Content uploaded by Wang Youling
Author content
All content in this area was uploaded by Wang Youling
Content may be subject to copyright.
Recombinant Chicken Interferon-aInhibits H9N2 Avian
Influenza Virus Replication In Vivo by Oral Administration
Shanshan Meng,
1,2
Limin Yang,
1
Chongfeng Xu,
1,2
Zhuoming Qin,
3
Huaiying Xu,
3
Youling Wang,
3
Lei Sun,
1
and Wenjun Liu
1,4
Chicken interferon-alpha (ChIFN-a) has been demonstrated to be an important cytokine in antiviral immunity.
However, the preventive or therapeutic effect of ChIFN-aas an oral antiviral agent on avian influenza virus (AIV)
infection has not been fully clarified in chickens systemically. In the present study, we investigated the anti-H9N2
AIV effect of ChIFN-aon a cohort of 7- and 33-day-old specific pathogen-free (SPF) chickens by oral administration.
Results showed that both the ChIFN-apreventive and therapeutic groups exhibited significantly reduced viral load
in trachea when compared with the virus-challenged control group. The therapeutic effect was better than the
preventive effect on 7-day-old SPF chickens, which is opposite to 33-day-old SPF chickens. We speculated that T-
dependent lymphocyte system of 33-day-old SPF chickens might be easier to be stimulated by ChIFN-athan that of
7-day-old SPF chickens. In addition, there was no side effect on the body weight of chickens treated with ChIFN-a.
We also found that IFN-stimulated genes (ISGs) (20,50-oligoadenylate synthetase and Mx1) were upregulated in
groups treated by ChIFN-aand/or virus, indicating that these 2 ISGs not only participated in anti-AIV response
in vivo but also could be induced by oral administration of ChIFN-a. The present study suggested that ChIFN-acould
be used as a potential preventive and therapeutic antiviral agent against H9N2 AIV infection by oral administration.
Introduction
Chicken interferon-a(ChIFN-a) belongs to type I IFNs
and plays an essential role in the host antiviral response
through stimulating T-dependent lymphocyte system and
induction of numerous IFN-stimulated genes (ISGs) (Rose
1979; Sekellick and others 1994; Li and others 2005; Cheva-
liez and Pawlotsky 2009). There is evidence that ChIFN-a
administrated by oral ingestion or intravenous injection in-
hibits many epidemic avian viruses, such as infectious bron-
chitis virus, infectious bursal disease virus, and Newcastle
disease virus (Marcus and others 1999; Mo and others 2001;
Pei and others 2001). It has also been reported that intranasal
administration of human IFN-acan reduce the morbidity of
seasonal influenza A virus in ferrets (Kugel and others 2009).
More importantly, the H5N1 influenza viral replication at
early stage in mice can be controlled by the type I IFN
(Szretter and others 2009).
It has been elucidated that ChIFN-acould induce the
expression of numerous ISGs. Two of these genes, Mx1 and
20,50-oligoadenylate synthetase (20,50-OAS), were transcrip-
tionally increased at 3 days postinfection (dpi) in protecting
H9N2-infected 14-day-old specific pathogen-free (SPF)
chickens (Reemers and others 2009). However, whether the
expression levels of chicken Mx1 and 20,50-OAS in vivo can
be used as indicators of the antiviral effect of exogenous
ChIFN-aremains unknown.
The H9N2 subtype avian influenza virus (AIV), which was
first isolated from chickens (Chen and others 1994), has
gained considerable attention in China since it was rapidly
spread across China and even transmitted from animals to
humans (Chen and others 1994; Peiris and others 1999, 2001;
Guo and others 2000; Saito and others 2001; Liu and others
2003; Choi and others 2004; Xu and others 2004, 2007; Li and
others 2005). H9N2-infected chickens can serve as reservoir
host and transmit this kind of virus to mammals such as
pigs and humans (Webster and others 1992; Alexander 2000),
thus increasing the potential risk in controlling the viral
mutants. Moreover, H9N2-infected chickens are vulnerable
to secondary infection by pathogenic microbes, which may
consequently cause severe commercial loss. ChIFN-amay be
clinically used as an exogenous antiviral reagent to boost host
innate immunity responses for controlling low-pathogenicity
AIV infection (Marcus and others 2007). Although it has been
1
CAS Key Laboratory of Pathogenic Microbiology and Immunology, Institute of Microbiology, Chinese Academy of Sciences, Beijing,
People’s Republic of China.
2
Graduate University of Chinese Academy of Sciences, Beijing, People’s Republic of China.
3
Institute of Poultry Science, Shandong Academy of Agricultural Sciences, Jinan, People’s Republic of China.
4
China-Japan Joint Laboratory of Molecular Immunology and Molecular Microbiology, Institute of Microbiology, Chinese Academy of
Sciences, Beijing, People’s Republic of China.
JOURNAL OF INTERFERON & CYTOKINE RESEARCH
Volume 31, Number 7, 2011
ªMary Ann Liebert, Inc.
DOI: 10.1089/jir.2010.0123
533
identified that ChIFN-acould reduce the mortality of H9N2
(A/Beijing/1/96/H9N2) AIV in 9-day-old SPF chicken em-
bryos and 1-day-old SPF chickens (Xia and others 2004), the
clinical effect of ChIFN-aas a preventive and therapeutic or-
ally administrated antiviral agent against H9N2 AIV remains
to be demonstrated.
In the present study, several experiments were performed
to determine whether orally administrated ChIFN-ahad the
capability of protecting chickens from H9N2 AIV challenge
in SPF chickens. The expression level of chicken Mx1 and
20,50-OAS in tissues and body weights were also measured to
evaluate the antiviral effect of ChIFN-ain vivo.
Materials and Methods
Virus stocks
Avian influenza A virus, subtype H9N2, isolate A/
Chicken/GuangDong/05, was provided by the Institute of
Poultry Science, Shandong Academy of Agricultural Sci-
ences. The virus was reproduced in 10-day-old SPF chicken
embryonated eggs. The allantoic fluids were harvested,
stored at 708C, and used for testing the egg infectious dose
(EID
50
).
Preparation of ChIFN-a
The recombinant ChIFN-aprotein was prepared from
Escherichia coli. In brief, the ChIFN-agene was amplified by
polymerase chain reaction (PCR) from chicken liver (pBV/
chiIFNafor: 50-GAATTCATGTGCAACCACCTTCGCCCC
CA-30; pBV/chiIFNarev: 50-AGATCTTTAAGTGCGCGTGT
TGCC-30), cloned into the vector pBV220, and then induced
expression in E. coli strain BL21 (DE3) at 428C for 5 h. To
purify the ChIFN-aprotein, the cells were harvested and
treated using an ultrasonic cell disruptor. After that, the in-
clusion body was separated by centrifugation and washed
with PBST (pH 7.4; 137 mM NaCl, 2.7 mM KCl, 10 mM
Na
2
HPO
4
, 1.76 mM KH
2
PO
4
, and 1% triton), 2 M urea, and
1 M NaCl in turn. Then the inclusion body was dissolved in
8 M urea. The denatured protein was refolded in the re-
folding buffer [50 mM Tris (pH 8.0), 0.5 M Arg, 2 mM EDTA,
0.5 mM glutathione (oxidized), and 20% glycerol] at 48C for
48 h. After refolding, the ChIFN-awas added to cation ex-
change chromatography at the rate of 0.3 mL min
1
and then
eluted using PBS (pH 7.4) and 1 M NaCl at the rate of 1 mL
min
1
. The purified ChIFN-awere then detected by SDS-
PAGE analysis with Coomassie brilliant blue staining. The
antiviral titer of ChIFN-awas performed using vesicular
stomatitis virus/Madin Darby bovine kidney cells according
to previously described protocols (Chen and others 2009).
Chickens
Seven-day-old and 33-day-old white leghorn SPF chickens
were housed under SPF conditions according to the People’s
Republic of China National Standard ‘‘SPF chicken microbi-
ological quality control’’ (GB/T17998-1 999, China).
Testing the preventive and therapeutic
effects of ChIFN-aon chickens
Chickens were divided into 5 groups, namely the pre-
ventive group, therapeutic group, virus-challenged control
group, ChIFN-acontrol group, and blank control group.
Each chicken was orally fed with ChIFN-aby a 1-mL med-
ical syringe without needle. The preventive group (n¼20)
was successively orally fed with ChIFN-aonce a day for 4
days and subsequently infected with H9N2 AIV. The thera-
peutic group (n¼20) was first infected with H9N2 AIV and
then orally fed with ChIFN-aonce a day for 5 days. For
7-day-old SPF chickens, the preventive and therapeutic
groups were orally fed 0.510
4
U of ChIFN-afor each chick
per day. The dose of ChIFN-aused for 33-day-old SPF
chickens was 2-fold that of 7-day-old SPF chickens. About
110
6
EID
50
bird
1
H9N2 AIV was administered to 7-day-
old SPF chickens by intramuscular injection in the breast
muscle and 110
7
EID
50
bird
1
H9N2 AIV was administered
to 33-day-old SPF chickens by intravenous injection in the
wing vein. For comparison, day-matched virus-challenged
control group only infected with H9N2 AIV, ChIFN-acon-
trol group only treated with ChIFN-a, and blank control
group without any treatment were used.
Body weight was measured every 2 days. The body weight
gain was calculated as the mean body weight of each group
from 2 to 10 dpi minus the corresponding mean body
weight of groups at 4 dpi.
RNA isolation and real-time PCR
The transcriptional level of 2 ISGs (Mx1 and 20,50-OAS) was
analyzed and H9N2 AIV matrix protein gene (M1) mRNA
level was measured to determine the viral load in the tissues.
Table 1. Primers for Amplification of Interferon-Stimulated Genes and M1 of H9N2 Avian
Influenza Virus Used in Real-Time Polymerase Chain Reaction
Genes Primer Sequences of primers (50–30)
Size of
amplicon (bp)
Annealing
temperature (8C)
GenBank
accession no.
b-Actin
a
b-actin-RT-F GAGAAATTGTGCGTGACATCA 152 60 L08165
b-Actin-RT-R CCTGAACCTCTCATTGCCA
20,50-OAS
a
20,50-OAS-RT-F CACGGCCTCTTCTACGACA 103 62 AB037592
20,50-OAS-RT-R TGGGCCATACGGTGTAGACT
Mx1 Mx1-RT-F AGACCTTGCTTTTGGATGTGCT 105 62 AB088533.1
Mx1-RT-R TTGCTCAGGCGTTTATTTGCT
M1 M1-RT-F GGCTAAAGACAAGACCAATCCTG 87 60 AF536727.1
M1-RT-R GTCCTCGCTCACTGGGCAC
a
These primers were referred from Li and others (2007). Other primers were designed by Primer Express software v.1.5 (Applied
Biosystems).
20,50-OAS, 20,50-oligoadenylate synthetase; F, forward primer; R, reverse primer.
534 MENG ET AL.
For the RNA preparation, the upper part tissues of trachea of
four 7- and 33-day-old SPF chickens were collected at 4 and
3 dpi, respectively. Briefly, total RNA was extracted from the
trachea using RNAprep pure animal tissue kit (Tiangen).
Approximately 1 mg RNA was used to synthesize cDNA
using TIANScript RT Kit (Tiangen) according to the manu-
facturer’s directions. An aliquot (1/25) of the cDNA was used
as the template for a real-time PCR using SYBR
Premix Ex
Taqkit (Takara). The sequences of primers are listed in
Table 1 and b-actin was used as the internal control. All real-
time PCRs were performed in the Corbett Rotor-Gene 6000
(Corbett Research). The C
t
values of mRNA were determined
by Rotor-gene 6000 series software (Corbett Research) and the
relative gene expression was calculated using the 2
DDCt
method (Livak and Schmittgen 2001). The tracheal tissues of
7- and 33-day-old SPF chickens without any treatment were
collected at 4 dpi and used as calibrator of corresponding
animal experiment, respectively.
Statistical analysis
All data were analyzed using SPSS version 13.0 for Windows
software (SPSS, Inc., Chicago, IL). Comparison between dif-
ferent groups was performed using the Mann–Whitney Utest.
For all tests, a two-sided Pvalue of <0.05 was considered
significant.
Results
Preparation of recombinant ChIFN-a
In this study, the ChIFN-agene was cloned from chicken
liver and the deduced amino acid sequence without signal
sequence (32–193 aa) exhibited 100% identity with IFN-aof
Gallus (GenBank accession No. ABB05335). The recombinant
ChIFN-aprotein was expressed in E. coli strain BL21 (DE3)
and purified as previously described. The anti-vesicular
stomatitis virus activity of ChIFN-awas 110
7
Umg
1
, and
the ChIFN-awas used in the subsequent experiments.
The body weight of chickens was not influenced
by ChIFN-a
The body weight gain was measured every 2 days. Figure
1A shows that the body weight gain of all infected groups of
7-day-old SPF chickens gradually increased during the ex-
periment and there was no significant difference among them.
It showed that the body weight of 7-day-old SPF chickens was
not influenced by ChIFN-aand/or H9N2 AIV inoculation.
The body weight gain of the 33-day-old SPF chickens is shown
in Fig. 1B. We found that the body weight gain of the 3 in-
fected groups was significantly lower than that of the blank
control from 2 to 10 dpi and the preventive and therapeutic
groups recovered the body weight gain quicker when com-
pared with the virus-challenged control group. Moreover, the
body weight gain of the ChIFN control group was close to that
of the blank control group, which indicated that the body
weight of 33-day-old SPF chickens was influenced by H9N2
AIV and not by ChIFN-a.
ChIFN-asignificantly reduced the viral
load in trachea
The relative trachea viral load from each group was de-
termined using real-time PCR in both 7- and 33-day-old SPF
chickens. For 7-day-old SPF chickens, the M1 mRNA level of
the preventive and therapeutic groups was significantly in-
hibited by ChIFN-aat 3 dpi. The M1 mRNA level in trachea
was reduced by about 12- and 3-fold in the therapeutic and
preventive groups, respectively, compared with that of the
virus-challenged control group (Fig. 2A). We further ana-
lyzed the M1 mRNA level in trachea from 33-day-old SPF
chickens and found that the M1 mRNA level was about 10-
and 85-fold down in the therapeutic and preventive groups,
respectively, over the virus-challenged control group (Fig.
2B). These data indicated that ChIFN-agiven by oral ad-
ministration could significantly reduce the replication of
H9N2 AIV in trachea of 7- and 33-day-old SPF chickens.
FIG. 1. Body weight gain of 7-day-old (A) and 33-day-old
(B) specific pathogen-free (SPF) chickens. The body weight
gain was calculated as the mean body weight of each group
from 2 to 10 days postinfection (dpi) minus the corre-
sponding mean body weight of groups at 4 dpi. Data were
shown as means SEM. The Mann–Whitney Utest was used
to compare the differences of body weight gain between each
group and corresponding blank control group of the same
postinfection day. A Pvalue of <0.05 was considered sta-
tistically significant. *P<0.05.
CHIFN-aINHIBITS AIV REPLICATION BY ORAL ADMINISTRATION 535
The changes of the ISG expression levels
in chickens
We tried to identify whether Mx1 and 20,50-OAS could be
used as indexes to evaluate the antiviral effect of exogenous
ChIFN-ain chickens. The expression levels of these 2 ISGs
were also determined by real-time PCR. As showed in Table
2, both the virus-challenged control group and the ChIFN
control group could increase the expression levels of 20,50-
OAS and Mx1 when compared with the blank control group.
Moreover, these 2 ISG levels of the preventive and thera-
peutic groups were higher than those of the virus-challenged
control group and the ChIFN control group in both 7- and
33-day-old SPF chickens. As a result, 20,50-OAS and Mx1
could be used as reference indexes to evaluate the antiviral
effect of exogenous ChIFN-a.
Discussion
Low-pathogenicity AIV cause the outbreaks of febrile re-
spiratory infection ranging from mild illness such as weight
loss (<10%), ruffled feathers, and elevated temperatures to
severe illness (Belser and others 2007). Given the commercial
loss of AIV infection, finding a potential antiviral agent and
immunopotentiator is urgently needed. In the present study,
we demonstrated that oral administration of ChIFN-anot
FIG. 2. Viral load of 7-day-old (A) and 33-day-old (B) SPF chickens in trachea at 3 dpi, assayed by real-time polymerase
chain reaction. Data were shown as means SEM. The Mann–Whitney Utest was used to compare the differences of viral
load between each group and corresponding virus-challenged control group. A Pvalue of <0.05 was considered statistically
significant. *P<0.05.
Table 2. Induction of Interferon-Stimulated Genes of 7- and 33-Day-Old Specific
Pathogen-Free Chickens at 3Days Postinfection
Fold induction in 7-day-old SPF chickens
a
20,50-OAS Mx1
Preventive group 9.17 0.27 11.51 0.04
Therapeutic group 11.49 0.36 14.11 0.49
b
Virus-challenged control 7.85 1.00 4.35 1.75
ChIFN control 2.14 0.07 2.52 0.07
Blank control 0.92 0.14 0.91 0.14
Fold induction in 33-day-old SPF chickens
a
20,50-OAS Mx1
Preventive group 24.01 0.33 66.30 1.15
Therapeutic group 30.61 0.53 74.07 1.28
Virus-challenged control 15.99 0.91 64.15 2.22
ChIFN control 4.51 0.06 25.45 0.22
Blank control 0.70 0.01 0.71 0.01
b-Actin was used as the internal control.
The Mann–Whitney Utest was used to compare the differences of the relative expression level of each ISG between each group and
corresponding virus-challenged control group. A Pvalue of <0.05 was considered statistically significant.
a
Fold induction was calculated as the relative expression level of each individual gene compared with the level of normal control at 2 dpi
by 2
DDCt
and represented as mean SEM.
b
P<0.05.
SPF, specific pathogen-free; ChIFN, chicken interferon-alpha; dpi, days postinfection.
536 MENG ET AL.
only led to rapid recovery of the body weight gain in the
virus-challenged 33-day-old SPF chickens, but also showed
antiviral ability in both 7- and 33-day-old chickens.
Our study indicated that ChIFN-acould be used as a pre-
ventive and therapeutic agent against AIV. Further, we found
that the therapeutic effect was better than the preventive
effect on 7-day-old SPF chickens, which is opposite to 33-day-
old SPF chickens. These findings also indicated that the
T-dependent lymphocyte system of 33-day-old SPF chickens
was more mature than that of 7-day-old SPF chickens (Rose
1979), and hence, major histocompatibility complex class I
(MHC I) molecules might be upregulated efficiently (Sam-
uel 2001; Chevaliez and Pawlotsky 2009). Further studies
such as NK cell cytotoxicity assays are needed to detect the
change of T-dependent lymphocyte system in chickens, which
was caused by exogenous ChIFN-a( Jarosinski and others
2001).
We used real-time PCR to quantify the viral load in trachea,
which was very sensitive for assessing the antiviral action of
ChIFN-a. Further, oral administration of ChIFN-awas used in
our studies. Although ChIFN-aadministrated by oral inges-
tion can inhibit infectious bursal disease virus and Newcastle
disease virus (Marcus and others 1999; Pei and others 2001),
there is still no report about the anti-H9N2 activity of ChIFN-a
by oral administration until now. In this study, the viral load
of trachea in both 7- and 33-day-old chickens proved that oral
administration of ChIFN-awas an efficient and convenient
way against H9N2 infection. As ChIFN-aused in our study
was prepared from E. coli, a low-cost treatment of H9N2 in-
fection was also provided at the same time.
All type I IFNs regulate the transcription of ISGs by stim-
ulating classical JAK-STAT (signal transducer and activator of
transcription) signaling pathways (Li and others 2005).
However, very little information is available about the sup-
pressive effect of ISGs in vivo when ChIFN-ais administrated
by oral route. In the present study, 20,50-OAS and Mx1 could
be stimulated by oral ChIFN-aalone, which fit the previous
study that 20,50-OAS and Mx1 were 2 key ISGs involved in
IFN-induced pathways (Samuel 2001). The present findings
also suggested that 20,50-OAS and Mx1 actively participate in
regulating anti-AIV response, which was further reinforced
by the observation of upregulated expression of Mx1 and
20,50-OAS in AIV challenge control. However, chickens trea-
ted with ChIFN-aafter H9N2 AIV infection in the present
study exhibited a stronger effect on increasing the expression
level of both 20,50-OAS and Mx1 when compared with the
virus-challenged control. Taken together, we thought that
20,50-OAS and Mx1, at least in part, were involved in the an-
tiviral process of ChIFN-a, although the Mx1 protein of
chicken has been proved to lack antiviral activity in former
studies (Bernasconi and others 1995; Daviet and others 2009;
Benfield and others 2010). Therefore, the expression level of
Mx1 and 20,50-OAS in this study could not fully explain the
antiviral mechanism of ChIFN-a. This meant that other anti-
viral ISGs such as protein kinase (PKR) and RNA adenosine
deaminase (ADAR1) should also be investigated in the anti-
AIV response in future studies (Herbert and others 1995; Ko
and others 2004; Li and others 2010).
In summary, we extended the preventive and therapeutic
effect of ChIFN-ato chickens of different ages and demon-
strated that ChIFN-aadministrated by oral route not only
led to rapid recovery of the body weight gain, but also
showed a potential to suppress virus replication. Thus, oral
administration of recombinant ChIFN-aprovides a new
option in the prevention and therapy of H9N2 AIV infection.
Acknowledgments
This study was funded by the Knowledge Innovation
Program of the Chinese Academy of Sciences (KSCX2-YW-
R-158, KSCX2-YW-N-054) and the Major Special Program
of the Ministry of Science and Technology of China
(2009ZX10004-109).
Author Disclosure Statement
No competing financial interests exist.
References
Alexander DJ. 2000. A review of avian influenza in different bird
species. Vet Microbiol 74:3–13.
Belser JA, Lu X, Maines TR, Smith C, Li Y, Donis RO, Katz JM,
Tumpey TM. 2007. Pathogenesis of avian influenza (H7) virus
infection in mice and ferrets: enhanced virulence of Eurasian
H7N7 viruses isolated from humans. J Virol 81:11139–11147.
Benfield CT, Lyall JW, Tiley LS. 2010. The cytoplasmic location
of chicken mx is not the determining factor for its lack of
antiviral activity. PLoS One 5:e12151.
Bernasconi D, Schultz U, Staeheli P. 1995. The interferon-
induced Mx protein of chickens lacks antiviral activity. J In-
terferon Cytokine Res 15:47–53.
Chen BL, Zhang ZJ, Chen WB. 1994. Isolation and preliminary
serological characterization of type A influenza viruses from
chickens. Chin J Vet Med 20:3–5.
Chen X, Xue Q, Zhu R, Fu X, Yang L, Sun L, Liu W. 2009.
Comparison of antiviral activities of porcine interferon type I
and type II. Sheng Wu Gong Cheng Xue Bao 25:806–812.
Chevaliez S, Pawlotsky JM. 2009. Interferons and their use in
persistent viral infections. Handb Exp Pharmacol 189:203–241.
Choi YK, Ozaki H, Webby RJ, Webster RG, Peiris JS, Poon L, Butt
C, Leung YH, Guan Y. 2004. Continuing evolution of H9N2
influenza viruses in Southeastern China. J Virol 78:8609–8614.
Daviet S, Van Borm S, Habyarimana A, Ahanda ML, Morin V,
Oudin A, Van Den Berg T, Zoorob R. 2009. Induction of Mx
and PKR failed to protect chickens from H5N1 infection. Viral
Immunol 22:467–472.
Guo YJ, Krauss S, Senne DA, Mo IP, Lo KS, Xiong XP, Norwood
M, Shortridge KF, Webster RG, Guan Y. 2000. Characteriza-
tion of the pathogenicity of members of the newly established
H9N2 influenza virus lineages in Asia. Virology 267:279–288.
Herbert A, Lowenhaupt K, Spitzner J, Rich A. 1995. Chicken
double-stranded RNA adenosine deaminase has apparent
specificity for Z-DNA. Proc Natl Acad Sci U S A 92:7550–7554.
Jarosinski KW, Jia W, Sekellick MJ, Marcus PI, Schat KA. 2001.
Cellular responses in chickens treated with IFN-alpha orally
or inoculated with recombinant Marek’s disease virus ex-
pressing IFN-alpha. J Interferon Cytokine Res 21:287–296.
Ko JH, Asano A, Kon Y, Watanabe T, Agui T. 2004. Character-
ization of the chicken PKR: polymorphism of the gene and
antiviral activity against vesicular stomatitis virus. Jpn J Vet
Res 51:123–133.
Kugel D, Kochs G, Obojes K, Roth J, Kobinger GP, Kobasa D,
Haller O, Staeheli P, von Messling V. 2009. Intranasal ad-
ministration of alpha interferon reduces seasonal influenza A
virus morbidity in ferrets. J Virol 83:3843–3851.
Li C, Yu K, Tian G, Yu D, Liu L, Jing B, Ping J, Chen H. 2005.
Evolution of H9N2 influenza viruses from domestic poultry in
Mainland China. Virology 340:70–83.
CHIFN-aINHIBITS AIV REPLICATION BY ORAL ADMINISTRATION 537
Li YP, Handberg KJ, Juul-Madsen HR, Zhang MF, Jorgensen PH.
2007. Transcriptional profiles of chicken embryo cell cultures
following infection with infectious bursal disease virus. Arch
Virol 152:463–478.
Li Z, Wolff KC, Samuel CE. 2010. RNA adenosine deaminase
ADAR1 deficiency leads to increased activation of protein
kinase PKR and reduced vesicular stomatitis virus growth
following interferon treatment. Virology 396:316–322.
Liu H, Liu X, Cheng J, Peng D, Jia L, Huang Y. 2003. Phyloge-
netic analysis of the hemagglutinin genes of twenty-six avian
influenza viruses of subtype H9N2 isolated from chickens in
China during 1996–2001. Avian Dis 47:116–127.
Livak KJ, Schmittgen TD. 2001. Analysis of relative gene ex-
pression data using real-time quantitative PCR and the 2(-Delta
Delta C(T)) Method. Methods 25:402–408.
Marcus PI, Girshick T, van der Heide L, Sekellick MJ. 2007.
Super-sentinel chickens and detection of low-pathogenicity
influenza virus. Emerg Infect Dis 13:1608–1610.
Marcus PI, van der Heide L, Sekellick MJ. 1999. Interferon action
on avian viruses. I. Oral administration of chicken interferon-
alpha ameliorates Newcastle disease. J Interferon Cytokine
Res 19:881–885.
Mo CW, Cao YC, Lim BL. 2001. The in vivo and in vitro effects of
chicken interferon alpha on infectious bursal disease virus and
Newcastle disease virus infection. Avian Dis 45:389–399.
Pei J, Sekellick MJ, Marcus PI, Choi IS, Collisson EW. 2001.
Chicken interferon type I inhibits infectious bronchitis virus
replication and associated respiratory illness. J Interferon
Cytokine Res 21:1071–1077.
Peiris JS, Guan Y, Markwell D, Ghose P, Webster RG, Shortridge
KF. 2001. Cocirculation of avian H9N2 and contempo-
rary ‘‘human’’ H3N2 influenza A viruses in pigs in south-
eastern China: potential for genetic reassortment? J Virol 75:
9679–9686.
Peiris M, Yuen KY, Leung CW, Chan KH, Ip PL, Lai RW, Orr
WK, Shortridge KF. 1999. Human infection with influenza
H9N2. Lancet 354:916–917.
Reemers SS, van Haarlem DA, Groot Koerkamp MJ, Vervelde L.
2009. Differential gene-expression and host-response profiles
against avian influenza virus within the chicken lung due to
anatomy and airflow. J Gen Virol 90:2134–2146.
Rose ME. 1979. The immune system in birds. J R Soc Med
72:701–705.
Saito T, Lim W, Suzuki T, Suzuki Y, Kida H, Nishimura SI,
Tashiro M. 2001. Characterization of a human H9N2 influenza
virus isolated in Hong Kong. Vaccine 20:125–133.
Samuel CE. 2001. Antiviral actions of interferons. Clin Microbiol
Rev 14:778–809.
Sekellick MJ, Ferrandino AF, Hopkins DA, Marcus PI. 1994.
Chicken interferon gene: cloning, expression, and analysis.
J Interferon Res 14:71–79.
Szretter KJ, Gangappa S, Belser JA, Zeng H, Chen H, Matsuoka
Y, Sambhara S, Swayne DE, Tumpey TM, Katz JM. 2009. Early
control of H5N1 influenza virus replication by the type I in-
terferon response in mice. J Virol 83:5825–5834.
Webster RG, Bean WJ, Gorman OT, Chambers TM, Kawaoka Y.
1992. Evolution and ecology of influenza A viruses. Microbiol
Rev 56:152–179.
Xia C, Liu J, Wu ZG, Lin CY, Wang M. 2004. The interferon-
alpha genes from three chicken lines and its effects on H9N2
influenza viruses. Anim Biotechnol 15:77–88.
Xu C, Fan W, Wei R, Zhao H. 2004. Isolation and identification
of swine influenza recombinant A/Swine/Shandong/1/2003
(H9N2) virus. Microbes Infect 6:919–925.
Xu KM, Li KS, Smith GJ, Li JW, Tai H, Zhang JX, Webster RG,
Peiris JS, Chen H, Guan Y. 2007. Evolution and molecular ep-
idemiology of H9N2 influenza A viruses from quail in southern
China, 2000 to 2005. J Virol 81:2635–2645.
Address correspondence to:
Dr. Lei Sun
CAS Key Laboratory of Pathogenic Microbiology
and Immunology
Institute of Microbiology
Chinese Academy of Sciences
No. 1 West Beichen Road
Chaoyang District
Beijing 100101
People’s Republic of China
E-mail: sunlei362@im.ac.cn
Dr. Wenjun Liu
CAS Key Laboratory of Pathogenic Microbiology
and Immunology
Institute of Microbiology
Chinese Academy of Sciences
No. 1 West Beichen Road
Chaoyang District
Beijing 100101
People’s Republic of China
E-mail: liuwj@im.ac.cn
Received 2 September 2010/Accepted 6 January 2011
538 MENG ET AL.
