Content uploaded by Wei-sheng Feng
Author content
All content in this area was uploaded by Wei-sheng Feng on Dec 09, 2022
Content may be subject to copyright.
Content uploaded by Wei-sheng Feng
Author content
All content in this area was uploaded by Wei-sheng Feng on Jul 27, 2022
Content may be subject to copyright.
Full Terms & Conditions of access and use can be found at
https://www.tandfonline.com/action/journalInformation?journalCode=iipi20
Immunopharmacology and Immunotoxicology
ISSN: (Print) (Online) Journal homepage: https://www.tandfonline.com/loi/iipi20
β-Sitosterol inhibits ovalbumin-induced asthma-
related inflammation by regulating dendritic cells
Ru Wang, Mengnan Zeng, Beibei Zhang, Qinqin Zhang, Jufang Jia, Bing Cao,
Meng Liu, Pengli Guo, Yuhan Zhang, Xiaoke Zheng & Weisheng Feng
To cite this article: Ru Wang, Mengnan Zeng, Beibei Zhang, Qinqin Zhang, Jufang Jia, Bing Cao,
Meng Liu, Pengli Guo, Yuhan Zhang, Xiaoke Zheng & Weisheng Feng (2022) β-Sitosterol inhibits
ovalbumin-induced asthma-related inflammation by regulating dendritic cells, Immunopharmacology
and Immunotoxicology, 44:6, 1013-1021, DOI: 10.1080/08923973.2022.2102990
To link to this article: https://doi.org/10.1080/08923973.2022.2102990
Published online: 28 Jul 2022.
Submit your article to this journal
Article views: 111
View related articles
View Crossmark data
ORIGINAL ARTICLE
b-Sitosterol inhibits ovalbumin-induced asthma-related inflammation by
regulating dendritic cells
Ru Wang
a,b
, Mengnan Zeng
a,b
, Beibei Zhang
a,b
, Qinqin Zhang
a,b
, Jufang Jia
a,b
, Bing Cao
a,b
, Meng Liu
a,b
,
Pengli Guo
a,b
, Yuhan Zhang
a,b
, Xiaoke Zheng
a,b,c
and Weisheng Feng
a,b,c
a
School of Pharmacy, Henan University of Chinese Medicine, Zhengzhou, China;
b
The Engineering and Technology Center for Chinese
Medicine Development of Henan Province, Zhengzhou, China;
c
Co-construction Collaborative Innovation Center for Chinese Medicine and
Respiratory Diseases by Henan and Education Ministry of P. R., Henan University of Chinese Medicine, Zhengzhou, China
ABSTRACT
Aim: To investigate the effects of b-sitosterol (B-SIT) and the underlying mechanisms of action in an
ovalbumin-induced rat model of asthma.
Methods: The pathological and morphological changes in lung and tracheal tissues were observed by
H&E, PAS, and Masson’s staining. The levels of IgE, TNF-a, and IFN-cin the bronchoalveolar lavage fluid
(BALF) and those of IL-6, TGF-b1, and IL-10 in serum were measured by ELISA. The relative expression
levels of IL-5, IL-13, IL-21, CD11c, CD80, and CD86 mRNA in lung tissue were examined by RT-qPCR.
Flow cytometry was performed to assess the levels of immune cells, including macrophages and neu-
trophils in spleen tissue and Th cells, Tc cells, NK cells, and DCs in peripheral blood. The protein
expression levels of CD68, MPO, CD11c, CD80, and CD86 were detected by western blotting or
immunohistochemistry.
Results: B-SIT improved the injury in OVA-induced pathology, decreased the levels of inflammatory
factors of IgE, TNF-a, IL-6, TGF-b1, IL-5, IL-13, and IL-21 and increased the levels of IFN-cand IL-10. In
addition, B-SIT decreased the number of macrophages and neutrophils and the relative expression lev-
els of CD68 and MPO in the spleen. Moreover, B-SIT increased the number of Th cells, Tc cells, NK
cells, and DCs in peripheral blood and upregulated the levels of CD11c, CD80, and CD86 in the spleen
and lung.
Conclusion: B-SIT improved symptoms in a rat model of asthma likely via the inhibition of inflamma-
tion by regulating dendritic cells.
ARTICLE HISTORY
Received 14 February 2022
Accepted 9 July 2022
KEYWORDS
Asthma; b-sitosterol;
inflammation; immune
response; dendritic cells
Introduction
Asthma is caused by allergen inhalation, which leads to air-
way hyperresponsiveness, inflammatory cell infiltration,
mucous production, airway remodeling, and airway obstruc-
tion [1], in addition to varying symptoms of wheezing, dys-
pnea, chest tightness, coughing, and reversible airflow
obstruction [2]. It is estimated that more than 300 million
people worldwide suffer from the disease, resulting in huge
medical expenses and economic burden; nevertheless, the
medication currently available to treat asthma offers only
symptomatic relief and has several limitations [3,4]. Studies
have shown that an imbalance in the immune microenviron-
ment is the main cause of asthma pathogenesis [5], during
which immune cells release cytokines, resulting in airway
inflammation [6,7]; however, the underlying mechanisms
remain unclear.
In allergic asthma, dendritic cells (DCs) play essential roles
in the initiation, maintenance, and propagation of Th2 aller-
gic responses, and is a key factor in mediated immune
response [8]. DCs represent the most potent antigen-present-
ing cells (APCs) of the immune system, acting as a bridge
between innate and adaptive immunity and being critically
involved in the maintenance of immune homeostasis [9].
Moreover, DCs can secrete cytokines to host inflammatory
cells that play a regulatory activity [10]; however, the manner
in which DCs help to improve asthma pathology
remains unclear.
B-SIT is one of the phytosterols is widely exists in various
kinds of plant seeds, displays anti-tumor, anti-microbial, and
immunomodulatory activities [11], and can specifically
increase the activity of Th1 cells [12]. Studies have shown
that B-SIT possesses important immune regulatory and mod-
ulatory properties [13] and plays an important role in the
pathogenesis of the inflammatory cytokine response [14];
nevertheless, reports regarding improvements in asthma fol-
lowing B-SIT treatment are scarce. One study demonstrated
that 50 mg/kg B-SIT sufficiently prevented chronic liver injury
in a carbon tetrachloride-induced rat model [15]; therefore,
we used 50 mg/kg of B-SIT to study the therapeutic effect of
B-SIT in asthmatic rats by evaluating the inflammatory and
immune responses with a view to finding novel targets and
treatments for asthma.
CONTACT Weisheng Feng fwsh@hactcm.edu.cn;XiaokeZheng zhengxk.2006@163.com Henan University of Chinese Medicine, Zhengzhou, 450046, China
ß2022 Informa UK Limited, trading as Taylor & Francis Group
IMMUNOPHARMACOLOGY AND IMMUNOTOXICOLOGY
2022, VOL. 44, NO. 6, 1013–1021
https://doi.org/10.1080/08923973.2022.2102990
Materials and methods
Reagents
Ovalbumin (OVA) (SLCH2414) was purchased from Sigma-
Aldrich; aluminum hydroxide gel (ImjectV
RAlum, 77161) was
bought from Thermo Fisher Scientific; dexamethasone
(H41021610) was a positive control procured from Shanghai
Jinbuhuan Lankao Pharmaceutical Co., Ltd.; and B-SIT
(C12368373) was purchased from Shanghai Macklin
Biochemical Co., Ltd. Anti-mouse F4/80 (565853), anti-mouse
Ly-6G and Ly-6C (553128), anti-CD3e (550353), anti-CD4
(553052), and anti-CD49b (553858) antibodies were bought
from BD Pharmingen
TM
. Anti-CD8a (11-0081-82), anti-CD3e
(46-0033-82), anti-CD11c (12-0114-82), and anti-CD86 (11-
0860-82) antibodies were procured from Thermo Fisher
Scientific. Antibodies against CD11c (A1508), CD80 (A16039),
CD86 (A1199), b-actin (Ac026), MPO (A1374), and CD68
(A6554) were purchased from ABclonal. Goat anti-rabbit IgG
(925-6807) and goat anti-rabbit IgG H&L (HRP) (ab209101)
were bought from Li-COR and Abcam, respectively.
Animals
6–8 weeks old male SD rats (SPF, weighing 180–220 g) were
purchased from JI NAN PENG YUE Experimental Animal
Breeding Co. (License SCXK (LU) 20190003). Experimental
Animal License No. SYXK(Yu)2020-0004. Animals were housed
in a clean-grade room with a 12 h light/dark cycle, a constant
temperature of 24 C, and free access to food and drinking
water. All experiments and procedures were approved by
the Animal Ethics Committee of the Henan University of
Chinese Medicine, Zhengzhou, China. (Approval No.
DWLL2018080003). Rats were allowed to acclimate for one
week and were subsequently randomly divided into the fol-
lowing groups: normal group (CON, n¼10); model group (M,
n¼10); dexamethasone group (DEX, 0.075 mg/kg [16],
n¼10); and B-SIT group (B-SIT, 50 mg/kg, n¼10). The CON
group was intraperitoneally injected with normal saline(NS,
1 ml/0.2 kg) and the M, DEX, and B-SIT groups were sensi-
tized with intraperitoneally OVA (10 mg/0.2 kg) and alumi-
num hydroxide gel (10 mg/0.2 kg) dissolved in NS on days 0
and 7. One week after the final sensitization, the M, DEX,
and B-SIT groups were aerosolized 2% OVA (SLCD1615) by
inhalation using an ultrasonic sprayer (402AI, yuwell) for
30 min on seven consecutive days, and the CON group was
replaced with NS for the 2% OVA. Meanwhile, 30 min before
atomization, the CON group received double distilled water
by intragastric, the DEX and M groups received intragastric
administration of DEX and the B-SIT group received intragas-
tric administration of B-SIT. Time line of OVA-induced asthma
model as shown in Figure 1.
Pathological analysis
Rat lungs and trachea were separated and fixed in 4% parafor-
maldehyde for 24 h. Subsequently, the tissues were dehydrated
in increasing concentrations of ethanol, treated with xylene,
embedded in paraffin, and cut into 5lm-thick sections. The
sections were dewaxed and subjected to alcohol gradient elu-
tion. Lung tissue was stained with hematoxylin and eosin (H&E),
Periodic Acid Schiff (PAS), and Masson’s stain. The tracheal tis-
sues were prepared appropriately and stained with H&E.
ELISA analysis
Following anesthesia, blood and BALF were removed from the
rats and centrifuged at 4C, 3000 rpm/min for 15 min. The
supernatant was collected and stored at 4 C. The levels of IgE
(ERC117, NEOBIOSCIENCE), TNF-a(ERC102a, NEOBIOSCIENCE),
and IFN-c(RK00199, ABclonal) in BALF and the levels of IL-6
(RK00020, ABclonal), IL-10 (RK00050, ABclonal), and TGF-b1
(ERC107b, NEOBIOSCIENCE) in serum were measured by ELISA
according to the kit manufacturer’sinstructions.
Real-time quantitative PCR (RT-qPCR) analysis
An RNA extraction kit (R1200, Solarbio) was used to extract
total RNA from lung tissue according to the manufacturer’s
instructions. RNA obtained quantitatively by the Nano
Drop
TM
One Ultraviolet-spectrophotometer (Thermo
Scientific) and subsequently reverse transcribed to acquire
the template DNA using a BeyoRT
TM
III First Strand cDNA
Synthesis Kit (D7178M, Beyotime). Fluorescence quantitative
PCR was performed using the QuantiNova
TM
SYBR Green PCR
Kit (Qiagen, Germany). The primers used for RT-qPCR amplifi-
cation are listed in Table 1.
Table 1. Sequences of the primers for RT-qPCR.
Gene Primer sequences (50-30)
Rat IL-5 F: GTTGACGAGCAATGAGACGATG
R: TGGTATTTCCACAGTGCCCC
Rat IL-13 F: GTGGCCCTCAGGGAGCTTAT
R: TGTCAGGTCCACGCTCCATA
Rat IL-21 F: AGAAAGCCAAACTCAAGCCATC
R: TCATACAAATCACAGGAAGGGC
Rat CD11c F: GCGTGGAGAACTTTGATGCTTT
R: CAGAACGGGTCCATCAGGTGT
Rat CD80 F: CAGGTTCATTCATCTCTTTGTGC
R: GACAGCAATGCCTTTTCTCTCAC
Rat CD86 F: AGACATGTGTAACCTGCACCAT
R: CTGCGCCCAAATAGTGTTCG
Rat GAPDH F: CTGGAGAAACCTGCCAAGTATG
R: GGTGGAAGAATGGGAGTTGCT
Figure 1. Time line of OVA-induced asthma model. For sensitization, Male SD
rats received an i.p injection of OVA and aluminum hydroxide or NS on days 0
and 7. From days 14–20, the rats were challenged with aerosolized 2% OVA or
NS in a plexiglass chamber for 30 min per day and DEX, b-SIT was given 30 min
in advance. Samples were collected on day 21. Abbreviations: OVA: ovalbumin;
NS: normal saline; i.p: intraperitoneal; i.g: intragastric.
1014 R. WANG ET AL.
Flow cytometry analysis of immune cells
Fresh spleen tissue was ground to 70 mm, rinsed with cold
PBS, transferred to an EP tube, and centrifuged at 500 g for
5 min centrifugal. The supernatant was discarded and the
cells were resuspended in 300 ll cold PBS and divided
equally among the tubes. Rat anti-mouse F4/80 and PE-con-
jugated rat anti-mouse Ly-6G and Ly-6C antibodies were
used. Take 100 ll aliquot of rat whole blood was added to a
flow tube containing anti-CD3e, anti-CD4, and anti-CD8a
antibodies to label Th and Tc cells; anti-CD49b and anti-
CD3e antibodies to label NK cells; and anti-CD11c and
anti-CD86 antibodies to label DCs. The tubes were incubated
in the light for 30 min, followed by the addition of 2 ml 1
red blood cell lysis buffer and a further 10-min incubation.
The tubes were subsequently centrifuged at 500 g for 5 min
and the supernatant was discarded. Following resuspension
and centrifugation twice, the supernatant was discarded,
300 ll PBS was added, and the cells were analyzed by flow
cytometry (FACS Aria
TM
III, BD).
Western blotting analysis
Total protein was extracted from lung tissue using a
total protein extraction kit (BC3710, Solarbio), and the pro-
tein concentration was measured using a BCA protein
quantitation kit (PC0020, Solarbio). Each sample was nor-
malized to 60 lg protein, separated using SDS-PAGE, and
transferred to PVDF membranes using a semi-dry system
(Bio-Rad). Subsequently, the membranes were blocked
with BSA for 1.5 h, incubated with primary antibody for 3 h
(anti-CD11c, anti-CD80, anti-CD86, and anti-b-actin), and
then incubated with goat anti-rabbit IgG for 1 h in the
dark. Protein levels were quantitated using Image Studio
version 5.2.
Immunohistochemistry
Spleen tissue was paraffin embedded, dewaxed, dehydrated,
and cut into 5 lm-thick sections. Sections were incubated
with anti-MPO (1:100), anti-CD68 (1:100), anti-CD11c (1:100),
anti-CD80 (1:100), and anti-CD86 (1:100) antibodies, followed
by goat anti-rabbit IgG H&L (HRP) (1:300). Hematoxylin was
used as a counterstain and neutral balsam was used to
mount the sections for observation.
Statistical analysis
SPSS 26.0 was used for statistical analysis. The measurement
results are presented as the mean ± standard deviation (SD).
Using the single factor analysis of variance (One-Way-
Figure 2. B-SIT could improve lung structural organization in asthmatic rats. (A) Lung tissue stained with hematoxylin and eosin (H&E) (20). (B) Lung tissue stained
with Periodic Acid Schiff (PAS) (20). (C) Lung tissue stained with Masson’s stain (20). (D) Tracheal tissue stained with hematoxylin and eosin (H&E) (5and 20).
IMMUNOPHARMACOLOGY AND IMMUNOTOXICOLOGY 1015
ANOVA) between groups. In all analyses, pvalue was lower
than .05 was taken as statistically significant.
Results
B-SIT could improve lung structural organization in
asthmatic rats
The H&E staining of the lungs results as shown in Figure
2(A), which included inflammatory cells infiltrate into the
peribronchial and perivascular areas and bronchial wall thick-
ening were marked in OVA-induced asthmatic rats; besides,
goblet cell proliferation and excessive mucus secretion were
observed by PAS staining (Figure 2(B)) and blue collagen
sediment was clearly visible around the bronchi by Masson’s
staining (Figure 2(C)); meanwhile, goblet cell hyperplasia was
observed by H&E staining of tracheal tissue (Figure 2(D)).
However, the injury in OVA-induced pathology were
improved by DEX and B-SIT.
B-SIT could inhibit the inflammatory response in
asthmatic rats
The results of inflammatory factors showed that the levels of
IgE and TNF-ain BALF and those of IL-6 and TGF-b1in
serum were increased, and the level of IFN-cin BALF and
that of IL-10 in serum were significantly decreased in OVA-
induced asthmatic rats. These changes were effectively
reversed by DEX and B-SIT (Figure 3(A–F)). Moreover, the
relative expression levels of IL-5, IL-13, and IL-21 mRNA in
lung tissue were significantly increased but could be reduced
by DEX and B-SIT (Figure 3(G–I)).
B-SIT could reduce the percentage of F4/80
1
macrophages and Ly-6G
1
neutrophils in spleen tissue in
asthmatic rats
Flow cytometry analyzed the effects of B-SIT on the number of
F4/80
þ
macrophages and Ly-6G
þ
neutrophilsinspleentissue
and the results (Figure 4) showed that the numbers of macro-
phages (F4/80
þ
) and neutrophils (Ly-6G
þ
)inOVA-induced
asthmatic rats were significantly increased; and the relative
expression levels of CD68 and MPO were also significantly
increased, all of which were attenuated by DEX and B-SIT.
B-SIT could increase the percentages of Th cells, Tc
cells, NK cells, and DCs in the peripheral blood in
asthmatic rats
Th cells, Tc cells, NK cells, and DCs in the peripheral blood
were detected by flow cytometry (Figure 5), the results of
which indicate that the numbers of all of these cells were
Figure 3. B-SIT could inhibit the inflammatory response in asthmatic rats. (A, B, C) The levels of IgE, TNF-a, and IFN-cin BALF. (D, E, F) The levels of TGF-b1, IL-6,
and IL-10 in serum. G, H, I. The relative expression levels of IL-5, IL-13, and IL-21 mRNA in lung tissue. p<0.05, p<0.01 compared with the M group.
1016 R. WANG ET AL.
significantly reduced in OVA-induced asthmatic rats, while
DEX and B-SIT significantly increased their number.
B-SIT could increase the levels of CD11c, CD80, and
CD86 in asthmatic rats
The results of DCs surface molecules of CD11c, CD80 and
CD86 were shown that the mRNA and the protein levels of
CD11c, CD80 and CD86 in lung tissue and the levels of
CD11c, CD80 and CD86 in spleen tissue were significantly
decreased in OVA-induced asthma rats, which were signifi-
cantly increased by DEX and B-SIT (Figure 6).
Discussion
Asthma causes serious health and socioeconomic problems
worldwide [17]. Over recent decades, asthma treatment has
focused on relieving inflammation and bronchoconstriction
[18,19]. Despite major advances in research, the prevalence
of asthma is continuously increasing [20]. The study found
Figure 4. B-SIT could reduce the percentage of F4/80
þ
macrophages and Ly-6G
þ
neutrophils in spleen tissue in asthmatic rats. (A) Macrophage (F4/80
þ
) and neu-
trophil (Ly-6G
þ
) positive cell populations in each group. (B) Immunohistochemistry was used to detect the expression levels of CD68 and MPO in spleen tissue
(40). Brown areas show the protein expression of CD68 and MPO. p<0.05, p<0.01 compared with the M group.
IMMUNOPHARMACOLOGY AND IMMUNOTOXICOLOGY 1017
that plant sterols have a substantial anti-inflammatory effect
[21], and B-SIT as one kind of plant sterols that can protect
against airway inflammation actions [22]. With glucocorticoid
effects of DEX is commonly used in the treatment of asthma
due to its anti-inflammatory, anti-allergic, and immunomodu-
latory effects [23]. B-SIT and DEX share similar functions,
including anti-inflammatory, immunomodulatory, but reports
describing its effect on asthma are scarce and the underlying
mechanisms of action remain elusive. Therefore, we chose
DEX as a positive control to demonstrate that B-SIT has a
protective effect on asthma pathology by controlling inflam-
mation and the immune response and enhancing the func-
tion of DCs.
OVA is widely used to induce asthma in experimental
animals [24], the main symptoms of which are characterized
by the influx of immune cells into the lungs, excessive
mucus production, and airway inflammation [25]. By observ-
ing the histopathological changes, we found that B-SIT
improved inflammatory cell infiltration, goblet cell
hyperplasia, mucus hypersecretion, and collagen cell depos-
ition in the bronchial area. Prompt B-SIT could protect
asthma rat organizational structure and reduce airway
inflammation. Asthma is induced by sensitization to and
challenge with foreign antigens [18]. Following exposure to
allergens, immune cells secrete cytokines that are involved
in inflammatory and immune responses [26]. Th2 cytokines,
such as IL-5 and IL-13, prominently mediate the develop-
ment of asthma and airway inflammation [27]. Zheng et al.
[28] found that an active ingredient in safflower may be a
potential anti-inflammatory agent for the treatment of
asthma by increasing these Th2 factors. TNF-acan induce
inflammatory cell influx into the lungs and airways [29], and
TGF-b1 and IL-6 can induce airway smooth muscle cell pro-
liferation and hypertrophy by promoting the release of
inflammatory mediators [30]. TNF-a,TGF-b1, and IL-6, as
proinflammatory factors [31]canpromotethereleaseof
inflammatory mediators and promote inflammation and air-
way contraction. According to the present study, the levels
Figure 5. B-SIT could increase the percentage of Th cells, Tc cells, NK cells, and DCs in the peripheral blood in asthmatic rats. (A) Th and Tc (CD3e
þ
CD8a
þ
,
CD3e
þ
CD4
þ
) positive cell populations in each group. (B) NK (CD49b
þ
CD3e
þ
) positive cell population in each group. (C) Dendritic (CD11c
þ
CD86
þ
) positive cell
population in each group. p<0.05, p<0.01 compared with the M group.
1018 R. WANG ET AL.
of IgE and TNF-ain BALF and those of IL-6 and TGF-b1in
serum were increased in OVA-induced asthmatic rats. In
addition, the levels anti-inflammatory cytokines, IL-10 [32]
and IFN-c[33], were significantly decreased in serum from
OVA-induced asthmatic rats, and the relative expression lev-
els of IL-5, IL-13, and IL-21 mRNA were significantly
increased. All these changes were reversed by B-SIT. Prompt
inflammatory factors play an important role in the
Figure 6. B-SIT could increase the levels of CD11c, CD80, and CD86 in asthmatic rats. (A) The relative expression levels of CD11c, CD80, and CD86 mRNA in lung tis-
sue. (B) The protein expression levels of CD11c, CD80, and CD86 in lung tissue. (C) Immunohistochemistry was used to detect the protein expression levels of
CD11c, CD80, and CD86 in spleen tissue (40). Brown areas show protein expression. p<0.05, p<0.01 compared with the M group.
IMMUNOPHARMACOLOGY AND IMMUNOTOXICOLOGY 1019
development of asthma, and B-SIT likely adjusts the levels
of these factors to improve symptoms in asthmatic rats.
The release of cytokines is dependent on the immune
cells, by allergen, the immune cells release of cytokines play
an immune response. Studies have shown that macrophages
can affect airway inflammation, remodeling, and mucus
hypersecretion [34]; and thus, by restraining macrophage
function, allergic airway inflammation can be alleviated [35].
Studies have demonstrated that a reduction in the number
of macrophages inhibits inflammation in asthmatic rats [36].
Neutrophils are known to be ‘first responder’immune cells
and are associated with exacerbated inflammation [37]; an
increase in the number of neutrophils can worsen the symp-
toms of asthma [38]. In the present study, we found that the
numbers of macrophages and neutrophils in OVA-induced
asthmatic rats were significantly increased but were reduced
by B-SIT. Moreover, we evaluated the presence of the macro-
phage marker, CD68 [39], and the neutrophil marker, MPO
[40]. These results were consistent, indicating that the pres-
ence of increased numbers of macrophages and neutrophils
may worsen the symptoms of asthma by adjusting the
inflammatory mechanism, and inhibiting their action could
relieve asthma.
Studies have demonstrated that after differentiation, DCs
appear dysfunctional, which may lead to immune system
dysregulation and prolongation of airway inflammation [41].
DCs are known to play a key role in the release of proinflam-
matory cytokines during asthma pathogenesis. After allergen
stimulation, DC surface factors can prompt T cell differenti-
ation. On one hand, T cells interact with B cells, induce IgE,
and can stimulate Th2 cells to secrete the proinflammatory
factors, IL-5 and IL-13 [42,43]; on the other hand, DCs are
able to stimulate Treg cells to secrete IL-10 and TGF-b1[14].
In addition, DCs can induce NK cell activation [44], and
research has shown that an increase in the number of NK
cells can reduce asthma airway inflammation [45]; hence,
DCs play an important role in the control of inflammatory
factors and improvement of asthma symptoms by B-SIT. Our
experimental results clearly confirm that B-SIT significantly
increased the number of DCs, Th cells, Tc cells, and NK cells.
In addition, CD11c, CD80 and CD86 as DCs surface molecule
[46], B-SIT significantly increased the relative mRNA and pro-
tein expression levels of CD11c, CD80, and CD86 in lung and
spleen tissue. Taken together, these data demonstrate that
B-SIT could exert anti-inflammatory and immunomodulatory
actions, likely by increasing the number of DCs and regulat-
ing their functions.
Conclusion
B-SIT improved symptoms in a rat model of asthma, likely
via the inhibition of inflammation by regulating DCs.
Disclosure statement
No potential conflict of interest was reported by the author(s).
Funding
This work was supported by the National Key Research and
Development Project (The Major Project for Research of the
Modernization of TCM): [2017YFC1702800, 2019YFC1708802], Henan
province high-level personnel special support ‘ZhongYuan One
Thousand People Plan’-Zhongyuan Leading Talent [ZYQR201810080].
References
[1] Yao Y, Zeng QX, Deng XQ, et al. Connexin 43 upregulation in
mouse lungs during ovalbumin-induced asthma. PLOS One. 2015;
10(12):e0144106.
[2] Theofani E, Semitekolou M, Morianos I, et al. Targeting NLRP3
inflammasome activation in severe asthma. J Clin Med. 2019;
8(10):1615.
[3] Wang Q, Cui Y, Wu X, et al. Evodiamine protects against airway
remodelling and inflammation in asthmatic rats by modulating
the HMGB1/NF-kappaB/TLR-4 signalling pathway. Pharm Biol.
2021;59(1):192–199.
[4] Xue M, Xu S, Su L, et al. Surfactant protein-A inhibits thymic stro-
mal lymphopoietin-mediated T follicular helper cell differentiation
and IgE production in asthma. Clin Immunol. 2021;231:108822.
[5] Zhu X, Cui J, Yi L, et al. The role of T cells and macrophages in
asthma pathogenesis: a new perspective on mutual crosstalk.
Mediators Inflamm. 2020;2020(7835284):7835284.
[6] Lambrecht BN, Hammad H. The immunology of asthma. Nat
Immunol. 2015;16(1):45–56.
[7] Li H, Li J, Lu T, et al. DZNep attenuates allergic airway inflamma-
tion in an ovalbumin-induced murine model. Mol Immunol. 2021;
131:60–67.
[8] Morianos I, Semitekolou M. Dendritic cells: critical regulators of
allergic asthma. Int J Mol Sci. 2020;21(21):7930.
[9] Small EJ, Fratesi P, Reese DM, et al. Immunotherapy of hormone-
refractory prostate cancer with antigen-loaded dendritic cells. J
Clin Oncol. 2000;18(23):3894–3903.
[10] Leite Dantas R, Freff J, Ambree O, et al. Dendritic cells: neglected
modulators of peripheral immune responses and neuroinflamma-
tion in mood disorders? Cells. 2021;10(4):941.
[11] Yuk JE, Woo JS, Yun CY, et al. Effects of lactose-beta-sitosterol
and beta-sitosterol on ovalbumin-induced lung inflammation in
actively sensitized mice. Int Immunopharmacol. 2007;7(12):
1517–1527.
[12] Schuijs MJ, Hammad H, Lambrecht BN. Professional and ’amateur’
antigen-presenting cells in type 2 immunity. Trends Immunol.
2019;40(1):22–34.
[13] Bouic PJ. The role of phytosterols and phytosterolins in immune
modulation: a review of the past 10 years. Curr Opin Clin Nutr
Metab Care. 2001;4(6):471–475.
[14] Kurano M, Hasegawa K, Kunimi M, et al. Sitosterol prevents obes-
ity-related chronic inflammation. Biochim Biophys Acta Mol Cell
Biol Lipids. 2018;1863(2):191–198.
[15] Devaraj E, Roy A, Royapuram Veeraragavan G, et al. Beta-
Sitosterol attenuates carbon tetrachloride-induced oxidative
stress and chronic liver injury in rats. Naunyn Schmiedebergs
Arch Pharmacol. 2020;393(6):1067–1075.
[16] Zhang B, Zeng M, Zhang Q, et al. Mechanism of “ephedrae
Herba-Descurainiae semen lepidii semen”combination in treat-
ment of bronchial asthma based on network pharmacology and
experimental verification. Chin J Chin Mater Med. 2022; 1–15.
[17] Dharmage SC, Perret JL, Custovic A. Epidemiology of asthma in
children and adults. Front Pediatr. 2019;7:246.
[18] Kim BH, Lee S. Sophoricoside from Sophora japonica ameliorates
allergic asthma by preventing mast cell activation and CD4(þ)T
cell differentiation in ovalbumin-induced mice. Biomed
Pharmacother. 2021;133:111029.
[19] Wechsler ME. Current and emerging biologic therapies for
asthma and COPD. Respir Care. 2018;63(6):699–707.
1020 R. WANG ET AL.
[20] Nam HH, Lee JH, Ryu SM, et al. Gekko gecko extract attenuates
airway inflammation and mucus hypersecretion in a murine
model of ovalbumin-induced asthma. J Ethnopharmacol. 2022;
282:114574.
[21] Brull F, De Smet E, Mensink RP, et al. Dietary plant stanol ester
consumption improves immune function in asthma patients:
results of a randomized, double-blind clinical trial. Am J Clin
Nutr. 2016;103(2):444–453.
[22] Mahajan SG, Mehta AA. Suppression of ovalbumin-induced Th2-
driven airway inflammation by beta-sitosterol in a guinea pig
model of asthma. Eur J Pharmacol. 2011;650(1):458–464.
[23] Wu YF, Chen YQ, Li Q, et al. Supplementation with tetrahydrocur-
cumin enhances the therapeutic effects of dexamethasone in a
murine model of allergic asthma. Int Arch Allergy Immunol. 2020;
181(11):822–830.
[24] Durrant DM, Metzger DW. Emerging roles of T helper subsets in
the pathogenesis of asthma. Immunol Invest. 2010;39(4–5):
526–549.
[25] Casaro M, Souza VR, Oliveira FA, et al. OVA-Induced allergic air-
way inflammation mouse model. Methods Mol Biol. 2019;1916:
297–301.
[26] Aherne SA, O’Brien NM. Modulation of cytokine production by
plant sterols in stimulated human jurkat T cells. Mol Nutr Food
Res. 2008;52(6):664–673.
[27] Kubo M. Innate and adaptive type 2 immunity in lung allergic
inflammation. Immunol Rev. 2017;278(1):162–172.
[28] Zheng M, Guo X, Pan R, et al. Hydroxysafflor yellow a alleviates
ovalbumin-induced asthma in a Guinea pig model by attenuate-
ing the expression of inflammatory cytokines and signal trans-
duction. Front Pharmacol. 2019;10:328.
[29] Yan Y, Liu L, Dou Z, et al. Soufeng yuchuan decoction mitigates
the ovalbumin-induced lung damage in a rat model of asthma.
Biomed Pharmacother. 2020;125:109933.
[30] Yamaya M, Nomura K, Arakawa K, et al. Clarithromycin decreases
rhinovirus replication and cytokine production in nasal epithelial
cells from subjects with bronchial asthma: effects on IL-6, IL-8
and IL-33. Arch Pharm Res. 2020;43(5):526–539.
[31] Zhang Q, Feng A, Zeng M, et al. Chrysosplenol D protects mice
against LPS-induced acute lung injury by inhibiting oxidative
stress, inflammation, and apoptosis via TLR4-MAPKs/NF-kappaB
signaling pathways. Innate Immun. 2021;27(7-8):514–524.
[32] Cellat M, Kuzu M,
_
Is¸ler CT, et al. Tyrosol improves ovalbumin
(OVA)-induced asthma in rat model through prevention of airway
inflammation. Naunyn Schmiedebergs Arch Pharmacol. 2021;
394(10):2061–2075.
[33] Mitchell C, Provost K, Niu N, et al. IFN-gamma acts on the airway
epithelium to inhibit local and systemic pathology in allergic air-
way disease. J Immunol. 2011;187(7):3815–3820.
[34] Lee JW, Chun W, Lee HJ, et al. The role of macrophages in the
development of acute and chronic inflammatory lung diseases.
Cells. 2021;10(4):897.
[35] van der Veen TA, de Groot LES, Melgert BN. The different faces
of the macrophage in asthma. Curr Opin Pulm Med. 2020;26(1):
62–68.
[36] Lee HS, Park DE, Bae B, et al. Tranglutaminase 2 contributes to
the asthmatic inflammation by modulating activation of alveolar
macrophages. Immun Inflamm Dis. 2021;9(3):871–882.
[37] Qiu Y, Zhu J, Bandi V, et al. Bronchial mucosal inflammation and
upregulation of CXC chemoattractants and receptors in severe
exacerbations of asthma. Thorax. 2007;62(6):475–482.
[38] Casal Moura M, Berti A, Keogh KA, et al. Asthma control in
eosinophilic granulomatosis with polyangiitis treated with rituxi-
mab. Clin Rheumatol. 2020;39(5):1581–1590.
[39] Du X, Gao Y, Sun P, et al. CD163(þ)/CD68(þ) tumor-associated
macrophages in angiosarcoma with lymphedema. Int J Clin Exp
Pathol. 2018;11(4):2106–2111.
[40] Kargapolova Y, Geißen S, Zheng R, et al. The enzymatic and non-
enzymatic function of myeloperoxidase (MPO) in inflammatory
communication. Antioxidants. 2021;10(4):562.
[41] Holt PG, Upham JW. The role of dendritic cells in asthma. Curr
Opin Allergy Clin Immunol. 2004;4(1):39–44.
[42] Kianian F, Karimian SM, Kadkhodaee M, et al. Protective effects of
ascorbic acid and calcitriol combination on airway remodelling in
ovalbumin-induced chronic asthma. Pharm Biol. 2020;58(1):
107–115.
[43] Wang Y, Liao K, Liu B, et al. GITRL on dendritic cells aggravates
house dust mite-induced airway inflammation and airway hyper-
responsiveness by modulating CD4(þ) T cell differentiation.
Respir Res. 2021;22(1):46.
[44] Degli-Esposti MA, Smyth MJ. Close encounters of different kinds:
dendritic cells and NK cells take centre stage. Nat Rev Immunol.
2005;5(2):112–124.
[45] Haspeslagh E, Helden MJ, Deswarte K, et al. Role of NKp46(þ)
natural killer cells in house dust mite-driven asthma. EMBO Mol
Med. 2018;10(4):e8657.
[46] Li J, Zhang F, Li J. The immunoregulatory effects of traditional
Chinese medicine on treatment of asthma or asthmatic inflamma-
tion. Am J Chin Med. 2015;43(6):1059–1081.
IMMUNOPHARMACOLOGY AND IMMUNOTOXICOLOGY 1021
