023

integration fragment position. g, MiR96-ITR integration reads from NGS of isolated hair 1024

cells from injected ears, the reference is the AAV ITR sequence. h, qPCR analysis of 1025

Mir96 level in injected and uninjected cochlea (n=6). Each dot represents a independent 1026

result from 2 cochleae combined. Values and error bars reflect mean ± SD. i, qPCR 1027

analysis of miR96-ITR RNA level in injected and uninjected cochlea to test if there are 1028

miR96-ITR transcripts in injected cochlea (n=3). Each dot represents an independent 1029

experiment with 2 cochleae. Values and error bars reflect mean ± SD. j, CIRCLEseq 1030

analysis of KKH-saCas9-sgRNA-4 in Mir9614C>A/+ primary fibroblasts genomic DNA. k 1031

Quantification of indel frequency of potential off-target sites from the mouse genome. l 1032

Quantification of indel frequency of potential off-target sites from AAV2-KKH-saCas9-1033

sgRNA-4 injected cochlea. Values and error bars reflect mean ± SD. 1034

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

1035

Fig. 8. A dual AAV carrying multiple gRNAs targeting all known Mir96 seed region 1036

mutations in human cells specifically and efficiently. a, Sequence information of the 1037

human MIR96 locus and the sgRNAs design to target three known seed mutations. 1038

Red: mutatio site. Blue: the protospacer adjacent motifs (PAMs) nucleotides. b, 1039

Schematic view of dual AAV constructions. One contains “U1a-spCas9-polyA” cassette, 1040

the other contains three U6-sgRNA cassettes. c, Sequence of the optimized spCas9 1041

sgRNA, the bold lettersindicate the changes compared to the unmodified sequence. d, 1042

e, Representative NGS results from spCas9/sgmiR96-master edited HEK-miR96 (15A 1043

to T) cells and spCas9/sgmiR96-master edited HEK293T wild type cells. f, g, Indel 1044

profiles from spCas9/sgmiR96-master edited HEK-miR96 (15A to T) cells. Minus 1045

numbers represent deletions, plus numbers represent insertions. h, The indel frequency 1046

in the HEK-miR96 mutation cell lines and wild-type HEK293T cells after genome editing 1047

using spCas9/sgmiR96-master. Each dot represents an independent experiment. 1048

Values and error bars reflect mean ± SD. i, Off-target analysis in spCas9/sgmiR96-1049

master edited HEK-miR96 (15A to T) cells. Genomic DNA was pooled from three 1050

independent biological replicates for sequencing. Values and error bars reflect mean ± 1051

SD. 1052

1053

1054

1055

1056

1057

1058

1059

1060

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

1061

Extended Data 1062

1063

Extended Data Fig. 1 | Targeting Mir9614C>A mutation with different CRISPR 1064

nuclease systems. a, Schematic diagram of plasmid constructions for different 1065

CRISPR systems used for in vitro screening. b, Representative reads of the NGS from 1066

spCas9/sgRNA-1 edited Mir9614C>A/+and wild-type primary fibroblasts. Magenta Dotted 1067

Lines indicate the double stranded DNA cutting site. Green indicates the mutant 1068

nucleotide. c, The indel frequency in Mir9614C>A/+ and wild-type primary fibroblasts after 1069

editing by different delivery methods and editors. Each dot represents an independent 1070

experiment. Values and error bars reflect mean ± SD. 1071

1072

Extended Data Fig. 2 | The correction of Mir9614C>A mutation using prime editing in 1073

human cells. a, Schematic overview of the prime editing system. b, Sequence of the 1074

Mir96 +14 C>A mutation locus and the prime editing design. The mutation nucleotide in 1075

the Mir9614C>A allele is displayed in red. The protospacer adjacent motifs (PAMs) 1076

nucleotides of the pegRNA are displayed in blue. c, A to C correction frequency after 1077

prime editing. Each dot represents an independent experiment. Values and error bars 1078

reflect mean ± SD. d, Representative NGS result after prime editing, showing the 1079

corrected reads. Red arrow indicates the Mir96 +14 C>A mutation nucleotide. 1080

1081

Extended Data Fig. 3 | Genome editing efficiency of optimized AAV vectors. a, 1082

Schematic diagram of AAV2 constructions for GFP delivery used for in vivo delivery into 1083

adult mouse cochleae. b, Representative confocal images of AAV2 transduction in the 1084

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

apical region of adult cochlea. Hair cells were labeled with MYO7A (red) and AAV was 1085

labeled with GFP (green). Scale bar, 20μm. c,d, Transduction efficiency of IHCs (c) and 1086

OHC (d) by AAV2-GFP across different turns of the cochlea (Apex, Apex-Middle, and 1087

Middle-Base). Time of imaging: 22 weeks of age. Values and error bars reflect mean ± 1088

SD, n=3. Each dot represents an independent experiment. e, Representative 1089

fluorescence images of HEK-GFP cells after gemome editing of unmodified and 1090

optimized KKH-saCas9/sgRNA targeting GFP. GFP negative cells are the edited cells. 1091

f, Editing efficiency shown by the percentage of GFP negative cells after genome 1092

editing. Each dot represents an independent experiment. Values and error bars reflect 1093

mean ± SD. 1094

1095

Extended Data Fig. 4 | Genome editing at Mir9614C>A locus in adult Mir9614C>A/+

1096

mice. a-c, Representative NGS results of AAV2-KKH-saCas9-sgRNA-4 injected ears 1097

from Mir9614C>A/+ mice and Mir96+/+ mice, and AAV2-KKH-saCas9-sgCtrl injected ears 1098

from Mir9614C>A/+ mice. d, Representative images of FM1-43FX labeled hair cells after 1099

digestion of cochlear tissues. FM1-43FX labeled hair cells are shown in green. 1100

Arrowheads point to the GFP+ hair cells that were picked for NGS. e, Quantification of 1101

the percentage of indel-containing reads in the NGS results of AAV2-KKH-saCas9-1102

sgRNA-4 edited cochlea samples and isolated hair cells lysis. Values and error bars 1103

reflect mean ± SD. f, g, Representative NGS results of the isolated hair cells from 1104

AAV2-KKH-saCas9-sgRNA-4 injected and uninjected ears of Mir9614C>A/+ mice. 1105

1106

Extended Data Fig. 5 | Age-dependent treatment outcome by editing in Mir9614C>A/+

1107

mice. a, The experimental design of inner ear injections of AAV2-CMV-KKH-saCas9-1108

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

sgRNA-4 in 3-week-old and 6-week-old Mir9614C>A/+ mice followed by hearing test. b-e, 1109

Effects on auditory function restoration. ABR (b, d) and DPOAE (c, e) thresholds in 1110

Mir9614C>A/+ mice treated with AAV2-CMV-KKH-saCas9-sgRNA-4 ears (blue) and 1111

untreated ears (red) at 16 weeks age (b-c) and 26 weeks age (d-e). 1112

1113

Extended Data Fig. 6 | Safety assessment of AAV delivery of editing complex in 1114

adult mice. a, Gel image of the PCR showing the miR96-ITR integration fragment after 1115

different dosages of AAV treatment in HEK-miR96-14C>A cells. b, NGS results of 1116

miR96-ITR integration reads from AAV treated HEK-miR96-14C>A cells. c, The 1117

sequences of potential off-target genetic loci of KKH-saCas9/sgRNA-4 in mouse 1118

genome. None of these loci were associated with hearing function. d, The NGS result of 1119

off-target editing at the OT1 locus showed a low level of indel formation. 1120

1121

Extended Data Fig. 7 | Low titer AAV2 eliminated AAV vector integration. a, Gel 1122

image of the PCR showing the KKH-saCas9 expression and miR96-ITR integration 1123

fragment after 1×109 vg AAV2 treatment. b, c, Representative NGS results and pie 1124

chart analysis of 1×109 vg AAV2-KKH-saCas9-sgRNA-4 injected ears from Mir9614C>A/+ 1125

mice. 1126

1127

1128

Extended Data Fig. 8 | Efficient genome editing targeting multiple MIR96 seed 1129

region mutations in human cells. a, Representative NGS results from 1130

spCas9/sgmiR96-master edited HEK-miR96 (13G to A) cells. b, c, Indel profiles from 1131

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

spCas9/sgmiR96-master edited HEK-miR96 (13G to A) cells. Minus numbers represent 1132

deletions, plus numbers represent insertions. d, Representative NGS results from 1133

spCas9/sgmiR96-master edited HEK-miR96 (14C to A) cells. e, f, Indel profiles from 1134

spCas9/sgmiR96-master edited HEK-miR96 (14C to A) cells. Minus numbers represent 1135

deletions, plus numbers represent insertions. g, The sequences of potential off-target 1136

genetic loci of spCas9/sgmiR96-master in human genome. None of these loci were 1137

associated with hearing function. 1138

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

Figure 1 1139

1140

1141

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

Figure 2 1142

1143

1144

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

Figure 3 1145

1146

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

Figure 4 1147

1148

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

Figure 5 1149

1150

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

Figure 6 1151

1152

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

Figure 7 1153

1154

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

Figure 8 1155

1156

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

Extended Data Figure 1 1157

1158

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

Extended Data Figure 2 1159

1160

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

Extended Data Figure 3 1161

1162

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

Extended Data Figure 4 1163

1164

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

Extended Data Figure 5 1165

1166

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

Extended Data Figure 6 1167

1168

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

Extended Data Figure 7 1169

1170

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

Extended Data Figure 8 1171

1172

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

Supplementary Information 1173

1174

1175

1176

Targeted genome editing restores auditory function in adult mice with 1177

progressive hearing loss caused by a human microRNA mutation 1178

1179

Wenliang Zhu1,2,8, Wan Du1,2,8, Arun Prabhu Rameshbabu1,2, Ariel Miura Armstrong1,2, 1180

Stewart Silver1,2, Yehree Kim1,2, Wei Wei1,2, Yilai Shu3,4,5, Xuezhong Liu6, Morag A 1181

Lewis7, Karen P. Steel7, Zheng-Yi Chen1, 2 * 1182

1183

1 Department of Otolaryngology-Head and Neck Surgery, Graduate Program in Speech 1184

and Hearing Bioscience and Technology and Program in Neuroscience, Harvard 1185

Medical School, Boston, USA. 1186

2 Eaton-Peabody Laboratory, Massachusetts Eye and Ear Infirmary, Boston, USA. 1187

3 ENT Institute and Otorhinolaryngology Department of Eye & ENT Hospital, State Key 1188

Laboratory of Medical Neurobiology and MOE Frontiers Center for Brain Science, 1189

Fudan University, Shanghai, 200031, China. 1190

4 Institutes of Biomedical Science, Fudan University, Shanghai, 200032, China. 1191

5 NHC Key Laboratory of Hearing Medicine, Fudan University, Shanghai, 200031, 1192

China. 1193

6 Department of Otolaryngology, University of Miami School of Medicine, Miami, FL, 1194

33136, USA. 1195

7 Wolfson Sensory, Pain and Regeneration Centre, King’s College London, London, UK. 1196

8 These authors contributed equally: Wenliang Zhu, Wan Du 1197

* Corresponding author. Email: zheng-yi_chen@meei.harvard.edu (Z.C.) 1198

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

1199

AAV-CMV-KKH-saCas9-sgRNA-4: 1200

1201

CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGC1202

GAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCCTCTAGACTCGAGGCGTTGACATTGATT1203

ATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAA1204

ATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGG1205

ACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACG1206

CCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAG1207

TACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCA1208

CGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGT1209

AACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCTCTGGCTAACTAG1210

CCACCATGGGCAAACGCCCAGCAGCTACAAAGAAGGCAGGTCAAGCCAAGAAAAAGAAAggaGCCCCAAAGAAGAAGCGGAAG1211

GTCGGTtccAAGCGGAACTACATCCTGGGCCTGGACATCGGCATCACCAGCGTGGGCTACGGCATCATCGACTACGAGACACG1212

GGACGTGATCGATGCCGGCGTGCGGCTGTTCAAAGAGGCCAACGTGGAAAACAACGAGGGCAGGCGGAGCAAGAGAGGCGC1213

CAGAAGGCTGAAGCGGCGGAGGCGGCATAGAATCCAGAGAGTGAAGAAGCTGCTGTTCGACTACAACCTGCTGACCGACCAC1214

AGCGAGCTGAGCGGCATCAACCCCTACGAGGCCAGAGTGAAGGGCCTGAGCCAGAAGCTGAGCGAGGAAGAGTTCTCTGCC1215

GCCCTGCTGCACCTGGCCAAGAGAAGAGGCGTGCACAACGTGAACGAGGTGGAAGAGGACACCGGCAACGAGCTGTCCACC1216

AAAGAGCAGATCAGCCGGAACAGCAAGGCCCTGGAAGAGAAATACGTGGCCGAACTGCAGCTGGAACGGCTGAAGAAAGACG1217

GCGAAGTGCGGGGCAGCATCAACAGATTCAAGACCAGCGACTACGTGAAAGAAGCCAAACAGCTGCTGAAGGTGCAGAAGGC1218

CTACCACCAGCTGGACCAGAGCTTCATCGACACCTACATCGACCTGCTGGAAACCCGGCGGACCTACTATGAGGGACCTGGC1219

GAGGGCAGCCCCTTCGGCTGGAAGGACATCAAAGAATGGTACGAGATGCTGATGGGCCACTGCACCTACTTCCCCGAGGAAC1220

TGCGGAGCGTGAAGTACGCCTACAACGCCGACCTGTACAACGCCCTGAACGACCTGAACAATCTCGTGATCACCAGGGACGA1221

GAACGAGAAGCTGGAATATTACGAGAAGTTCCAGATCATCGAGAACGTGTTCAAGCAGAAGAAGAAGCCCACCCTGAAGCAGA1222

TCGCCAAAGAAATCCTCGTGAACGAAGAGGATATTAAGGGCTACAGAGTGACCAGCACCGGCAAGCCCGAGTTCACCAACCTG1223

AAGGTGTACCACGACATCAAGGACATTACCGCCCGGAAAGAGATTATTGAGAACGCCGAGCTGCTGGATCAGATTGCCAAGAT1224

CCTGACCATCTACCAGAGCAGCGAGGACATCCAGGAAGAACTGACCAATCTGAACTCCGAGCTGACCCAGGAAGAGATCGAG1225

CAGATCTCTAATCTGAAGGGCTATACCGGCACCCACAACCTGAGCCTGAAGGCCATCAACCTGATCCTGGACGAGCTGTGGCA1226

CACCAACGACAACCAGATCGCTATCTTCAACCGGCTGAAGCTGGTGCCCAAGAAGGTGGACCTGTCCCAGCAGAAAGAGATCC1227

CCACCACCCTGGTGGACGACTTCATCCTGAGCCCCGTCGTGAAGAGAAGCTTCATCCAGAGCATCAAAGTGATCAACGCCATC1228

ATCAAGAAGTACGGCCTGCCCAACGACATCATTATCGAGCTGGCCCGCGAGAAGAACTCCAAGGACGCCCAGAAAATGATCAA1229

CGAGATGCAGAAGCGGAACCGGCAGACCAACGAGCGGATCGAGGAAATCATCCGGACCACCGGCAAAGAGAACGCCAAGTAC1230

CTGATCGAGAAGATCAAGCTGCACGACATGCAGGAAGGCAAGTGCCTGTACAGCCTGGAAGCCATCCCTCTGGAAGATCTGCT1231

GAACAACCCCTTCAACTATGAGGTGGACCACATCATCCCCAGAAGCGTGTCCTTCGACAACAGCTTCAACAACAAGGTGCTCGT1232

GAAGCAGGAAGAAAACAGCAAGAAGGGCAACCGGACCCCATTCCAGTACCTGAGCAGCAGCGACAGCAAGATCAGCTACGAA1233

ACCTTCAAGAAGCACATCCTGAATCTGGCCAAGGGCAAGGGCAGAATCAGCAAGACCAAGAAAGAGTATCTGCTGGAAGAACG1234

GGACATCAACAGGTTCTCCGTGCAGAAAGACTTCATCAACCGGAACCTGGTGGATACCAGATACGCCACCAGAGGCCTGATGA1235

ACCTGCTGCGGAGCTACTTCAGAGTGAACAACCTGGACGTGAAAGTGAAGTCCATCAATGGCGGCTTCACCAGCTTTCTGCGG1236

CGGAAGTGGAAGTTTAAGAAAGAGCGGAACAAGGGGTACAAGCACCACGCCGAGGACGCCCTGATCATTGCCAACGCCGATT1237

TCATCTTCAAAGAGTGGAAGAAACTGGACAAGGCCAAAAAAGTGATGGAAAACCAGATGTTCGAGGAAAAGCAGGCCGAGAGC1238

ATGcctgagatcgagacagagcaggaatacaaggaaattttcatcacccctcatcagattaaacacataaaggacttcaaagactataaatactctcatagggtggacaaaaaaccca1239

atcgcaagctcattaatgacaccctgtactcaacacggaaggatgataaaggtaataccttgattgtgaataatcttaatggattgtatgacaaagataacgacaagctcaagaagctgatc1240

aacaagtctccagagaagctccttatgtatcaccacgacccacagacttatcagaaattgaaactgatcatggagcaatacggggatgagaagaacccactctacaaatattatgagga1241

aacaggtaattacctgaccaagtactccaagaaggataacggaccagtgatcaaaaagataaagtactatggcaacaaacttaatgcgcatttggacataactgacgattaccccaattc1242

tcgaaacaaggttgtgaagctctccctgaagccttatagatttgacgtgtacctggataatggggtttataaattcgtcaccgtgaaaaatctggacgtgatcaaaaaggagaactattatgaa1243

gtaaactcaaagtgctatgaggaggcgaagaagctgaagaagatctccaatcaggccgagttcatcgcttccttctataagaacgatctcatcaagatcaatggagagctttatcgcgtcat1244

tggtgtgaacaatgacttgctgaacaggatcgaagtcaatatgatagacattacctaccgggagtatctcgaaaacatgaatgataaacggccgcctcacatcatcaagacaatcgcatct1245

aaaactcagtcaataaaaaagtactctaccgatatcctggggaatctctatgaagtgaagtcaaagaagcacccacaaatcattaaaaaaggtAAAAGGCCGGCGGCCAC1246

GAAAAAGGCCGGCCAGGCAAAAAAGAAAAAGGGATCCTACCCATACGATGTTCCAGATTACGCTTAAGAATTCGCTGATCAGCC1247

TCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACT1248

GTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGAC1249

AGCAAGGGGGAGGATTGGGAAGAGAATAGCAGGCATGCTGGGGAGGTACCGAGGGCCTATTTCCCATGATTCCTTCATATTTG1250

CATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTA1251

GAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATT1252

TCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGAAGCAAAAATGTGCTAGTTCgttAtagtactctgtaatgaaaattacaga1253

atctactaTaacaaggcaaaatgccgtgtttatctcgtcaacttgttggcgagaTTTTTTTGCGGCCGCAGGAACCCCTAGTGATGGAGTTGGCCACTCCC1254

TCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTG1255

AGCGAGCGAGCGCGCAGCTGCCTGCAGG 1256

1257

ITR, CMV Promoter, NLSs, KKH-saCas9 coding sequence, HA Tag, PloyA, U6 Promoter, sgRNA 1258

1259

Supplementary Fig. 1 | DNA sequence of AAV-CMV-KKH-saCas9-sgRNA-4. 1260

1261

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

AAV-U1A-spCas9-PA: 1262

1263

CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGC1264

GAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCCTCTAGAATGGAGGCGGTACTATGTAGA1265

TGAGAATTCAGGAGCAAACTGGGAAAAGCAACTGCTTCCAAATATTTGTGATTTTTACAGTGTAGTTTTGGAAAAACTCTTAGCC1266

TACCAATTCTTCTAAGTGTTTTAAAATGTGGGAGCCAGTACACATGAAGTTATAGAGTGTTTTAATGAGGCTTAAATATTTACCGT1267

AACTATGAAATGCTACGCATATCATGCTGTTCAGGCTCCGTGGCCACGCAACTCATACTACCGGtgCCACCATGGGCAAACGCC1268

CAGCAGCTACAAAGAAGGCAGGTCAAGCCAAGAAAAAGAAAggaGCCCCAAAGAAGAAGCGGAAGGTCGGTGGAtccGACAAGA1269

AGTACAGCATCGGCCTGGACATCGGCACCAACTCTGTGGGCTGGGCCGTGATCACCGACGAGTACAAGGTGCCCAGCAAGAA1270

ATTCAAGGTGCTGGGCAACACCGACCGGCACAGCATCAAGAAGAACCTGATCGGAGCCCTGCTGTTCGACAGCGGCGAAACA1271

GCCGAGGCCACCCGGCTGAAGAGAACCGCCAGAAGAAGATACACCAGACGGAAGAACCGGATCTGCTATCTGCAAGAGATCT1272

TCAGCAACGAGATGGCCAAGGTGGACGACAGCTTCTTCCACAGACTGGAAGAGTCCTTCCTGGTGGAAGAGGATAAGAAGCAC1273

GAGCGGCACCCCATCTTCGGCAACATCGTGGACGAGGTGGCCTACCACGAGAAGTACCCCACCATCTACCACCTGAGAAAGA1274

AACTGGTGGACAGCACCGACAAGGCCGACCTGCGGCTGATCTATCTGGCCCTGGCCCACATGATCAAGTTCCGGGGCCACTT1275

CCTGATCGAGGGCGACCTGAACCCCGACAACAGCGACGTGGACAAGCTGTTCATCCAGCTGGTGCAGACCTACAACCAGCTG1276

TTCGAGGAAAACCCCATCAACGCCAGCGGCGTGGACGCCAAGGCCATCCTGTCTGCCAGACTGAGCAAGAGCAGACGGCTGG1277

AAAATCTGATCGCCCAGCTGCCCGGCGAGAAGAAGAATGGCCTGTTCGGAAACCTGATTGCCCTGAGCCTGGGCCTGACCCC1278

CAACTTCAAGAGCAACTTCGACCTGGCCGAGGATGCCAAACTGCAGCTGAGCAAGGACACCTACGACGACGACCTGGACAAC1279

CTGCTGGCCCAGATCGGCGACCAGTACGCCGACCTGTTTCTGGCCGCCAAGAACCTGTCCGACGCCATCCTGCTGAGCGACA1280

TCCTGAGAGTGAACACCGAGATCACCAAGGCCCCCCTGAGCGCCTCTATGATCAAGAGATACGACGAGCACCACCAGGACCT1281

GACCCTGCTGAAAGCTCTCGTGCGGCAGCAGCTGCCTGAGAAGTACAAAGAGATTTTCTTCGACCAGAGCAAGAACGGCTACG1282

CCGGCTACATTGACGGCGGAGCCAGCCAGGAAGAGTTCTACAAGTTCATCAAGCCCATCCTGGAAAAGATGGACGGCACCGA1283

GGAACTGCTCGTGAAGCTGAACAGAGAGGACCTGCTGCGGAAGCAGCGGACCTTCGACAACGGCAGCATCCCCCACCAGATC1284

CACCTGGGAGAGCTGCACGCCATTCTGCGGCGGCAGGAAGATTTTTACCCATTCCTGAAGGACAACCGGGAAAAGATCGAGAA1285

GATCCTGACCTTCCGCATCCCCTACTACGTGGGCCCTCTGGCCAGGGGAAACAGCAGATTCGCCTGGATGACCAGAAAGAGC1286

GAGGAAACCATCACCCCCTGGAACTTCGAGGAAGTGGTGGACAAGGGCGCTTCCGCCCAGAGCTTCATCGAGCGGATGACCA1287

ACTTCGATAAGAACCTGCCCAACGAGAAGGTGCTGCCCAAGCACAGCCTGCTGTACGAGTACTTCACCGTGTATAACGAGCTG1288

ACCAAAGTGAAATACGTGACCGAGGGAATGAGAAAGCCCGCCTTCCTGAGCGGCGAGCAGAAAAAGGCCATCGTGGACCTGC1289

TGTTCAAGACCAACCGGAAAGTGACCGTGAAGCAGCTGAAAGAGGACTACTTCAAGAAAATCGAGTGCTTCGACTCCGTGGAA1290

ATCTCCGGCGTGGAAGATCGGTTCAACGCCTCCCTGGGCACATACCACGATCTGCTGAAAATTATCAAGGACAAGGACTTCCT1291

GGACAATGAGGAAAACGAGGACATTCTGGAAGATATCGTGCTGACCCTGACACTGTTTGAGGACAGAGAGATGATCGAGGAAC1292

GGCTGAAAACCTATGCCCACCTGTTCGACGACAAAGTGATGAAGCAGCTGAAGCGGCGGAGATACACCGGCTGGGGCAGGCT1293

GAGCCGGAAGCTGATCAACGGCATCCGGGACAAGCAGTCCGGCAAGACAATCCTGGATTTCCTGAAGTCCGACGGCTTCGCC1294

AACAGAAACTTCATGCAGCTGATCCACGACGACAGCCTGACCTTTAAAGAGGACATCCAGAAAGCCCAGGTGTCCGGCCAGGG1295

CGATAGCCTGCACGAGCACATTGCCAATCTGGCCGGCAGCCCCGCCATTAAGAAGGGCATCCTGCAGACAGTGAAGGTGGTG1296

GACGAGCTCGTGAAAGTGATGGGCCGGCACAAGCCCGAGAACATCGTGATCGAAATGGCCAGAGAGAACCAGACCACCCAGA1297

AGGGACAGAAGAACAGCCGCGAGAGAATGAAGCGGATCGAAGAGGGCATCAAAGAGCTGGGCAGCCAGATCCTGAAAGAACA1298

CCCCGTGGAAAACACCCAGCTGCAGAACGAGAAGCTGTACCTGTACTACCTGCAGAATGGGCGGGATATGTACGTGGACCAG1299

GAACTGGACATCAACCGGCTGTCCGACTACGATGTGGACCATATCGTGCCTCAGAGCTTTCTGAAGGACGACTCCATCGACAA1300

CAAGGTGCTGACCAGAAGCGACAAGAACCGGGGCAAGAGCGACAACGTGCCCTCCGAAGAGGTCGTGAAGAAGATGAAGAAC1301

TACTGGCGGCAGCTGCTGAACGCCAAGCTGATTACCCAGAGAAAGTTCGACAATCTGACCAAGGCCGAGAGAGGCGGCCTGA1302

GCGAACTGGATAAGGCCGGCTTCATCAAGAGACAGCTGGTGGAAACCCGGCAGATCACAAAGCACGTGGCACAGATCCTGGA1303

CTCCCGGATGAACACTAAGTACGACGAGAATGACAAGCTGATCCGGGAAGTGAAAGTGATCACCCTGAAGTCCAAGCTGGTGT1304

CCGATTTCCGGAAGGATTTCCAGTTTTACAAAGTGCGCGAGATCAACAACTACCACCACGCCCACGACGCCTACCTGAACGCC1305

GTCGTGGGAACCGCCCTGATCAAAAAGTACCCTAAGCTGGAAAGCGAGTTCGTGTACGGCGACTACAAGGTGTACGACGTGC1306

GGAAGATGATCGCCAAGAGCGAGCAGGAAATCGGCAAGGCTACCGCCAAGTACTTCTTCTACAGCAACATCATGAACTTTTTCA1307

AGACCGAGATTACCCTGGCCAACGGCGAGATCCGGAAGCGGCCTCTGATCGAGACAAACGGCGAAACCGGGGAGATCGTGTG1308

GGATAAGGGCCGGGATTTTGCCACCGTGCGGAAAGTGCTGAGCATGCCCCAAGTGAATATCGTGAAAAAGACCGAGGTGCAG1309

ACAGGCGGCTTCAGCAAAGAGTCTATCCTGCCCAAGAGGAACAGCGATAAGCTGATCGCCAGAAAGAAGGACTGGGACCCTAA1310

GAAGTACGGCGGCTTCGACAGCCCCACCGTGGCCTATTCTGTGCTGGTGGTGGCCAAAGTGGAAAAGGGCAAGTCCAAGAAA1311

CTGAAGAGTGTGAAAGAGCTGCTGGGGATCACCATCATGGAAAGAAGCAGCTTCGAGAAGAATCCCATCGACTTTCTGGAAGC1312

CAAGGGCTACAAAGAAGTGAAAAAGGACCTGATCATCAAGCTGCCTAAGTACTCCCTGTTCGAGCTGGAAAACGGCCGGAAGA1313

GAATGCTGGCCTCTGCCGGCGAACTGCAGAAGGGAAACGAACTGGCCCTGCCCTCCAAATATGTGAACTTCCTGTACCTGGCC1314

AGCCACTATGAGAAGCTGAAGGGCTCCCCCGAGGATAATGAGCAGAAACAGCTGTTTGTGGAACAGCACAAGCACTACCTGGA1315

CGAGATCATCGAGCAGATCAGCGAGTTCTCCAAGAGAGTGATCCTGGCCGACGCTAATCTGGACAAAGTGCTGTCCGCCTACA1316

ACAAGCACCGGGATAAGCCCATCAGAGAGCAGGCCGAGAATATCATCCACCTGTTTACCCTGACCAATCTGGGAGCCCCTGCC1317

GCCTTCAAGTACTTTGACACCACCATCGACCGGAAGAGGTACACCAGCACCAAAGAGGTGCTGGACGCCACCCTGATCCACCA1318

GAGCATCACCGGCCTGTACGAGACACGGATCGACCTGTCTCAGCTGGGAGGCGACAAAAGGCCGGCGGCCACGAAAAAGGC1319

CGGCCAGGCAAAAAAGAAAAAGTGAGGAtccAATAAAGGAAATTTATTTTCATTGCAATAGTGTGTTGGAATTTTTTGTGTCTCTCA1320

GCAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCC1321

CGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG 1322

1323

ITR, U1A Promoter, NLSs, spCas9 coding sequence, PloyA 1324

1325

Supplementary Fig. 2 | DNA sequence of AAV-U1A-spCas9-PA. 1326

1327

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

AAV-sgmir96-Master: 1328

1329

CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGC1330

GAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCCGCACGCGTGAGGGCCTATTTCCCATG1331

ATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACA1332

AAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGT1333

AACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGAATGTGCTAGTTCCAAAATGTTTCAGA1334

GCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT1335

TCTAGAGGGTACCGGGGCCCGGTCGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTT1336

CCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATG1337

TTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATC1338

AAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCT1339

TATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGG1340

GCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCA1341

ACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAA1342

GCAGAGCTGGTTTAGTGAACCGTCAGATCCGCTAGCGCTACCGGTCGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACC1343

GGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGAT1344

GCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCC1345

TGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGG1346

CTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACC1347

CTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACA1348

ACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGAC1349

GGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTAC1350

CTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCG1351

GGATCACTCTCGGCATGGACGAGCTGTACAAGTCCGGACTCAGATCTCGATAACCTGCAGCGAATTCGATATCAAGCTTATCGA1352

TACCGAGCGCTGCTCGAGAGATCTACGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACT1353

CCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGGGGTGGA1354

GGGGGGTGGTATGGAGCAAGGGGCAAGTTGGGAAGACAACCTGTAGGGCCTGCGGGGTCTATTGGGAACCAAGCTGGAGTG1355

CAGTGGCACAATCTTGGCTCACTGCAATCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTTGTTGGGAT1356

TCCAGGCATGCATGACCAGGCTCAGCTAATTTTTGTTTTTTTGGTAGAGACGGGGTTTCACCATATTGGCCAGGCTGGTCTCCA1357

ACTCCTAATCTCAGGTGATCTACCCACCTTGGCCTCCCAAATTGCTGGGATTACAGGCGTGAACCACTGCTCCCTTCCCTGTCC1358

TTCTGATTTTGTAGGTAACCACGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAG1359

AGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGT1360

TTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTT1361

GTGGAAAGGACGAAACACCGAATGTGCTAGTGTCAAAATGTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGC1362

TAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTCAGGAAACAGCTATGACACGCGTGAGGGCCTATTTC1363

CCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTA1364

GTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTT1365

ACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGAATGTGCTAGAGCCAAAATGT1366

TTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC1367

TTTTTTGTGCGGACCGAGCGGCCGCAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGA1368

GGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGC1369

AGG 1370

1371

ITR, CMV Promoter, EGFP, PloyA, U6 Promoter, sg14C, sg13G, sg15A 1372

1373

Supplementary Fig. 3 | DNA sequence of AAV- sgmir96-Master. 1374

1375

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

1376

1377

1378

1379

Supplementary Fig. 4 | Uncropped images of western blots. 1380

1381

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

Name

Sequence (5'-3')

rtmri96

CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCAAAAATGTG

qmiR96-F

TCGGCAGGTTTGGAACTAGCAC

qmiR96-R

CTCAACTGGTGTCGTGGA

ACAGAGCAGAGACAGATCCGCGAG

TGAGACACACAGACCCTGGGATG

GCTTCAACAACAAGGTGCTCGTG

CTGTTGATGTCCCGTTCTTCCAG

AAV ITR

GGAACCCCTAGTGATGGAGTT

mus-mir96-NGS-F

ACAGAGCAGAGACAGATCCGCGAG

mus-mir96-NGS-R

TGAGACACACAGACCCTGGGATG

hu-mir96-NGS-F

TCCGGAGCACCTTACCCACTTCTG

hu-mir96-NGS-R

GCTGGGGCCCTGACACAAGGATG

1382

Supplementary Table. 1 | Primers used in this study. 1383

1384

1385

Primer

Sequence (5'-3')

Primer

Sequence (5'-3')

hsp-OT1-F

CGGGATTTCACCATATTGGTCAGG

hsp-OT1-R

TGGTCTCGAACTCCTGACCTCAAG

hsp-OT2-F

AAGTGATGCATAAAACCTCGTGGG

hsp-OT2-R

TGAGGTTTCACCATGTTGGCCAGG

hsp-OT3-F

TGATTCCTAGGTCCTCTTTCACAG

hsp-OT3-R

GAGAGTGACAAGAAAGCTTCTATG

hsp-OT4-F

GTCCAAAGTCTCATCTGAGACAAG

hsp-OT4-R

AGCGTACCGTGGGTGTGAGACATG

hsp-OT5-F

AATAGCAGCAAACACCTAATAGGG

hsp-OT5-R

CATCAGGACTTTCAGATGACACAG

hsp-OT6-F

GCAAATAAATGATACACAAAGATG

hsp-OT6-R

TAAACATGATTGTCAATTTGGAGG

hsp-OT7-F

ACACAAAGACGACACGCCTGACAG

hsp-OT7-R

CATCTTAATCTGTTAGGCTGATGG

hsp-OT8-F

TTCAAAACAAAGGGTGTTTGGGGC

hsp-OT8-R

ATGTTCTTTTCCTGTGACCTCCTG

hsp-OT9-F

TACATTCACACACATACACACACG

hsp-OT10-F

ACACTGTAGAAACTCTGTTATTAG

hsp-OT10-F

ACACTGTAGAAACTCTGTTATTAG

hsp-OT10-R

GAGCCATAATATACTGAAGATCAG

msa-OT1-F

TGCACTGGGAAACTGAGCAAATAG

msa-OT1-R

TCTTGAATCCCAGTCACATCATTC

msa-OT2-F

GCTGGGATCTAAGTTTGATTGCTG

msa-OT2-R

AACACTAGGATGATGTTTAGAGGC

msa -OT3-F

AAGGTGGTCAGAACTTAGAGTTTG

msa -OT3-R

AAAGCTCATTTCAAACAAAGATCG

msa-OT4-F

TTTGGGCTCCTGCCATACTCTGTG

msa-OT4-R

GGAGAGTGGCCAGGAAAGCTAGTG

msa-OT5-F

AGTACCTAAAATATATACCCTAAG

msa-OT5-R

CAGTGGGTCCCCACATGCTCAGAG

msa-OT6-F

CTGACTTCATACTATGAATATGGG

msa-OT6-R

TTGCTACTGTTATGAATCGTAATG

msa-OT7-F

ATCTACAAAGCGTTGAACCTCGGG

msa-OT7-R

GATGTCTCTCTAAGATCCAGTGAG

msa-OT8-F

TCACTGTAGCCATTTCTCATGCAG

msa-OT8-R

CTGGTCTGTCTATAATTTAGTTGG

msa-OT9-F

ACTGGTACTAGAGCTATCTCTTCC

msa-OT9-R

ATGTAAGTGTATATATGTATATCTG

msa-OT10-F

CAGGCAGGCTGGCTGGAGCAGCAG

msa-OT10-R

CCTGAGCAATTATTAACTAGGCTG

1386

Supplementary Table. 2 | Primers used for offtarget analysis in this study. 1387

1388

1389

Name

Sequence (5'-3')

sgRNA-1

AAATGTGCTAGTTCCAAAAT CGG

sgRNA-2

AAAATGTGCTAGTTCCAAAA TCG

sgRNA-3

AAAATGTGCTAGTTCCAAAA TCGG

sgRNA-4

CAAGCAAAAATGTGCTAGTTC CAAAAT

sgtdT-1

CAGACATGATAAGATACATTG ATGAGT

sgtdT-2

GTATGGCTGATTATGATCCTC TAGAGT

sg13

AAATGTGCTAGTGTCAAAAT CGG

sg15

AAATGTGCTAGAGCCAAAAT CGG

1390

Supplementary Table. 3 | sgRNA protospacer sequences used in this study. Red fonts indicate the 1391

PAM sequence. 1392

1393

1394

The copyright holder for this preprintthis version posted October 28, 2023. ; https://doi.org/10.1101/2023.10.26.564008doi: bioRxiv preprint

ResearchGate has not been able to resolve any citations for this publication.

Treatment of monogenic and digenic dominant genetic hearing loss by CRISPR-Cas9 ribonucleoprotein delivery in vivo

Article

Full-text available

Aug 2023

Mutations in Atp2b2, an outer hair cell gene, cause dominant hearing loss in humans. Using a mouse model Atp2b2Obl/+, with a dominant hearing loss mutation (Oblivion), we show that liposome-mediated in vivo delivery of CRISPR-Cas9 ribonucleoprotein complexes leads to specific editing of the Obl allele. Large deletions encompassing the Obl locus and indels were identified as the result of editing. In vivo genome editing promotes outer hair cell survival and restores their function, leading to hearing recovery. We further show that in a double-dominant mutant mouse model, in which the Tmc1 Beethoven mutation and the Atp2b2 Oblivion mutation cause digenic genetic hearing loss, Cas9/sgRNA delivery targeting both mutations leads to partial hearing recovery. These findings suggest that liposome-RNP delivery can be used as a strategy to recover hearing with dominant mutations in OHC genes and with digenic mutations in the auditory hair cells, potentially expanding therapeutics of gene editing to treat hearing loss.

Rescue of auditory function by a single administration of AAV-TMPRSS3 gene therapy in aged mice of human recessive deafness DFNB8

Article

Full-text available

May 2023
MOL THER

Patients with mutations in the TMPRSS3 gene suffer from recessive deafness DFNB8/DFNB10. For these patients, cochlear implantation is the only treatment option. Poor cochlear implantation outcomes are seen in some patients. To develop biological treatment for TMPRSS3 patients, we generated a knockin mouse model with a frequent human DFNB8 TMPRSS3 mutation. The Tmprss3A306T/A306T homozygous mice display delayed onset progressive hearing loss similar to human DFNB8 patients. Using AAV2 as a vector to carry a human TMPRSS3 gene, AAV2-hTMPRSS3 injection in the adult knockin mouse inner ear results in TMPRSS3 expression in the hair cells and the spiral ganglion neurons. A single AAV2-hTMPRSS3 injection in Tmprss3A306T/A306T mice of an average age of 18.5 months leads to sustained rescue of the auditory function to a level similar to wild-type mice. AAV2-hTMPRSS3 delivery rescues the hair cells and the spiral ganglions neurons. This study demonstrates successful gene therapy in an aged mouse model of human genetic deafness. It lays the foundation to develop AAV2-hTMPRSS3 gene therapy to treat DFNB8 patients, as a standalone therapy or in combination with cochlear implantation.

Precise detection of CRISPR/Cas9 editing in hair cells in the treatment of autosomal dominant hearing loss

Article

Full-text available

Jul 2022

Gene therapy would benefit from the effective editing of targeted cells with CRISPR/Cas9 tools. However, it is difficult to precisely assess the editing performance in vivo because the tissues contain many non-targeted cells, which is one of the major barriers to clinical translation. Here, in the Atoh1-GFP;Kcnq4+/G229D mice, recapitulating a novel mutation we identified in a hereditary hearing loss pedigree, the high-efficiency editing of CRISPR/Cas9 in hair cells (34.10% on average) was precisely detected by sorting out labeled cells compared with only 1.45% efficiency in the whole cochlear tissue. After injection of the developed AAV_SaCas9-KKH_sgRNA agents, the Kcnq4+/G229D mice showed significantly lower ABR and DPOAE thresholds, shorter ABR wave I latencies, higher ABR wave I amplitudes, increased number of surviving outer hair cells (OHCs) and more hyperpolarized resting membrane potentials of OHCs. These findings provide an innovative approach to accurately assess the underestimated editing efficiency of CRISPR/Cas9 in vivo and offer a promising strategy for the treatment of KCNQ4-related deafness.

In vivo outer hair cell gene editing ameliorates progressive hearing loss in dominant-negative Kcnq4 murine model

Article

Full-text available

Feb 2022
thno

Outer hair cell (OHC) degeneration is a major cause of progressive hearing loss and presbycusis. Despite the high prevalence of these disorders, targeted therapy is currently not available. Methods: We generated a mouse model harboring Kcnq4W276S/+ to recapitulate DFNA2, a common genetic form of progressive hearing loss accompanied by OHC degeneration. After comprehensive optimization of guide RNAs, Cas9s, vehicles, and delivery routes, we applied in vivo gene editing strategy to disrupt the dominant-negative allele in Kcnq4 and prevent progressive hearing loss. Results: In vivo gene editing using a dual adeno-associated virus package targeting OHCs significantly improved auditory thresholds in auditory brainstem response and distortion-product otoacoustic emission. In addition, we developed a new live-cell imaging technique using thallium ions to investigate the membrane potential of OHCs and successfully demonstrated that mutant allele disruption resulted in more hyperpolarized OHCs, indicating elevated KCNQ4 channel activity. Conclusion: These findings can facilitate the development of targeted therapies for DFNA2 and support the use of CRISPR-based gene therapy to rectify defects in OHCs.

Engineered pegRNAs improve prime editing efficiency

Article

Full-text available

Mar 2022
NAT BIOTECHNOL

Prime editing enables the installation of virtually any combination of point mutations, small insertions or small deletions in the DNA of living cells. A prime editing guide RNA (pegRNA) directs the prime editor protein to the targeted locus and also encodes the desired edit. Here we show that degradation of the 3′ region of the pegRNA that contains the reverse transcriptase template and the primer binding site can poison the activity of prime editing systems, impeding editing efficiency. We incorporated structured RNA motifs to the 3′ terminus of pegRNAs that enhance their stability and prevent degradation of the 3′ extension. The resulting engineered pegRNAs (epegRNAs) improve prime editing efficiency 3–4-fold in HeLa, U2OS and K562 cells and in primary human fibroblasts without increasing off-target editing activity. We optimized the choice of 3′ structural motif and developed pegLIT, a computational tool to identify non-interfering nucleotide linkers between pegRNAs and 3′ motifs. Finally, we showed that epegRNAs enhance the efficiency of the installation or correction of disease-relevant mutations.

Prevention of acquired sensorineural hearing loss in mice by in vivo Htra2 gene editing

Article

Full-text available

Mar 2021
GENOME BIOL

Background Aging, noise, infection, and ototoxic drugs are the major causes of human acquired sensorineural hearing loss, but treatment options are limited. CRISPR/Cas9 technology has tremendous potential to become a new therapeutic modality for acquired non-inherited sensorineural hearing loss. Here, we develop CRISPR/Cas9 strategies to prevent aminoglycoside-induced deafness, a common type of acquired non-inherited sensorineural hearing loss, via disrupting the Htra2 gene in the inner ear which is involved in apoptosis but has not been investigated in cochlear hair cell protection. Results The results indicate that adeno-associated virus (AAV)-mediated delivery of CRISPR/SpCas9 system ameliorates neomycin-induced apoptosis, promotes hair cell survival, and significantly improves hearing function in neomycin-treated mice. The protective effect of the AAV–CRISPR/Cas9 system in vivo is sustained up to 8 weeks after neomycin exposure. For more efficient delivery of the whole CRISPR/Cas9 system, we also explore the AAV–CRISPR/SaCas9 system to prevent neomycin-induced deafness. The in vivo editing efficiency of the SaCas9 system is 1.73% on average. We observed significant improvement in auditory brainstem response thresholds in the injected ears compared with the non-injected ears. At 4 weeks after neomycin exposure, the protective effect of the AAV–CRISPR/SaCas9 system is still obvious, with the improvement in auditory brainstem response threshold up to 50 dB at 8 kHz. Conclusions These findings demonstrate the safe and effective prevention of aminoglycoside-induced deafness via Htra2 gene editing and support further development of the CRISPR/Cas9 technology in the treatment of non-inherited hearing loss as well as other non-inherited diseases.

Hearing impairment due to Mir183/96/182 mutations suggests both loss and gain of function effects

Article

Full-text available

Dec 2020

The microRNA miR-96 is important for hearing, as point mutations in humans and mice result in dominant progressive hearing loss. Mir96 is expressed in sensory cells along with Mir182 and Mir183, but the roles of these closely-linked microRNAs are as yet unknown. Here we analyse mice carrying null alleles of Mir182, and of Mir183 and Mir96 together to investigate their roles in hearing. We found that Mir183/96 heterozygous mice had normal hearing and homozygotes were completely deaf with abnormal hair cell stereocilia bundles and reduced numbers of inner hair cell synapses at four weeks old. Mir182 knockout mice developed normal hearing then exhibited progressive hearing loss. Our transcriptional analyses revealed significant changes in a range of other genes, but surprisingly there were fewer genes with altered expression in the organ of Corti of Mir183/96 null mice compared with our previous findings in Mir96 Dmdo mutants, which have a point mutation in the miR-96 seed region. This suggests the more severe phenotype of Mir96 Dmdo mutants compared with Mir183/96 mutants, including progressive hearing loss in Mir96 Dmdo heterozygotes, is likely to be mediated by the gain of novel target genes in addition to the loss of its normal targets. We propose three mechanisms of action of mutant miRNAs; loss of targets that are normally completely repressed, loss of targets whose transcription is normally buffered by the miRNA, and gain of novel targets. Any of these mechanisms could lead to a partial loss of a robust cellular identity and consequent dysfunction.

Advances in gene therapy hold promise for treating hereditary hearing loss

Article

Feb 2023
MOL THER

Gene therapy focuses on genetic modification to produce therapeutic effects or treat diseases by repairing or reconstructing genetic material, thus being expected to be the most promising therapeutic strategy for genetic disorders. Due to the growing attention to hearing impairment, an increasing amount of research is attempting to utilize gene therapy for hereditary hearing loss (HHL)-an important monogenic disease and the most common type of congenital deafness. Several gene therapy clinical trials for HHL have recently been approved, and additionally, CRISPR/Cas tools have been attempted for HHL treatment. Therefore, in order to further advance the development of inner ear gene therapy and promote its broad application in other forms of genetic disease, it is imperative to review the progress of gene therapy for HHL. Herein, we address three main gene therapy strategies-gene replacement, gene suppression, and gene editing, summarizing which strategy is most appropriate for particular monogenic diseases based on different pathogenic mechanisms and then focusing on their successful applications for HHL in preclinical trials. Finally, we elaborate on the challenges and outlooks of gene therapy for HHL.

Prime editing for precise and highly versatile genome manipulation

Article

Nov 2022

Programmable gene-editing tools have transformed the life sciences and have shown potential for the treatment of genetic disease. Among the CRISPR-Cas technologies that can currently make targeted DNA changes in mammalian cells, prime editors offer an unusual combination of versatility, specificity and precision. Prime editors do not require double-strand DNA breaks and can make virtually any substitution, small insertion and small deletion within the DNA of living cells. Prime editing minimally requires a programmable nickase fused to a polymerase enzyme, and an extended guide RNA that both specifies the target site and templates the desired genome edit. In this Review, we summarize prime editing strategies to generate programmed genomic changes, highlight their limitations and recent developments that circumvent some of these bottlenecks, and discuss applications and future directions.

Gene editing in a Myo6 semi-dominant mouse model rescues auditory function

Article

Jun 2021
MOL THER

Myosin VI is an unconventional myosin that is vital for auditory and vestibular function. Pathogenic variants in the human MYO6 gene cause autosomal dominant or recessive forms of hearing loss. Effective treatments for Myo6 mutation causing hearing loss are limited. We studied whether adeno-associated virus (AAV)-PHP.eB vector-mediated in vivo delivery of Staphylococcus aureus Cas9 (SaCas9-KKH)-single-guide (sg)RNA complexes could ameliorate hearing loss in Myo6WT/C442Y mouse model which recapitulated the phenotypes of human patients. The in vivo editing efficiency of the AAV-SaCas9-KKH-Myo6-g2 system on Myo6C442Y is 4.05% on average in Myo6WT/C442Y mice, which was ∼17-fold greater than editing efficiency of Myo6WT alleles. Rescue of auditory function was observed up to 5 months post AAV-SaCas9-KKH-Myo6-g2 injection in Myo6WT/C442Y mice. Meanwhile, shorter latencies of ABR wave I, lower distortion product otoacoustic emission (DPOAE) thresholds, increased cell survival rates, more regular hair bundle morphology, recovery of inward calcium levels were also observed in the AAV-SaCas9-KKH-Myo6-g2 treated ears compared to untreated ears. These findings provide further reference for in vivo genome editing as a therapeutic treatment for various semi-dominant forms of hearing loss and other semi-dominant diseases.

Targeted genome editing restores auditory function in adult mice with progressive hearing loss caused by a human microRNA mutation

Abstract

Recommended publications

Rescue of auditory function by a single administration of AAV-TMPRSS3 gene therapy in aged mice of h...

Rescue of Auditory Function by a Single Administration of AAV-TMPRSS3 Gene Therapy in Aged Mice of H...

Hearing impairment due to Mir183/96/182 mutations suggests both loss and gain of function effects

Precise detection of CRISPR/Cas9 editing in hair cells in the treatment of autosomal dominant hearin...