Content uploaded by Wei Liao
Author content
All content in this area was uploaded by Wei Liao on Apr 15, 2014
Content may be subject to copyright.
Compensatory dendritic cell development mediated by BATF-
IRF interactions
Roxane Tussiwand1,§, Wan-Ling Lee1,§, Theresa L. Murphy1,§, Mona Mashayekhi1, KC
Wumesh1, Jörn C. Albring1, Ansuman T. Satpathy1, Jeffrey A. Rotondo1, Brian T. Edelson1,
Nicole M. Kretzer1, Xiaodi Wu1, Leslie A. Weiss2, Elke Glasmacher3, Peng Li4, Wei Liao4,
Michael Behnke2, Samuel S.K. Lam1, Cora T. Aurthur1, Warren J. Leonard4, Harinder
Singh3, Christina L. Stallings2, L. David Sibley2, Robert D. Schreiber1, and Kenneth M.
Murphy1,5,*
1Department of Pathology and Immunology, Washington University School of Medicine, 660 S.
Euclid Ave., St. Louis, MO 63110, USA
2Department of Molecular Microbiology, Washington University School of Medicine, St. Louis, MO
63110, USA
3Department of Discovery Immunology, Genentech, Inc., 1 DNA Way, S. San Francisco, CA,
94080
4Laboratory of Molecular Immunology and Immunology Center, National Heart, Lung, and Blood
Institute, National Institutes of Health, Bethesda, MD 20892-1674
5Howard Hughes Medical Institute, Washington University School of Medicine, 660 S. Euclid
Ave., St. Louis, MO 63110, USA
Abstract
The AP-1 transcription factor
Batf3
is required for homeostatic development of CD8α+ classical
dendritic cells that prime CD8 T-cell responses against intracellular pathogens. Here, we identify
an alternative,
Batf3
-independent pathway for their development operating during infection with
intracellular pathogens mediated by the cytokines IL-12 and IFN-γ. This alternative pathway
results from molecular compensation for
Batf3
provided by the related AP-1 factors
Batf
, which
also functions in T and B cells, and
Batf2
induced by cytokines in response to infection.
Reciprocally, physiologic compensation between
Batf
and
Batf3
also occurs in T cells for
expression of IL-10 and CTLA-4. Compensation among BATF factors is based on the shared
capacity of their leucine zipper domains to interact with non-AP-1 factors such as Irf4 and Irf8 to
mediate cooperative gene activation. Conceivably, manipulating this alternative pathway of
dendritic cell development could be of value in augmenting immune responses to vaccines.
*To whom correspondence should be addressed. Phone 314-362-2009, Fax 314-747-4888, kmurphy@wustl.edu.
§These authors contributed equally to this study.
Author Contributions R.T., W.L., T.L.M., and M.M. performed experiments with
Batf
−/−,
Batf2
−/−,
Batf3
−/− and DKO mice;
T.L.M. made and analyzed all Batf mutants; J.A.R. aided with EMSA; W.KC., J.C.A., and A.T.S. were involved with microarray
analysis and generation of mutant mice. J.C.A. was involved in generating of
Batf2
−/− mice. B.T.E. was involved with
L.
monocytogenes
analysis; N.M.K was involved with cross-presentation analysis. X.W. was involved with bioinformatic analysis;
L.A.W. C.L.S. were involved with Mtb infection; E.G. and H.S. helped identify EMSA probes; P.L., W.L. and W.J.L. performed
ChIP-Seq and helped identify EMSA probes; M.B. and D.S. aided with
T. gondii
infections; S.S.K.L., C.T.A. and R.D.S. aided with
tumor models. H.S. and W.J.L. provided helpful discussions. K.M.M. directed the work and wrote the manuscript. All authors
discussed the results and contributed to the manuscript.
The authors have no conflicting financial interests.
NIH Public Access
Author Manuscript
Nature
. Author manuscript; available in PMC 2013 April 25.
Published in final edited form as:
Nature
. 2012 October 25; 490(7421): 502–507. doi:10.1038/nature11531.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Batf1 and Batf3 are activator protein 1 (AP-1)2 transcription factors3,4 with immune-specific
functions5–8.
Batf
is required for development of T helper cells producing IL-17 (TH17) and
follicular helper T (TFH) cells5, and class-switch recombination (CSR) in B cells6,9.
Batf3
is
required for development of CD8α+ classical dendritic cells (cDCs) and related CD103+
DCs8 that cross-present antigens to CD8 T cells7 and produce IL-12 in response to
pathogens10.
We recently recognized a heterozygous phenotype for
Batf3
of 50% fewer
CX3CR1−CD8α+ cDCs in
Batf3
+/− mice11, implying levels of Batf3 are limiting for CD8α+
DC development under homeostatic conditions. While analyzing
Toxoplasma gondii
infection in
Batf3
−/− mice, we observed evidence suggesting
Batf3
-independent CD8α+
cDC development10 based on apparent priming of pathogen specific CD8 T cells in
Batf3
−/−
mice treated with IL-12. Here, we report a
Batf3
-independent pathway of CD8α+ cDC
development that functions physiologically during infection by intracellular pathogens and
describe its molecular basis, which involves compensatory BATF factors.
Pathogens and IL-12 restore CD8α+ cDCs in Batf3−/− mice
IL-12 administration to
Batf3
−/− mice before infection with type II Prugniaud (Pru)
T.
gondii
reversed their susceptibility by inducing IFN-γ production not only from NK cells
but also from CD8 T cells10, suggesting potentially restored cross-priming. To test this idea,
we infected
Batf3
−/− mice with the attenuated12 RHΔ
ku80Δrop
5 strain of
T. gondii
and
examined CD8α+ cDCs (Supplementary Fig. 1a). Surprisingly, CD8α+ cDCs reappeared in
spleens of
Batf3
−/− mice by day 10 after infection. Infection by
L. monocytogenes
also
restored CD8α+ cDCs in
Batf3
−/− mice (Supplementary Fig. 1b). Aerosolized infection with
Mycobacterium tuberculosis
(Mtb) caused a progressive restoration of CD8α+ cDCs in
Batf3
−/− mice and expanded CD8α+ cDCs in WT mice (Fig. 1a). Mtb infection of
Batf3
−/−
mice restored the missing lung-resident CD103+ cDCs (DEC205+ CD24+ CD4− Sirp-α−
CD11b−)8,13 (Supplementary Fig. 1c).
Batf3
−/− mice showed no difference in survival to
Mtb infection compared to WT mice (Supplemental Fig. 1d), suggesting the initial lack of
CD8α+ cDCs and peripheral CD103+ cDCs was not sufficient for lethality with Mtb. Since
IL-12 is important in control of Mtb14, we measured serum IL-12 in Mtb-infected WT and
Batf3
−/− mice (Fig. 1b). IL-12 was reduced in
Batf3
−/− mice in the first three weeks, but
increased after 6 weeks to approximately 50% of Mtb-infected WT mice.
We found that IL-12 administration restored CD8α+ cDCs in all backgrounds of
Batf3
−/−
mice (Fig. 1c, Supplementary Fig. 2a). Restored CD8α+ cDCs were functional for cross-
presentation7,15,16 (Fig. 2a, Supplementary Fig. 2b). Purified splenic CD8α+ and CD4+
cDCs from WT or
Batf3
−/− mice, treated with vehicle or IL-12, were tested for cross-
presentation. As a control, OT-I T cells proliferated in response to WT CD8α+ DCs, but not
CD4+ DCs, co-cultured with ovalbumin-loaded cells with or without IL-12 treatment (Fig.
2a). Importantly, OT-I T cells proliferated similarly in response to IL-12-induced
Batf3
−/−
CD8α+ DCs, but not
Batf3
−/− CD4+ DCs, as to WT CD8α+ cDCs. The CD8α+ cDCs
restored by IL-12 in
Batf3
−/− mice were more similar in gene expression to WT CD8α+ DCs
than to CD4+ cDCs (Supplementary Fig. 2c). 1855 genes differed more than 4-fold in
expression between IL-12-induced CD8α+ cDCs and CD4+ cDCs within
Batf3
−/− mice.
However, in comparing IL-12-induced CD8α+ cDCs in
Batf3
−/− mice with the rare CD8α+
cDCs from
Batf3
−/− C57BL/6 mice, or with CD8α+ cDCs in WT mice, there were only 34
and 206 genes respectively differing more than 4-fold in expression.
The IL-12-induced restoration of CD8α+ cDCs in
Batf3
−/− mice was dependent on IFN-γ
in
vivo
(Supplementary Fig. 2d). With administration of control antibody, IL-12 induced a 3-
fold increase in CD8α+ cDCs in WT mice and restored CD8α+ cDCs in
Batf3
−/− mice. Both
Tussiwand et al. Page 2
Nature
. Author manuscript; available in PMC 2013 April 25.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
effects were blocked by anti-IFN-γ antibody. IL-12 induced IFN-γ production from NK
cells but not T cells (Supplementary Fig. 2e), and IL-12 treatment was able to restore
CD8α+ cDCs in
Rag2
−/−
Batf3
−/− mice (Supplementary Fig. 2f), indicating that T cells and
B cells are not required for this effect.
Batf3
−/− mice fail to reject highly immunogenic H31m1 and D42m1 fibrosarcomas7.
However,
Batf3
−/− mice pre-treated with IL-12 either fully rejected or showed reduced
growth of these fibrosacromas (Fig. 2b, Supplementary Fig. 2g). Rejection was not simply
due to NK cell activation, since IL-12 treatment failed to alter tumor growth in
Rag2−/−
mice. Strikingly, IL-12-treated
Batf3
−/− mice re-established priming of CD8 T cells capable
of infiltrating tumors similar to WT mice (Fig. 2c). Mice with the inactivating IRF8 R249C
mutation17–19 failed to restore CD8α+ cDCs upon IL-12 administration (Supplementary Fig.
3a), indicating that restoration requires functional IRF8 protein. Further, these mice were
highly susceptible to infection by aerosolized Mtb20 (Supplementary Fig. 3b), suggesting
that
Batf3
−/− mice may resist Mtb infection by restoration of CD8α+ cDCs. Thus,
physiological
Batf3
-independent development of CD8α+ cDCs is induced by pathogens,
mediated by IL-12 and IFN-γ.
Batf, Batf2 and Batf3 cross-compensate in DCs and T cells
We asked if
Batf
could replace
Batf3
for
in vitro
cDC development7,21 (Fig. 3a). CD103+
Sirp-α− cDCs do not develop in Flt3L-treated
Batf3
−/− bone marrow (BM) cultures.
Retroviral expression of
Batf3
into
Batf3
−/− BM progenitors restored CD103+ cDC
development. Notably,
Batf
fully and cell-intrinsically restored CD103+ Sirp-α− cDC
development, while
c-Fos
was inactive (Supplementary Fig. 3c). CD103+ cDCs restored by
Batf
and
Batf3 in vitro
were functional, showing features of mature CD103+ cDCs,
including loss of Sirp-α and CD11b, upregulation of CD24, and selective production of
IL-12 in response to
T. gondii
antigen (Supplementary Fig. 3c-d). Reciprocally,
Batf3
but
not
c-Fos
restored cell-intrinsic IL-17a production by
Batf
−/− T cells and CSR in
Batf
−/− B
cells (Supplementary Fig. 3e–f). Thus,
Batf
and
Batf3
can molecularly cross-compensate for
several distinct lineage-specific functions, activities not shared by
c-Fos
.
We also identified
in vivo
compensation between
Batf
and
Batf3
in DCs. On the 129SvEv
and BALB/c backgrounds,
Batf3
−/− mice completely lack CD8α+ cDCs (Fig. 3b,
Supplementary Fig. 2a). In contrast, C57BL/6
Batf3
−/− mice retain a 3–7% population of
CD8α+ cDCs19,22 in spleen and unexpectedly retain a completely normal population of
CD8α+ cDCs in skin-draining inguinal lymph nodes (ILNs) (Fig. 3b). These CD8α+ cDCs
are functional, since C57BL/6
Batf3
−/− mice showed robust priming of CD8 T cells against
HSV infection in the footpad, while 129SvEv
Batf3
−/− mice, lacking CD8α+ cDCs in ILNs,
did not (Supplementary Fig. 3g). However, C57BL/6
Batf
−/−
Batf3
−/− (BATF1/3DKO) mice
lack CD8α+ DCs in ILNs and fail to prime T cells against HSV. Thus, retention of
functional CD8α+ cDCs in ILNs of C57BL/6
Batf3
−/− mice is
Batf
-dependent.
Batf
and
Batf3
also compensate in expression of genes by T cells. IL-4 and IL-10 production
were not substantially affected in either
Batf
−/− or
Batf3
−/− TH2 cells (Fig. 3c,
Supplementary Fig. 3i–k). However, IL-10 is reduced at least 8-fold in BATF1/3DKO TH2
cells. Also, the inhibitory receptor CTLA-4 is partially reduced in
Batf
−/− TH2 cells but
reduced 3-fold further in BATF1/3DKO TH2 cells. In contrast, IFN-γ production by TH1
cells is unaffected by loss of
Batf
,
Batf3
or both.
We asked if IL-12-induced restoration of CD8α+ cDCs in
Batf3
−/− mice was due to
compensation by
Batf
(Supplementary Fig. 3h). Restoration of splenic CD8α+ cDCs in
IL-12-treated BATF1/3DKO mice was reduced to 5% from 11% in IL-12-treated
Batf3
−/−
mice. While
Batf
appears responsible for roughly half of the IL-12-induced restoration of
Tussiwand et al. Page 3
Nature
. Author manuscript; available in PMC 2013 April 25.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
CD8α+ cDCs in
Batf3
−/− mice, some residual compensation remained in BATF1/3DKO
mice. We asked if a third factor might compensate for
Batf
and
Batf3. Batf2
(SARI)23 is
closely related to
Batf
and
Batf3
and is induced by LPS and IFN-γ in macrophages and
CD103+ DC populations (Supplementary Fig. 4a–c). We found that
Batf2
was induced by
IFN-γ in WT and
Batf3
−/− DCs derived from Flt3L-cultured BM (Supplementary Fig. 4d–e)
and
in vivo
by IL-12 in DCs in
Batf3
−/− mice (Supplementary Fig. 4f). Induction of
Batf2
by
IFN-γ in cDCs made it a potential candidate to mediate IFN-γ-dependent compensation for
Batf3
.
We made
Batf2
−/− mice by targeting exons 1 and 2, eliminating Batf2 protein expression
(Supplementary Fig. 5).
Batf2
−/− mice had normal development of NK, T and B cells, pDCs,
neutrophils, resting cDCs, and peritoneal, liver and lung macrophages (Supplementary Fig.
6a–c). However,
Batf2
−/− mice displayed significantly decreased survival after infection by
T. gondii
(Pru) (Fig. 4a), although parasite burden and serum cytokines were similar to WT
mice (Supplementary Fig. 7a–b). Notably,
Batf2
−/− mice showed significantly decreased
numbers of lung-resident CD103+CD11b− DCs and CD103− CD11b− macrophages after
infection (Fig. 4b, Supplementary Fig. 7c). These changes were specific, since there were no
differences in other myeloid subsets (Supplementary Fig. 7d-e) Thus,
Batf2
plays a role in
maintaining numbers of
Batf3
-dependent CD103+ DCs in the lung following infection with
T. gondii
.
We asked if
Batf2
could compensate for DC defects in
Batf3
−/− mice and for T and B cell
defects in
Batf
−/− mice (Fig. 4c, Supplementary Fig. 8a-b). Like
Batf
, retroviral expression
of
Batf2
restored development of CD103+Sirp-α− DCs in Flt3L-treated
Batf3
−/− BM. Unlike
Batf
and
Batf3
, expression of
Batf2
did not restore TH17 development
Batf
−/− T cells and
only weakly restored CSR in
Batf
−/− B cells. Thus,
Batf2
selectively compensates for
Batf
and
Batf3
in cDCs but not in T or B cells. We next examined
in vivo
IL-12-induced
restoration of CD8α+ cDCs in
Batf2
−/−,
Batf3−/−
and
Batf2
−/−
Batf3
−/− (BATF2/3DKO)
mice (Fig. 4d, Supplementary Fig. 8c). IL-12 treatment restored CD8α+ cDCs from <1% to
>5% of total cDCs in
Batf3
−/− mice, but this was significantly reduced to ~2% in
BATF2/3DKO mice. This suggests that
Batf2
is responsible for roughly half of IL-12-
induced CD8α+ cDC restoration in
Batf3
−/− mice. We found similar results with
in vitro
CD103+ cDC development. While GM-CSF restored only CD103 and not DEC205
expression in Flt3L-treated
Batf3
−/− BM cultures19, adding IFN-γ with GM-CSF restored
DEC205+CD103+CD11b− DCs (Supplementary Fig. 8d-e). We used this system to analyze
compensation between
Batf
,
Batf2
, and
Batf3
(Supplementary Fig. 8d–e). Relative to WT
BM, CD103+DEC205+CD11b− cDCs were partially reduced in
Batf
−/−,
Batf2
−/− and
Batf3
−/− singly-deficient BM, but were reduced to an even greater extent in both
BATF1/3DKO and BATF2/3DKO BM relative to all single-deficient BM cultures.
Collectively, these results suggest that
Batf
and
Batf2
both act in the cytokine-dependent
rescue of CD8α+ cDC development in
Batf3
−/− mice.
The BATF LZ domain interacts with IRF4 and IRF8
To understand BATF cross-compensation, we analyzed chimeric proteins containing fused
domains of Batf, Batf2, and c-Fos (Supplementary Fig. 9). c-Fos inactivity could result from
inhibitory actions of N- and C-terminal domains missing in Batf and Batf3 (Fig. 5a).
However, removing these domains from c-Fos (Δ5′c-FosΔ3′) or fusing the Batf DBD with
the c-Fos LZ (BBRFFΔ3′) failed to restore CD103+ cDC development (Fig. 5a), TH17
development or CSR activity (Supplementary Fig. 10a–b). However, fusing the Batf LZ
with the c-Fos DBD (Δ5′FFQBB) fully restored CD103+ cDC development in Ftl3L-treated
Batf3
−/− BM cultures, fully restored CSR in
Batf
−/− B cells and exhibited 20% of WT
activity for restoring IL-17 production. Further, Batf with a C-terminal GFP (Batf-GFP) or
Tussiwand et al. Page 4
Nature
. Author manuscript; available in PMC 2013 April 25.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
c-Fos (BBBF) domain had >40% of WT Batf activity in all three assays (Supplementary Fig.
11). Thus, the LZ domain, not the DBD, determines BATF specificity.
Removing the Batf2 C-terminal domain (Batf2 DM) allowed for full restoration of CD103+
cDC development, but led to only partial restoration of CSR activity (~15%), and no
restoration of TH17 development (Supplementary Fig. 10c–h). Fusing the Batf DBD with
the Batf2 LZ (B1HB2 DM) allowed for approximately 50% of WT Batf activity for CSR
and TH17 development in
Batf
−/− B and T cells. Fusing the Batf2 DBD with Batf LZ
(B2QB1) allowed for 50% of WT Batf activity in CD103+ cDC development, but provided
less than 5% WT Batf activity in TH17 development. Thus, the Batf2 DBD restricts activity
in T and B cells, but its LZ functions for all BATF lineage-specific activities.
A recent study24 proposed that Irf4 and Batf may interact. Correspondence between the
phenotypes of
Batf
−/− with
Irf4
−/− mice, lacking TH17 development and CSR, and
Batf3
−/−
with
Irf8
−/− mice, lacking CD8α+ cDC development (Supplementary Fig. 12)5–7,25–28,
suggested that Batf and Batf3 may cooperate with both Irf4 and Irf8. Further, ChIP-Seq
analysis of Batf and Irf4 revealed coincident binding to composite AP-1 and IRF motifs (Li
et al., In Press; Glasmacher et al, In Press). By analogy with the Ets-IRF composite elements
(EICE)29, the AP-1-IRF composite elements are designated as AICE (Glasmacher et al., In
Press; Li et al., In Press). Recalling the c-Fos LZ interaction with NF-AT that mediates
cooperative binding to
Il2
regulatory regions30, we therefore asked if the Batf LZ interacted
with non-AP-1 factors, including Irf4.
Electrophoretic mobility shift assays (EMSA) demonstrated interactions between BATF and
both Irf4 and Irf8 (Fig. 5, Supplementary Figs. 13, 14). The Batf/Jun complex that formed
on an AP-1 consensus probe1,2 was unchanged by addition of Irf4 or Irf8. Its abundance was
increased by additional JunB (Supplementary Fig. 13a). However, using an AICE from the
CTLA-4 locus, a slower mobility complex formed with addition of either
Irf4
or
Irf8
, which
required the IRF consensus element (Fig. 5b, Supplementary Fig. 13b). This Batf/Jun/Irf4
complex required both Batf and IRF protein, and Irf4 was unable to bind the AICE1 probe
without Batf (Fig. 5b). In contrast, Irf4 was able to bind to and Ets/IRF consensus
elements31 (EICE) in the presence of PU.1 independently of Batf (Fig. 5b). The Batf/Jun/
Irf4 complex had similar mobility to the Fos/Jun complex in activated cells, but could be
distinguished by antibody supershifts (Supplementary Fig. 13c). Spatial constraints on the
Batf/Irf4 interaction are suggested by lack of Batf/Irf4 complex formation on the AICE2
probe with reversed orientation of the AP-1 and IRF elements (Supplementary 13a, c).
The ability of chimeric Batf proteins to interact with Irf4 correlated with their functional
activity (Fig. 5c). The active Δ5′FFQBB interacted with Irf4, but the inactive Δ5′c-FosΔ3′
and BBRFFΔ3′ did not (Fig. 5c), although all three bound an AP-1 consensus
(Supplementary Fig. 13d). A Batf/IRF complex also formed in B and T cells, requiring both
the IRF and AP-1 consensus elements (Fig. 5d, Supplementary Fig. 14c), and involved
contribution by endogenous Irf4 and Irf8 (Supplementary Fig. 14a, b, d). The Batf/IRF
complex was completely absent in
Batf
−/− B cells, but was partially retained in single-
deficient
Irf4
−/− or
Irf8
−/− B cell extracts (Supplementary Fig. 14a-b). Supershifts using anti-
Irf4 and anti-Irf8 antibodies in
Irf4
−/− or
Irf8
−/− B cell nuclear extracts showed that the
endogenous Batf/IRF complex is composed of a mixture of Irf4 and Irf8 (Supplementary
Fig. 14b). Similarly, supershifts of primary TH17 cells demonstrate an interaction between
Batf and both Irf4 and Irf8 (Supplementary Fig. 14d).
We identified Batf LZ mutations which abrogated both function and Irf4 interactions (Fig.
5e–f). Positions b, c and f of the c-Fos LZ face away from the parallel coiled-coil of the Jun
LZ and mediate interactions with NF-AT30 (Supplementary Fig. 9d). Several Batf mutations
Tussiwand et al. Page 5
Nature
. Author manuscript; available in PMC 2013 April 25.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
in these positions had no effect on activity (Supplementary Table 1, Supplementary Fig. 9c).
However, four residues together controlled nearly all BATF-specific activity (Fig. 5e,
Supplementary 15). Batf L56A, Batf K63D and Batf E77K showed no reduction in CD103+
cDC development, and retained >60% of WT Batf activity in CSR. In contrast, Batf H55Q
activity was reduced by nearly 70% (Fig. 5e). Double mutants Batf K63D E77K and Batf
H55Q L56A were reduced by 50% and 75%, but quadruple mutant Batf H55Q L56A K63D
E77K had less than 10% of WT Batf activity in CD103+ cDC development (Fig. 5e). This
loss of activity was specific since two other quadruple mutants, Batf E59Q D60Q K63D
E77K and Batf K63D R69Q K70D E77K, maintained >50% of WT Batf activity
(Supplementary Fig. 15c–d). A similar pattern was seen for CSR in
Batf
−/− B cells
(Supplementary Fig. 15b). The activity of these mutants correlated with Irf4 interaction (Fig.
5f). WT Batf and functional mutant K63D E77K, and both functional quadruple mutants
formed a complex with Irf4, whereas the less active Batf H55Q and Batf H55Q L56A, and
the completely inactive Batf H55Q L56A K63D E77K did not, although all were stably
expressed and could bind an AP-1 site (Supplementary 13e–f).
Discussion
We uncovered a cytokine-driven pathway for expansion of functional CD8α+ cDCs
occurring physiologically during infection by intracellular pathogens. This pathway relies on
functional compensation for
Batf3
provided by
Batf
and
Batf2
through a shared specificity
defined by the BATF LZ domain to support CD8α+ cDC and TH17 development, and CSR
in B cells. This compensatory pathway of CD8α+ cDCs development may provide a basis
for augmenting therapeutic immune responses. The basis of this shared specificity is the LZ
interaction with non-AP-1 factors, including Irf4 and Irf8, extending the repertoire of AP-1
interactions beyond the recognized association of Fos with NF-AT30. The ability of both
Batf and Batf3 to support both Irf4- and Irf8-dependent lineage activities implies that the
specificity for gene activation is determined largely by the IRF factors. An important next
step will be to determine how regulatory elements discriminate between these distinct
complexes.
Online Methods
Generation of Batf2−/− mice
The targeting construct was assembled by Gateway recombination cloning system
(Invitrogen). To construct pENTR loxFRT rNEO, a floxed PGK–
neor
(phosphoglycerate
kinase promoter - neomycin phosphotransferase) gene cassette (1982 bp) was excised from
the pLNTK targeting vector34 using
Sal
I and
Xho
I. After incubation with Easy-A cloning
enzyme (Stratagene) and dNTPs to generate 3′-A overhangs, the PGK–
neor
cassette was
ligated into the multiple cloning site of pGEM-T Easy (Promega). The resulting 2022 bp
PGK–
neor
gene cassette was released using
Not
I and ligated into the 2554 bp backbone of
Not
I digested pENTR lox-Puro35. Flippase Recognition Target (FRT) sites were
sequentially inserted at the
Sac
I and
Hind
III sites using DNA fragments generated by
following annealing oligonucleotides: SacII-FRT-A
(GAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCCGC) and
SacII-FRT-B
(GGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCGC), or
HindIII-FRT-A
(AGCTTGAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC)
and HindIII-FRT-B
(AGCTGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCA).
To construct pENTR-Batf2-5HA, the 5′ homology arm was generated by PCR from
genomic DNA using the following oligonucleotides, which contain attB4 and attB1r site:
Tussiwand et al. Page 6
Nature
. Author manuscript; available in PMC 2013 April 25.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
GGGGACAACTTTGTATAGAAAAGTTGGCAGGCTGAAGCAGGGACAC, and
GGGGACTGCTTTTTTGTACAAACTTGCCCTAGCACACCCAGTTTCAGTTTC. The
attB4-attB1r PCR fragment was ligated into pDONR(P4-P1R) plasmid (Invitrogen) by BP
recombination reaction. To construct pENTR-Batf2-3HA, the 3′ homology arm was
generated by PCR from genomic DNA using the following oligonucleotides which contain
attB2 and attB3site:
GGGGACAGCTTTCTTGTACAAAGTGGGCAGTCCCAGCATGACCCAGCCCCAGCA
TGA CCCAGCATCTGC, and
GGGGACAACTTTGTATAATAAAGTTGCCGTCTCACTCAGTTCTGTGTGTG. The
attB2-attB3 PCR fragment was ligated into pDONR (P2-P3) plasmid (Invitrogen) by BP
recombination reaction, following by the LR recombination reaction to generate final
targeting construct by using pENTR-Batf2-5HA, pENTR-Batf2-3HA, pENTR-loxFRT
rNEO, and pDEST DTA-MLS. The linearized vector was electroporated into EDJ22
embryonic stem cells, 129 SvEv background, and targeted clones were identified by
Southern blot analysis with 5′ and 3′ probes. Blastocyst injections were performed, and
male chimeras were bred to female 129S6/SvEv mice. Probes for Southern Blot analysis
were amplified from genomic DNA using the following primers: 5′-
GTTGGTGTGAGGTGATGAGGTCCC -3′ and 5′-
CTTGACTTCCTAGACCAGGGGC-3′ for the 5′ probe; 5′-
GGACCATATACTCTTACTGTTGAAACC-3′ and 5′-GGGCTGGGGACACACATG-3′
for the 3′ probe. Southern Blot analysis and genotyping PCR were performed to confirm
germline transmission and the genotype of the progeny. Primers used for genotyping PCR
are shown as follows: KO screen forward, 5′-
GAAACTGAAACTGGGTGTGCTAGGG-3′; KO screen reverse, 5′
CGCCTTCTTGACGAGTTCTTCTGAG-3′; WT screen reverse, 5′-
GCCTTCCTTGTCTCTCTCCATAGCG-3′.
Generation of Batf2-specific rabbit polyclonal antibody
Murine full-length Batf2 cDNA was cloned into pET-28a (+) expression vector (Novagen)
to generate recombinant Batf2 protein with His tagged. Recombinant Batf2 was then
expressed using
Escherichia coli
BL21 (Invitrogen). Purified recombinant Batf2 was used to
immunize New Zealand White rabbits (Harlan), and rabbit anti-mouse Batf2 sera were
collected and tested by ELISA and Western Blot analysis.
Pathogen infections
Listeria monocytogenes
and
T. gondii
infections were carried out as previously
described36,37. The type II avirulent Prugniaud (Pru) strain of
T. gondii
expressing a firefly
luciferase and GFP transgene (provided by J. Boothroyd, Stanford University, Palo Alto,
CA) was used for infections of
Batf2
−/− mice for the experiments shown in Fig. 4 and
Supplementary Fig. 7. Briefly, 800 tachyzoites were injected intraperitoneally (i.p.) into
mice. For Herpes simplex virus 1 (HSV-1) infections, mice were infected with the KOS
strain subcutaneously (s.c.) with 1.5 × 105 PFU/mouse in the foot pad. Viral supernatant and
HSV peptide were provided by M. Colonna. For
Mycobacterium tuberculosis
(
Mtb
)
infections, Erdman strain was grown to a density of 8×106 CFU/ml, and mice were exposed
to aerosol infection for 40 minutes using a Glas-Col aerosol exposure system (AES). After
24 hours, two mice per group were sacrificed, and lungs were harvested to determine
infection efficiency, which was about 100 CFU/lung. Lungs and spleens were collected at 1,
3 and 9 weeks post infection. The left lobe of the lung and one third of the spleen were used
for histological examination upon formalin fixation. The right lobe of the lung and two
thirds of the spleen were divided into CFU analysis and FACS analysis. For CFU analysis,
organs were homogenized and plated at various dilutions on 7H-10 culture plates, and after
three weeks, colonies were counted. For FACS analysis, organs were prepared as
Tussiwand et al. Page 7
Nature
. Author manuscript; available in PMC 2013 April 25.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
described38. For lungs, Ficoll gradient purification was performed prior to surface staining.
All samples were fixed upon staining for 20 minutes in 4% formalin. Serum was collected
by retro-orbital bleeding at week 1, 2, 3 and 6 and decontaminated by double filtering
through a 0.2mm filter.
Bioluminescence Imaging
Imaging was done as previously described39. In brief, mice were injected intraperitoneally
with D-luciferin (Biosynth AG, Switzerland) at 150 mg/kg and allowed to remain active for
5 minutes before being anesthetized with 2% isoflurane for 5 minutes. Animals were than
imaged with a Xenogen IVIS200 machine (Caliper Life Sciences). Data were analyzed with
the Living Image software (Caliper Life Sciences).
In vitro T cell restimulation after HSV infection
One week after infection, spleens were harvested and restimulated with the HSV peptide
HSV-gB2 (498-505) (Anaspec). Briefly, 2×106 splenocytes were restimulated for 5 hours in
the presence of Brefeldin A at 1 μg/mL and analyzed by FACS for intracellular IFN-γ and
TNF-α production as described later.
In vitro cross-presentation
DC cross-presentation of antigen to CD8+ OT-I T cells was assessed as previously
described40. Briefly, Spleens from naïve, vehicle or IL12-treated WT or
Batf3−/−
mice were
digested with collagenase B (Roche) and DNase I (Sigma-Aldrich). CD11c+ DCs were
obtained by negative selection using B220, Thy1.2, and DX5 microbeads followed by
positive selection with CD11c microbeads by MACS purification (Miltenyi Biotec). CD8α+
and CD4+ cDCs were cell sorted on a FACSAria II flow cytometer (post-sort purity >96%).
Splenocytes from Kb−/−Db−/−β2m−/− mice were prepared in serum-free medium, loaded with
10 mg/ml ovalbumin (EMD) by osmotic shock, and irradiated (13.5 Gy) as described
previously40. OT-I T cells were purified from OT-I/
Rag2−/−
mice by CD11c and DX5
negative selection, followed by positive selection with CD8α microbeads (purity >96%). T
cells were fluorescently labeled by incubation with 1 μM CFSE (Sigma-Aldrich) for 9 min
at 25°C at a density of 2 × 107 cells/ml. For the cross presentation assay, 5 × 104 –105
purified DCs were incubated with 5 × 104 –105 CFSE-labeled OT-I T cells in the presence
of increasing numbers of irradiated, ovalbumin-loaded Kb−/−Db−/−β2m−/− splenocytes (5 ×
103 to 1 × 105). After 3 days, OT-I T cell proliferation was analyzed by CSFE dilution
gating on CD3+ CD8+ CD45.1+ cells.
Tumor transplantation
MCA-induced fibrosarcomas were derived from 129/SvEv strain
Rag2−/−
or WT mice as
described previously41. Tumor cells were propagated
in vitro
and 106 tumor cells (129SvEv
fibrosarcoma tumor line H31m1 or D42m1) were injected s.c. in a volume of 150 μl
endotoxin-free PBS into the shaved flanks of naïve or IL12 conditioned (as described above)
wild type (WT)
Batf3
−/− and
Rag2
−/− recipient mice as described previously40. Injected
cells were >90% viable as assessed by trypan blue exclusion. Tumor size was measured on
the indicated days and is presented as the mean of two perpendicular diameters.
Tumor harvest
WT and naïve or IL12 treated
Batf3
−/− mice were inoculated with the H31m1 fibrosarcoma
tumor line. 11 days after, tumors were removed, minced and treated with 1μmg/ml type A
collagenase (Sigma) in HBSS (Hyclone) for 1h at 37°C. Cell suspension was analyzed by
FACS for CD8 T cell recruitment at the tumor site gating on CD45+, Thy1.2+ and CD8α+
cells.
Tussiwand et al. Page 8
Nature
. Author manuscript; available in PMC 2013 April 25.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Quantitative RT-PCR
For gene expression analysis, RNA was prepared from various cell types with either RNeasy
Mini Kit (Qiagen) or RNeasy Micro kit (QIAGEN), and cDNA was synthesized with
Superscript III reverse transcription (Invitrogen). Real-time PCR and a StepOnePlus Real-
Time PCR system (Applied Biosystems) were used according to the manufacturer’s
instructions, with the Quantitation Standard-Curve method and HotStart-IT SYBR Green
qPCR Master Mix (Affymetrix/USB). PCR conditions were 10 min at 95°C, followed by 40
two-step cycles consisting of 15 s at 95°C and 1 min at 60°C. Primers used for measurement
of
Batf2
expression are as follows: Batf2 qRT forward, 5′-
GGCAGAAGCACACCAGTAAGG-3′; Batf2 qRT reverse, 5′-
GAAGGGCGTGGTTCTGTTTC-3′. Hprt was used as normalization control, and primers
used are as follows: Hprt forward, 5′-TCAGTCAACGGGGGACATAAA-3′; and Hprt
reverse, 5′-GGGGCTGTACTGCTTAACCAG-3′.
DC preparation
Dendritic cells from lymphoid organs and non-lymphoid organs were harvested and
prepared as described 38. Briefly, spleens, MLNs, SLNs (inguinal), and liver were minced
and digested in 5 ml Iscove’s modified Dulbecco’s media + 10% FCS (cIMDM) with 250
μg/ml collagenase B (Roche) and 30 U/ml DNase I (Sigma-Aldrich) for 30 min at 37°C
with stirring. Cells were passed through a 70-μm strainer before red blood cells were lysed
with ACK lysis buffer. Cells were counted on a Vi-CELL analyzer, and 5–10 × 106 cells
were used per antibody staining reaction. Lung cell suspensions were prepared after
perfusion with 10 ml Dulbeccos PBS (DPBS) via injections into the right ventricle after
transection of the lower aorta. Dissected and minced lungs were digested in 5ml cIMDM
with 4mg/ml collagenase D (Roche) for 1 h at 37°C with stirring. Cells from the peritoneal
cavity were collected by washing the peritoneal cavity with 10 ml HBSS+2%FCS and 2mM
EDTA.
Bone marrow derived DC and macrophage
Bone marrow (BM)-derived DCs were generated from BM with 100 ng/mL of recombinant
Flt3L as described40. BM-derived macrophages were generated from BM with 20 ng/mL of
recombinant M-CSF (Peprotech) for 7 days, and rested in cIMDM without M-CSF for 24
hours before stimulation with various conditions as described in the figure legends.
Preparation of T. gondii lysate antigen (STAg)
T gondii
antigen was prepared by lysing tachyzoites of Pru strain in foreskin fibroblast
cultures through two cycles of freeze-thaw in liquid nitrogen. Lysate was then filtered,
aliquoted at a concentration of 1 mg/ml in PBS and stored at −80 degree. For DC
stimulation, 0.05 ug/ml were used and intracellular IL12 production was analyzed by FACS.
Cytokine induced CD8α+ DCs
WT and
Batf3
−/− mice bone marrow was prepared as described above. GM-CSF (10ng/ml)
and or IFN-γ (0.1ng/ml) was added to the cultures between day 8 and 10. Cells were
analysed two days after cytokine addition.
Antibodies and flow cytometry
Staining was performed at 4°C in the presence of Fc Block (anti CD16/32 clone 2.4G2,
BioXCell) in FACS buffer (DPBS + 0.5% BSA + 2 mm EDTA). The antibodies used for
DC analysis were as recently described42. Cells were analyzed on BD FACSCanto II or
FACSAria II and analyzed with FlowJo software (Tree star, Inc.).
Tussiwand et al. Page 9
Nature
. Author manuscript; available in PMC 2013 April 25.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Intracellular Cytokine Staining
For intracellular cytokine staining, cells were surface stained, then fixed in 2%
paraformaldehyde for 15 min at 4°C, permeabilized in DPBS + 0.1% BSA + 0.5% saponin,
and stained for intracellular cytokines as previously described43. Additional antibodies
included anti-TNF-α (MP6-XT22) and anti-IFN-γ (XMG1.2) from BioLegend.
ELISA and CBA
IL-12p40 concentration was measured from serum samples with the Mouse IL-12p40
OptEIA ELISA set (BD Bioscience) according to the manufacturer instructions. The
concentration of inflammatory cytokines was measured in the serum with the BD CBA
Mouse Inflammation Kit (BD Biosciences), and data were analyzed with FCAP Array
software (Soft Flow, Inc. USA).
Statistical analysis
Differences between groups in survival were analyzed by the log-rank test. Analysis of all
other data was done with an unpaired, two-tailed Student’s
t
test with a 95% confidence
interval (Prism; GraphPad Software, Inc.). P values less than 0.05 were considered
significant. *0.01 < p < 0.05, **0.001 < p < 0.01, ***p < 0.001, ****p < 0.0001.
Expression microarray analysis
Total RNA was isolated from cells using the Ambion RNAqueous-Micro Kit. For Mouse
Genome 430 2.0 Arrays, RNA was amplified, labeled, fragmented, and hybridized using the
3′ IVT Express Kit (Affymetrix). Data were normalized and expression values were
modeled using DNA-Chip analyzer (dChip) software (www.dChip.org)44. Mouse Gene 1.0
ST Arrays, RNA was amplified with the WT Expression Kit (Ambion) and labeled,
fragmented, and hybridized with the WT Terminal Labeling and Hybridization Kit
(Affymetrix). Data was processed using RMA quantile normalization and expression values
were modeled using ArrayStar software (DNASTAR). All original microarray data have
been deposited in NCBI’s Gene Expression Omnibus and are accessible through GEO.
CD4+ T cell cultures
CD4+ T cells were purified using DynaBeads FlowComp mouse CD4 kit (Invitrogen) and
were activated on αCD3/αCD28 coated plates under the following culture conditions: TH1
conditions: αIL4 10μg/ml (11B11, BioXcell) 0.1μg/ml IFNγ (Peprotech), 10u/ml IL12, IL2
40u/ml; TH2 conditions: αIL12 10μg/ml (Tosh, BioXCell), αIFNγ 10μg/ml (XMG1.2,
BioXCell), 10ng/ml IL4 (Peprotech), IL2 40u/ml; TH17 conditiions: IL-6 25ng/ml
(Peprotech), TGFβ 2ng/ml (Peprotech), IL1β 10ng/ml (Peprotech), αIL4 10 μg/ml (11B11,
BioXCell), αIFNγ 10μg/ml (XMG1.2, BioXCell), and αIL12 10μg/ml (Tosh, BioXCell).
IL2 (40u/ml) was added for the TH17 cultures in Supplementary Figure 12a. Cells were
diluted three fold in fresh media on day 3. On day 5 cells were activated with PMA/
ionomycin for analysis of cytokines and surface markers by FACS. For some experiments,
cells were restimulated on day 7 under the same conditions and analyzed 5 days later.
Retroviral analysis of BATF functional activity
For CD8α+ DC development, BM was cultured with Flt3L as described40, infected with
retrovirus and 2μg/ml polybrene on day 1, and analyzed for development of cDCs (CD11c+
B220−) on day 10.
CD4+ T cells were cultured under TH17 conditions43,45 and infected with retrovirus and
6μg/ml polybrene on day 1. Cells were analyzed on day 5 for cytokine expression by
Tussiwand et al. Page 10
Nature
. Author manuscript; available in PMC 2013 April 25.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
intracellular staining. For some experiments, cells were restimulated on day 7 under the
same conditions and analyzed 5 days later.
For analysis of class switch recombination, B220 cells purified by αB220 Macs microbeads
(Miltenyi) were cultured with LPS and IL4 as described46, infected with retrovirus and 6μg/
ml polybrene on day 1, and analyzed for switching to IgG1 on day 4 by FACS.
For infection of primary mouse cells, GFP-RV47 containing cDNAs for transcription factors,
chimeric proteins and mutated Batf were transfected into Phoenix E cells as described
previously48. Viral supernatants were collected 2 days later and concentrated by
centrifugation49. Cells were infected with viral supernatants by spin infection at 1800 rpm
for 45 min at room temperature.
Electromobility shift assays (EMSA)
For stable expression in 293FT cells, retroviruses (GFP-RV containing Batf, chimeric
proteins or Batf mutants, and/or truncated hCD4-RV47 containing Irf4 or Irf8 cDNA) were
packaged in Phoenix A cells and concentrated by centrifugation49. Infected 293FT cells
were sorted for retroviral marker expression and when indicated were transiently transfected
with JunB-GFP-RV using calcium phosphate. For transient expression, 293FT cells were
transfected with retroviral constructs using calcium phosphate. Nuclear extracts were
prepared 48hrs after transfection. For 293FT cells, nuclei were obtained after cellular lysis
with Buffer A containing 0.2% NP40 and nuclear extracts in Buffer C were dialyzed against
buffer D as described50. Nuclear extracts from T and B cells were prepared as described46.
EMSA was as described51 using 3μg of nuclear extract, 1mg poly dIdC (Sigma) and 7%T
3.3%C polyacrylamide gels. For competition assays, extracts were incubated with excess
unlabelled competitor DNA for 20 min before addition of labeled probe. For supershifts,
extracts were incubated with antibodies (αc-Fos (4) X (Santa Cruz) (for 293FT cells) or αc-
Fos 2G9C3 (Abcam) (for mouse T cells), αIrf4 (H- 140) X (Santa Cruz), αIrf8 (ICSBP)
C-19) X (Santa Cruz), αJun B (C-11) X (Santa Cruz) and rabbit αBatf 43, rabbit αBatf2
(described above), and rabbit αBatf3 (KC et al, submitted) for 1hr on ice prior to addition of
labeled probe and incubation at room temperature for 35minutes. The following pairs of
oligonucleotides were annealed to generate probes which were labeled with 32P-dCTP using
Klenow polymerase. The AP1consensus binding site is underlined. The Irf consensus
binding site is in italics. Mutated bases are in lower case.
AP1: 5′GATCAGCTTCGCTTGATGAGTCAGCCGG/
5′GATCCGGCTGACTCATCAAGCGAAG
AICE1 (from 3rd intron of mouse CTLA4):
5′CTTGCCTTAGAGG
TTTC
GGGATGACTAATACTGTA/
5′TCACGTACAGTATTAGTCATCCC
GAAA
CCTCTAAGG
AICE1 M1 (mutates the Irf consensus binding site):
5′CTTGCCTTAGAGGccaCGGGATGACTAATACTGTA/
5′TCACGTACAGTATTAGTCATCCCGtggCCTCTAAGG
AICE M2 (mutates the AP-1 consensus binding site):
5′CTTGCCTTAGAGG
TTTC
GGGAgacCTAATACTGTA/
5′TCACGTACAGTATTAGgtcTCCC
GAAA
CCTCTAAGG
Tussiwand et al. Page 11
Nature
. Author manuscript; available in PMC 2013 April 25.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
AICE2 (from 3rd intron of IL23R):
5′GATGTTTCAGG
GAAA
GCACTGACTCACTGGCTCTCCA/
5′GGTGGAGAGCCAGTGAGTCAGTGC
TTTC
CCTGAAA
EICE52: 5′GAAAAAGAGAAATAAAAGGAAGT
GAAA
CCAAG/
5′GATCCTTGG
TTTC
ACTTCCTTTTATTTCTCTTT
Eα: 5′TCGACATTTTTCTGATTGGTTAAA/5′GACTTTTAACCAATCAGAAAAATG
Plasmids
cDNAs for
Batf
,
Batf2
,
Batf3
,
Irf8
and
JunB
were generated by PCR from primary cells.
MigR1 containing HA tagged Irf4 was from H. Singh (Genentech). HA-Irf4 and Irf8 cDNAs
were subcloned into hCD4-RV47. Mutations in
Batf
were generated using QuickChange
mutagenesis with Batf -GFP-RV as the template. cDNAs for chimeric proteins were
generated by overlap extension and PCR and cloned into GFP-RV.
Supplementary Material
Refer to Web version on PubMed Central for supplementary material.
Acknowledgments
Supported by the Howard Hughes Medical Institute, National Institutes of Health (AI076427-02) and Department
of Defense (W81XWH-09-1-0185) (K.M.M.), the American Heart Association (12PRE8610005) (A.S.), German
Research Foundation (AL 1038/1-1) (J.C.A), American Society of Hematology Scholar Award and Burroughs
Welcome Fund Career Award for Medical Scientists (B.T.E.), and Cancer Research Institute predoctoral fellowship
(W.L.). We thank the ImmGen consortium32, Mike White for blastocyst injections and generation of mouse
chimeras, the Alvin J. Siteman Cancer Center at Washington University School of Medicine for use of the Center
for Biomedical Informatics and Multiplex Gene Analysis Genechip Core Facility. The Siteman Cancer Center is
supported in part by the NCI Cancer Center Support Grant P30 CA91842. IL-12 was a gift from Pfizer.
References
1. Dorsey MJ, et al. B-ATF: a novel human bZIP protein that associates with members of the AP-1
transcription factor family. Oncogene. 1995; 11:2255–2265. [PubMed: 8570175]
2. Wagner EF, Eferl R. Fos/AP-1 proteins in bone and the immune system. Immunol Rev. 2005;
208:126–140. [PubMed: 16313345]
3. Williams KL, et al. Characterization of murine BATF: a negative regulator of activator protein-1
activity in the thymus. Eur J Immunol. 2001; 31:1620–1627. [PubMed: 11466704]
4. Echlin DR, Tae HJ, Mitin N, Taparowsky EJ. B-ATF functions as a negative regulator of AP-1
mediated transcription and blocks cellular transformation by Ras and Fos. Oncogene. 2000;
19:1752–1763. [PubMed: 10777209]
5. Schraml BU, et al. The AP-1 transcription factor Batf controls T(H)17 differentiation. Nature. 2009;
460:405–409. [PubMed: 19578362]
6. Ise W, et al. The transcription factor BATF controls the global regulators of class-switch
recombination in both B cells and T cells. Nat Immunol. 2011
7. Hildner K, et al. Batf3 deficiency reveals a critical role for CD8alpha+ dendritic cells in cytotoxic T
cell immunity. Science. 2008; 322:1097–1100. [PubMed: 19008445]
8. Edelson BT, et al. Peripheral CD103+ dendritic cells form a unified subset developmentally related
to CD8alpha+ conventional dendritic cells. J Exp Med. 2010; 207:823–836. [PubMed: 20351058]
9. Betz BC, et al. Batf coordinates multiple aspects of B and T cell function required for normal
antibody responses. J Exp Med. 2010; 207:933–942. [PubMed: 20421391]
10. Mashayekhi M, et al. CD8a+ Dendritic Cells Are the Critical Source of Interleukin-12 that
Controls Acute Infection by Toxoplasma gondii Tachyzoites. Immunity. 2011; 35(2):249–259.
[PubMed: 21867928]
Tussiwand et al. Page 12
Nature
. Author manuscript; available in PMC 2013 April 25.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
11. Bar-On L, et al. CX3CR1+ CD8alpha+ dendritic cells are a steady-state population related to
plasmacytoid dendritic cells. Proc Natl Acad Sci U S A. 2010; 107:14745–14750. [PubMed:
20679228]
12. Behnke MS, et al. Virulence differences in Toxoplasma mediated by amplification of a family of
polymorphic pseudokinases. Proc Natl Acad Sci U S A. 2011; 108:9631–9636. [PubMed:
21586633]
13. Ginhoux F, et al. The origin and development of nonlymphoid tissue CD103+ DCs. J Exp Med.
2009; 206:3115–3130. [PubMed: 20008528]
14. Modlin RL, Barnes PF. IL12 and the human immune response to mycobacteria. Res Immunol.
1995; 146:526–531. [PubMed: 8839157]
15. den Haan JM, Lehar SM, Bevan MJ. CD8(+) but not CD8(−) dendritic cells cross-prime cytotoxic
T cells in vivo. J Exp Med. 2000; 192:1685–1696. [PubMed: 11120766]
16. Wilson NS, et al. Systemic activation of dendritic cells by Toll-like receptor ligands or malaria
infection impairs cross-presentation and antiviral immunity. Nat Immunol. 2006; 7:165–172.
[PubMed: 16415871]
17. Aliberti J, et al. Essential role for ICSBP in the in vivo development of murine CD8alpha +
dendritic cells. Blood. 2003; 101:305–310. [PubMed: 12393690]
18. Tailor P, Tamura T, Morse HC, Ozato K. The BXH2 mutation in IRF8 differentially impairs
dendritic cell subset development in the mouse. Blood. 2008; 111:1942–1945. [PubMed:
18055870]
19. Edelson BT, et al. Batf3-dependent CD11b(low/−) peripheral dendritic cells are GM-CSF-
independent and are not required for Th cell priming after subcutaneous immunization. PLoS
ONE. 2011; 6:e25660. [PubMed: 22065991]
20. Marquis JF, Lacourse R, Ryan L, North RJ, Gros P. Disseminated and rapidly fatal tuberculosis in
mice bearing a defective allele at IFN regulatory factor 8. J Immunol. 2009; 182:3008–3015.
[PubMed: 19234196]
21. Jackson JT, et al. Id2 expression delineates differential checkpoints in the genetic program of
CD8alpha(+) and CD103(+) dendritic cell lineages. EMBO J. 2011; 30:2690–704. [PubMed:
21587207]
22. Edelson BT, et al. CD8a+ Dendritic Cells Are an Obligate Cellular Entry Point for Productive
Infection by Listeria monocytogenes. Immunity. 2011; 35:236–248. [PubMed: 21867927]
23. Su ZZ, et al. Cloning and characterization of SARI (suppressor of AP-1, regulated by IFN). Proc
Natl Acad Sci U S A. 2008; 105:20906–20911. [PubMed: 19074269]
24. Ravasi T, et al. An atlas of combinatorial transcriptional regulation in mouse and man. Cell. 2010;
140:744–752. [PubMed: 20211142]
25. Brustle A, et al. The development of inflammatory T(H)-17 cells requires interferon-regulatory
factor 4. Nat Immunol. 2007; 8:958–966. [PubMed: 17676043]
26. Klein U, et al. Transcription factor IRF4 controls plasma cell differentiation and class-switch
recombination. Nat Immunol. 2006; 7:773–782. [PubMed: 16767092]
27. Tamura T, Ozato K. ICSBP/IRF-8: its regulatory roles in the development of myeloid cells. J
Interferon Cytokine Res. 2002; 22:145–152. [PubMed: 11846985]
28. Sciammas R, et al. Graded expression of interferon regulatory factor-4 coordinates isotype
switching with plasma cell differentiation. Immunity. 2006; 25:225–236. [PubMed: 16919487]
29. Brass AL, Zhu AQ, Singh H. Assembly requirements of PU. 1-Pip (IRF-4) activator complexes:
inhibiting function in vivo using fused dimers. EMBO J. 1999; 18:977–991. [PubMed: 10022840]
30. Chen L, Glover JN, Hogan PG, Rao A, Harrison SC. Structure of the DNA-binding domains from
NFAT, Fos and Jun bound specifically to DNA. Nature. 1998; 392:42–48. [PubMed: 9510247]
31. Eisenbeis CF, Singh H, Storb U. Pip, a novel IRF family member, is a lymphoid-specific, PU. 1-
dependent transcriptional activator. Genes Dev. 1995; 9:1377–1387. [PubMed: 7797077]
32. Heng TS, Painter MW. The Immunological Genome Project: networks of gene expression in
immune cells. Nat Immunol. 2008; 9:1091–1094. [PubMed: 18800157]
33. Ranganath S, et al. GATA-3-dependent enhancer activity in IL-4 gene regulation. J Immunol.
1998; 161:3822–3826. [PubMed: 9780146]
Tussiwand et al. Page 13
Nature
. Author manuscript; available in PMC 2013 April 25.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
34. Gorman JR, et al. The Ig(kappa) enhancer influences the ratio of Ig(kappa) versus Ig(lambda) B
lymphocytes. Immunity. 1996; 5:241–252. [PubMed: 8808679]
35. Iiizumi S, et al. Simple one-week method to construct gene-targeting vectors: application to
production of human knockout cell lines. Biotechniques. 2006; 41:311–316. [PubMed: 16989091]
36. Edelson BT, et al. CD8a+ Dendritic Cells Are an Obligate Cellular Entry Point for Productive
Infection by Listeria monocytogenes. Immunity. 2011; 35:236–248. [PubMed: 21867927]
37. Mashayekhi M, et al. CD8a+ Dendritic Cells Are the Critical Source of Interleukin-12 that
Controls Acute Infection by Toxoplasma gondii Tachyzoites. Immunity. 2011; 35:249–259.
[PubMed: 21867928]
38. Edelson BT, et al. Peripheral CD103+ dendritic cells form a unified subset developmentally related
to CD8alpha+ conventional dendritic cells. J Exp Med. 2010; 207:823–836. [PubMed: 20351058]
39. Saeij JP, Boyle JP, Grigg ME, Arrizabalaga G, Boothroyd JC. Bioluminescence imaging of
Toxoplasma gondii infection in living mice reveals dramatic differences between strains. Infect
Immun. 2005; 73:695–702. [PubMed: 15664907]
40. Hildner K, et al. Batf3 deficiency reveals a critical role for CD8alpha+ dendritic cells in cytotoxic
T cell immunity. Science. 2008; 322:1097–1100. [PubMed: 19008445]
41. Matsushita H, et al. Cancer exome analysis reveals a T-cell-dependent mechanism of cancer
immunoediting. Nature. 2012; 482:400–404. [PubMed: 22318521]
42. Satpathy AT, et al. Zbtb46 expression distinguishes classical dendritic cells and their committed
progenitors from other immune lineages. J Exp Med. 2012; 209:1135–1152. [PubMed: 22615127]
43. Schraml BU, et al. The AP-1 transcription factor Batf controls T(H)17 differentiation. Nature.
2009; 460:405–409. [PubMed: 19578362]
44. Li C, Wong WH. Model-based analysis of oligonucleotide arrays: expression index computation
and outlier detection. Proc Natl Acad Sci U S A. 2001; 98:31–36. [PubMed: 11134512]
45. Bending D, et al. Highly purified Th17 cells from BDC2.5NOD mice convert into Th1-like cells in
NOD/SCID recipient mice. J Clin Invest. 2009
46. Ise W, et al. The transcription factor BATF controls the global regulators of class-switch
recombination in both B cells and T cells. Nat Immunol. 2011; 12:536–543. [PubMed: 21572431]
47. Ranganath S, et al. GATA-3-dependent enhancer activity in IL-4 gene regulation. J Immunol.
1998; 161:3822–3826. [PubMed: 9780146]
48. Sedy JR, et al. B and T lymphocyte attenuator regulates T cell activation through interaction with
herpesvirus entry mediator. Nat Immunol. 2005; 6:90–98. [PubMed: 15568026]
49. Kanbe E, Zhang DE. A simple and quick method to concentrate MSCV retrovirus. Blood Cells
Mol Dis. 2004; 33:64–67. [PubMed: 15223013]
50. Dignam JD, Lebovitz RM, Roeder RG. Accurate transcription initiation by RNA polymerase II in
a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 1983; 11:1475–1489.
[PubMed: 6828386]
51. Szabo SJ, Gold JS, Murphy TL, Murphy KM. Identification of cis-acting regulatory elements
controlling interleukin-4 gene expression in T cells: roles for NF-Y and NF-ATc [published
erratum appears in Mol Cell Biol 1993 Sep;13(9):5928]. Mol Cell Biol. 1993; 13:4793–4805.
[PubMed: 8336717]
52. Eisenbeis CF, Singh H, Storb U. Pip, a novel IRF family member, is a lymphoid-specific, PU. 1-
dependent transcriptional activator. Genes Dev. 1995; 9:1377–1387. [PubMed: 7797077]
Tussiwand et al. Page 14
Nature
. Author manuscript; available in PMC 2013 April 25.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Figure 1. Intracellular pathogens or IL-12 restore lymphoid CD8α+ cDCs and tissue-resident
CD103+ cDCs in Batf3−/− mice
a, Wild type (WT) and
Batf3
−/− (BATF3 KO) 129SvEv mice were uninfected (CTL) or
infected with Mtb, and spleens harvested and analyzed by FACS at the indicated time.
Histograms for indicated markers are gated as autofluorescent−MHCIIhighCD11c+ cells.
Numbers are percent of cells in the gate. b, Serum IL-12 was measured from individual mice
(a) at the indicated time. c, Wild type (WT) and
Batf3
−/− (BATF3 KO) 129SvEv mice were
treated with vehicle (PBS) or IL-12 (IL12) and analyzed by FACS after 3 days as in (a).
Tussiwand et al. Page 15
Nature
. Author manuscript; available in PMC 2013 April 25.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Figure 2. IL-12-induced CD8α+ cDCs in Batf3−/− mice can cross-present and mediate tumor
rejection
a, From mice in Fig. 1c, DCs were purified by sorting as CD3−DX5−MHCII+CD11c+Sirp-
α−CD24+DEC205+ DCs (CD8DC) and CD3−DX5−MHCII+CD11c+Sirp-
α+CD24−DEC205− DCs (CD4DC) and assayed for cross-presentation7. OT-I proliferation
in response to cDCs mixed with the indicated number of MHC class I-deficient ovalbumin
(Ova)-loaded splenocytes is shown. b, Wild type (WT) or
Batf3
−/− (BATF3 KO) mice
treated with vehicle (PBS) or with IL-12 (IL12) were inoculated with 1×106 H31m1
fibrosarcomas. Tumor size in individual mice is shown. c, Mice in (b) were analyzed by
FACS 11 days after H31m1 inoculation for CD8 T cell infiltration into tumors7.
Tussiwand et al. Page 16
Nature
. Author manuscript; available in PMC 2013 April 25.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Figure 3. Batf compensates for CD8α+ cDC development in Batf3−/− mice
a, Wild type (WT), or
Batf3
−/− (BATF3KO) BM cells were infected with GFP-RV33
(Empty) or retrovirus expressing the indicated cDNA and cultured with Flt3L7. Histograms
for the indicated markers are for B220−CD11c+ cells on day 10. Numbers are the percent of
cells in the gate. b, Inguinal lymph nodes from WT,
Batf3
−/− (BATF3 KO) or
Batf
−/−
Batf3
−/− mice (BATF1/3 DKO) on 129SvEv or C57BL/6 backgrounds were analyzed
by FACS. Shown are histograms for DEC205 and CD8α. c, CD4 T cells of the indicated
genotype were differentiated twice under TH2 conditions5 and analyzed by FACS for
intracellular IL-10.
Tussiwand et al. Page 17
Nature
. Author manuscript; available in PMC 2013 April 25.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Figure 4. Batf2 compensates for Batf3 in CD8α+ and CD103+ cDC development during T. gondii
infection
a, Wild-type (WT) and
Batf2
−/− (BATF2KO) mice were infected with
T. gondii
and
monitored for survival. n=29 for WT (dashed line) and
Batf2
−/− (solid line) mice. b, Shown
are percentages of lung CD103+ DCs of total CD45.2+ cells for uninfected and infected (T.
gondii) mice on day 10. n=5 from one of three experiments. c, WT or
Batf3
−/− (BATF3KO)
BM cells were infected with the indicated retrovirus, cultured with Flt3L and analyzed by
FACS on day 10. d, Groups of 5 mice each of the indicated genotypes were treated with
vehicle (PBS) or IL-12 (IL12) and analyzed by FACS after 3 days. Shown are percentages
of CD8α+ cDCs as a total of splenic cDCs.
Tussiwand et al. Page 18
Nature
. Author manuscript; available in PMC 2013 April 25.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Figure 5. BATF leucine zipper interactions with non-AP-1 factors mediate lineage-specific
actions
a, Structures of chimeric proteins are shown below a diagram of c-Fos. DNA binding
domain (DB), hinge (H), leucine zipper (LZ), amino- (5′) and carboxy-terminus (3′). Flt3L-
treated WT or
Batf3
−/− (BATF3 KO) BM infected with the indicated retrovirus were
analyzed after 10 days. b, 293FT cells expressing both
Batf
and
Irf4
(upper panel) or
Batf
and
Irf4
as indicated (lower panel) were analyzed by EMSA with the indicated probes and
antibodies c, 293FT cells expressing Irf4 (+) and the indicated Batf chimera were analyzed
by EMSA with the AICE1 probe. d, B cells were analyzed by EMSA with the indicated
probe and competitor oligonucleotides (comp). e,
Batf3
−/− (BATF3 KO) BM infected with
the indicated Batf retroviruses s encoding Batf were analyzed as in (a). f, 293FT cells
expressing the indicated Batf mutants were analyzed by EMSA with the AICE1 probe.
Tussiwand et al. Page 19
Nature
. Author manuscript; available in PMC 2013 April 25.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
