Content uploaded by Vincenzo Scarlato
Author content
All content in this area was uploaded by Vincenzo Scarlato
Content may be subject to copyright.
Identification of the in vitro target of an iron-
responsive AraC-like protein from Neisseria
meningitidis that is in a regulatory cascade with Fur
Laura Fantappie
`,
1
Vincenzo Scarlato
1,2
and Isabel Delany
1
Correspondence
Isabel Delany
isabel.delany@novartis.com
Received 7 January 2011
Revised 27 April 2011
Accepted 13 May 2011
1
Novartis Vaccines, Microbial Molecular Biology, Via Fiorentina 1, 53100 Siena, Italy
2
Department of Biology, University of Bologna, Bologna, Italy
In this study we characterized a genetic locus that is predicted to encode one of the three AraC-
like regulators of Neisseria meningitidis, a homologue of MpeR of Neisseria gonorrhoeae which is
specific to the pathogenic Neisseria species. Previous microarray studies have suggested that
this gene is a member of the Fur regulon. In strain MC58, it is a pseudogene (annotated as two
ORFs, NMB1879 and NMB1878) containing a frameshift mutation which we show is common to
all strains tested belonging to the ST-32 hypervirulent clonal complex. Using primer extension and
S1 nuclease protection assays, we mapped two promoters in the upstream intergenic region: the
mpeR promoter and the NMB1880 promoter. The latter promoter drives transcription of the
divergent upstream locus, which is predicted to encode a high-affinity iron uptake system. We
demonstrated that both promoters are induced during iron limitation and that this regulation is also
mediated by the Fur regulator. DNA-binding studies with the purified MpeR protein revealed that it
binds to a region directly upstream of the NMB1880 divergent promoter, suggesting a role in its
regulation. Mutants of N. meningitidis strains lacking MpeR or overexpressing MpeR showed no
significant differences in expression of the P
NMB1880
promoter, nor did global transcriptional
profiling of an MpeR knockout identify any deregulated genes, suggesting that the MpeR protein
is inactive under the conditions used in these experiments. The presence of MpeR in a regulatory
cascade downstream of the Fur master iron regulator implicates it as being expressed in the iron-
limiting environment of the host, where it may in turn regulate a group of genes, including the
divergent iron transport locus, in response to signals important for infection.
INTRODUCTION
Neisseria meningitidis, the meningococcus, is a Gram-
negative diplococcus and an important human pathogen.
N. meningitidis resides within the nasopharyngeal tract of
humans, its only known habitat, and about 5–15 % of the
human population carries the bacteria without any
symptoms of infection (Fowler et al., 2004). A major step
in infection is the ability of some strains to cross the
nasopharyngeal epithelium into the circulatory system,
where the bacteria proliferate and adapt to the host
environment, causing septicaemia. Clinical responses to
infection are varied, ranging from benign to extreme, fatal
forms (meningococcemia). In the most severe form of
infection, bacteria in the blood make their way to the brain
and cross the blood–brain barrier and induce inflammation
of the meninges (meningitis).
Although extensive transcriptional regulation is expected to
accompany the infection process of N. meningitidis, the roles
of only a few transcriptional regulators during infection by
pathogenic neisseriae have been identified and investigated
to date. N. meningitidis and the closely related pathogen
Neisseria gonorrhoeae (the gonococcus) have many homo-
logous regulators, as predicted from their genome sequences,
although their infectious processes and niches are quite
distinct. Included in this arsenal are three AraC-like proteins
that exhibit a high level of identity (approximately. 95 %
identity). One of these, the MtrA protein, was characterized
in N. gonorrhoeae (Rouquette et al., 1999) and it was found
to activate the expression of mtrCDE, which encodes an
energy-dependent efflux pump that serves to export diverse
antimicrobial and hydrophobic agents (HAs). However, it
was subsequently reported that although the meningococcus
has a functional mtrCDE-encoded efflux pump, its expres-
sion is independent of MtrA (Rouquette-Loughlin et al.,
The array layout has been submitted to EBI ArrayExpress and it is
available with the identifier A-MEXP-1967. The entire set of supporting
microarray data has been deposited in the ArrayExpress public database
under the accession number E-MTAB-687.
A supplementary table, listing microarray results comparing RNA from
cultures of M1239 and M-2Dstrains grown to mid-exponential phase in
GC medium and exposed for 15 min to iron-limitation, is available with
the online version of this paper.
Microbiology (2011), 157, 2235–2247 DOI 10.1099/mic.0.048033-0
048033 G2011 Novartis Vaccines and Diagnostics Printed in Great Britain 2235
2004). In another report, a second AraC regulator termed
MpeR (for Mtr protein efflux regulator) was suggested to
modulate a twofold change in mtrF expression that is needed
for full HA resistance, but the underlying mechanism is still
unknown (Folster & Shafer, 2005). The AraC family of
transcriptional regulators is a growing family that contains
over 800 members (Egan, 2002). These proteins often
regulate virulence by controlling antibiotic and oxidative
stress resistance, expression of type III secretion, toxin
production and other processes that are important during
infection (Finlay & Falkow, 1997; Francis et al., 2002;
Childers & Klose, 2007).
AraC-like regulators are often part of complex regulatory
cascades, involving hierarchical induction of sequential
regulators in response to multiple signals, which ensures
tight regulation and induction under the appropriate
specific conditions. For example, the AraC-like regulator
ToxT activates many virulence factors of Vibrio cholerae
but is itself under the control of the ToxR and TcpP
regulators which respond to environmental stimuli and
ensure that ToxT is expressed only under virulence-
inducing conditions in the human intestine (reviewed by
Childers & Klose, 2007).
N. meningitidis, as with many bacteria, uses the ferric uptake
regulator (Fur) to induce gene expression in response to the
iron-limiting environment of the host. Iron is an essential
micronutrient, present in growth limiting concentrations in
the host; however, an excess of iron is also toxic and Fur
plays an essential role in regulating iron homeostasis to
maintain the intracellular concentration of the metal within
appropriate limits (Escolar et al., 1999b). N. meningitidis is
highly adapted to its exclusive niche within the human host
and has evolved outer-membrane receptors that sequester
iron directly from transferrin, lactoferrin and haemoglobin
host proteins. Although the meningococcus does not
produce siderophores, it does express siderophore receptors
and can, presumably, scavenge iron-loaded siderophores
produced by other bacteria in the naso-pharynx (Carson
et al., 1999). Some of these high-affinity iron-uptake systems
are important virulence factors in bacteria and have been
shown to play a major role in promoting the survival of the
meningococcus within the host (reviewed by Perkins-
Balding et al., 2004). Given the location of iron receptors
on the cell surface, their role in pathogenicity and often their
inter-strain sequence conservation, these types of proteins
have been under study as possible vaccine candidates for the
disease (Banerjee-Bhatnagar & Frasch, 1990).
Analysis of the genes regulated by Fur has revealed that this
protein also controls functions that are not directly related
to iron metabolism. These include cellular processes as
varied as the acid-shock response, defence against oxygen
radicals, production of toxins, virulence factors and
downstream transcriptional regulators, which may in turn
control expression of their regulon (Escolar et al., 1999a).
Therefore, transcriptional regulators that are induced by
signals similar to those found in the host environment, for
instance under iron limitation in a Fur-mediated way, may
be important in controlling gene expression in vivo. Study
of these regulators may give important information about
genes expressed in the host and therefore provide a deeper
understanding of the infection cycle of this important
pathogen.
In this work we studied and characterized the regulation of
a genetic locus of N. meningitidis annotated in the MC58
genome as NMB1878/9 that is predicted to encode an
AraC-like regulator, the orthologue of MpeR of the
gonococcus. We generated null mutant and overexpressing
derivatives as well as performing DNA-binding studies
with the purified protein, and we identified a direct target
of the regulator in vitro.
METHODS
Bacterial strains and culture conditions. The N. meningitidis
strains (Table 1) and their recombinant derivatives (see below) used
in the present study were routinely cultured in GC-based (Difco) agar
medium supplemented with Kellogg’s supplement I at 37 uCina5%
CO
2
/95 % air atmosphere at 95 % humidity. Strains were stocked in
10 % skimmed milk and stored at 280 uC. Each bacterial manipula-
tion was started from an overnight culture of a frozen stock. For
liquid cultures, N. meningitidis strains were grown overnight on solid
medium, resuspended in PBS to OD
600
1 and inoculated at 1 : 100
dilution into GC broth supplemented with Kellogg’s supplement I
and 12.5 mM Fe(NO
3
)
3
; when required, erythromycin, chlorampheni-
col and IPTG were added to final concentrations of 5 mgml
21
for the
antibiotics and 0.03, 0.1, 0.3 or 1 mM for IPTG. Escherichia coli
strains DH5a(Hanahan, 1983) and BL21(DE3) (Studier & Moffatt,
1986) were cultured in Luria–Bertani medium and, when required,
ampicillin or IPTG was added to a final concentration of 100 mgml
21
or 1 mM respectively.
Construction of plasmids and recombinant strains. DNA
manipulations were carried out routinely as described for standard
laboratory methods (Sambrook et al., 1989). The Fur-knockout
mutant derivative of MC58 (MC-Fko, here named Fko) was
previously described (Delany et al., 2003). In order to knock out
the mpeR gene in strain M1239 (which has the full-length mpeR
gene), by substituting it with an erythromycin cassette, the p1879-
ko : Ery plasmid was co nstructed. The ups tream regi on o f th e mpeR
gene, containing the intergenic region between mpeR and NMB1880
and 22 bp of the mpeR gene, was amplified by PCR with primers
1879-F/1879-R and cloned in the pGEMT vector (Promega) as a
BamHI–EcoRI fragment, generating the plasmid pGemT1879. Then
the downstream region of the mpeR gene was amplified by PCR with
primers 1879-3/1879-4 and cloned into pGemT1879 as a BamHI–
NsiI fragment. An erythromycin cassette was inserted into the
BamHI site, between the flanking regions, generating p1879-ko:Ery.
The plasmid was then linearized and used for transformation of the
M1239 strain to make an mpeR knockout mutant, M-2D.To
generate a strain of MC58 that could overexpress the full-length
MpeR protein in an IPTG-inducible manner (MC-P
ind
MpeR) we
generated the pPind-mpeR plasmid, by replacing the crgA gene from
plasmid pPindcrgA (Ieva et al., 2005) with the mpeR gene, amplified
from the M1239 genome using the primers 1878-F2/1879-RN (Table
2) and cloned as a NdeI–NsiI fragment. The plasmid pPind-mpeR
was then used to transform MC58, resulting in the integration of a
copy of mpeR under the control of the P
tac
promoter between the
NMB1428 and NMB1429 genes.
L. Fantappie
`, V. Scarlato and I. Delany
2236 Microbiology 157
To make a NMB1880 knockout we generated the plasmid
pGem1880KO as follows. Upstream and downstream flanking regions
of the NMB1880 gene were amplified from the MC58 genome using
primer pairs 1880-NS/1879-R and 1880-F/1880-R, respectively. The
downstream fragment of 359 bp was cloned via TA cloning into
pGEMT and subsequently the upstream fragment of 295 bp was
cloned as an EcoRI–SphI fragment flanking the downstream fragment.
Finally a kanamycin cassette from pILL600 (Labigne-Roussel et al.,
1988) was cloned between the two flanking regions into the EcoRI site,
generating the pGem1880KO construct. The plasmid was linearized
and used for transforming MC58, to generate the MC-1880KO strain.
Transformants were selected for antibiotic resistance and then tested
for the double crossover in the flanking regions by PCR. Induction of
the MpeR protein was achieved by growing strain MC-P
ind
MpeR in
GC broth with IPTG to the exponential phase.
RNA extraction, primer extension, S1 nuclease assay and
RT-PCR. N. meningitidis strains were grown in liquid culture to
exponential phase and then split into two samples that were exposed
for 15 min to treatment with or without 100 mM 2,29-dipyridyl (a
specific iron chelator; Sigma). After 15 min, the cultures were added
to an equal volume of frozen medium to bring the temperature
immediately to 4 uC, and RNA was extracted from the pelleted cells as
previously described (Delany et al., 2003).
Primer extension was performed as previously reported (Delany et al.,
2003). To ensure correct mapping of the promoter, a sequencing
reaction was carried out with a T7 sequencing kit (USB) using the
same primer as in the primer extension reaction (1879-2) and the
plasmid consisting of the relevant cloned promoter (pGemT-1879).
A radioactively labelled DNA probe for S1 mapping of the 59region of
the NMB1880 transcript from position +1 was prepared as follows.
The probe was amplified from the MC58 chromosome using the
1880-S1/1880-S2 primer pair, the appropriate 360 bp fragment was
extracted from an agarose gel and, after purification, 2 pmol of the
probe was labelled at both extremities with T4 polynucleotide kinase
and 4 pmol [c-
32
P]ATP. One labelled extremity was removed by
digestion with EcoRI, a site that was incorporated into the upstream
primer (1880-S1) and the resultant 337 bp probe, labelled on the 59
complementary strand, was purified using Chroma Spin TE-100
columns (Clontech). Approximately 20 fmol labelled probe was
coprecipitated with 30 mg total RNA and the S1 nuclease assay was
performed as previously described (Fantappie
`et al., 2009).
Quantification of the signals from the digested probes was performed
using a Phosphorimager and ImageQuant software (Molecular
dynamics). A G-A sequencing reaction (Maxam & Gilbert, 1977)
was performed with the probe parallel to the S1 nuclease reactions to
provide a molecular mass ladder for mapping the 59end of the
transcript.
RT-PCR on the mtrF, NMB1880 and NMB1882/tdfF genes was
performed on cDNAs prepared from RNA extracted from M1239 and
M-2Dstrains grown to mid-exponential phase and treated for 15 min
with or without 100 mM 2,29-dipyridyl as previously described
Table 1. Occurrence of stop mutation in mpeR in clinical strains of N. meningitidis and N.
gonorrhoeae isolated from diseased patients over diverse geographical and temporal span
Strain Sg* GLDYear of
isolation
Presence of
mpeR mutationd
Clonal complex§
MC58 B GB 1985 +ST-32
BZ169 B NL 1985 +ST-32
BZ83 B NL 1984 +ST-32
H44/76 B N 1976 +ST-32
CU385 B C 1980 +ST-32
N44/89 B BRA 1989 +ST-32
2996 B GB 1975 2ST-8
961-5945 B AUS 1996 2ST-8
M986 B USA 1963 2ST-11
NGP165 B N 1974 2ST-11
M01-240185 B GB 2001 2ST-11
8047 B USA 1978 2ST-11
NGH15 B N 1988 2ST-41/44
394/98 B NZ 1998 2ST-41/44
M1239 B USA 1994 2ST-41/44
M1390 B USA 1995 2ST-41/44
M01-240149 B GB 2001 2ST-41/44
BZ232 B NL 1964 2ST-37
1000 B CIS 1988 NA ST-18
F6124 A CH 1988 2Sub.III
BZ133 C NL 1977 2Sub.VII
F62 Ng USA 1960 2ND
*Serogroups A, B and C are all N. meningitidis, whereas Ng corresponds to N. gonorrhoeae.
DGeographical locations: AUS, Australia; BRA, Brazil; C, Cuba; CH, Chad; CIS, Russia; GB, Great Britain;
N, Norway; NL, Netherlands; NZ, New Zealand.
dNA, Did not result in amplification by PCR.
§Nomenclature of clonal complex according to multi locus sequence typing (Maiden et al., 1998), ND, not determined.
The MpeR regulator of meningococcus
http://mic.sgmjournals.org 2237
(Fantappie
`et al., 2009) using primers 1719-F and 1719-R, 1880-RT-F
and 1880-RT-R, and 1882-RT-F and 1882-RT-R, respectively.
Microarray procedures: design,cDNA labelling and hybridization
and data analysis. DNA microarray analysis was performed using an
Agilent custom-designed oligonucleotide array as previously described
(Fantappie
`et al., 2011). For microarray analysis, RNA was extracted
from pelleted cultures using the RNAeasy Mini-kit (Qiagen). Three
hybridizations were performed using cDNA probes from three
independent pools, corresponding to RNA extracted from a total of
nine independent bacterial cultures for each strain. Differentially
expressed genes (exhibiting a fold change of at least 2 with respect to
the reference) were assessed by grouping all log
2
ratios of the Cy5 and
Cy3 values corresponding to each gene, within experimental replicas
and spot replicas, and comparing them against the zero value by
Student’s t-test statistics (one-tailed) with a P-value of ,0.01. The
array layout was submitted to the EBI ArrayExpress and it is available
with the identifier A-MEXP-1967. The entire set of supporting
microarray data has been deposited in the ArrayExpress public
database under the accession number E-MTAB-687.
DNase I footprinting. For footprinting analysis, the pGemT1879
plasmid was 59-end labelled with [c-
32
P]ATP at its NcoI site and separated
from the vector by PAGE after digestion with SpeI, producing a probe of
the mpeR promoter region labelled at only one extremity, as previously
described (Oriente et al., 2010). DNase I footprinting experiments with
the purified glutathione S-transferase (GST)-MpeR protein and the
radioactively labelled mpeR promoter probe were carried out as
previously described (Oriente et al., 2010). Binding reactions were
performed in binding buffer consisting of 10 mM HEPES pH 7, 50 mM
NaCl, 10 mM KCl, 1 mM DTT, 0.01% NP-40 and 10 % glycerol.
Expression and purification of the MpeR protein, and generation
of anti-MpeR serum. Different strategies were used in order to
overexpress and obtain purified recombinant MpeR protein,
including an N-terminally histidine-tagged MpeR (His-MpeR)
protein which was purified under denaturing conditions in order
to raise antibodies and a natively purified GST fusion (GST-MpeR)
protein to use in DNA-binding studies. In order to purify the His-
MpeR protein the mpeR gene was amplified from the M1239 genome
by PCR using 1878-F2/1878-R2 primers and cloned into pET15b
(Stratagene), generating plasmid pET15-1878, which was trans-
formed into E. coli strain BL21(DE3). From an overnight culture of
the BL21(DE3)(pET15-1878) strain, 200 ml Luria–Bertani medium
was inoculated and the strain grown to OD
600
0.5 at 37 uC and
expression of the recombinant His-MpeR protein was induced by the
addition of 1 mM IPTG and further incubation for 3 h. Attempts to
purify the His-MpeR protein under native conditions failed;
therefore it was purified by Ni-NTA (Qiagen) affinity chromato-
graphy under denaturing conditions, following the manufacturer’s
instructions. A concentration of approximately 0.8 mg His-MpeR
ml
21
was obtained. The concentration of urea in the eluted protein
was reduced to 2 M by dialysis and this preparation was used to
immunize mice. All attempts to renature the protein into an active
DNA-binding form failed. To prepare anti-MpeR serum, 20 mg
denatured purified protein was used to immunize 6-week-old CD1
female mice; four mice were used. The protein was given
intraperitoneally, together with complete Freund’s adjuvant for the
first dose and incomplete Freund’s adjuvant for the second (day 21)
and third (day 35) booster doses. Bleed-out samples were taken on
day 49 and used in Western blot analysis.
In order to obtain an active form, mpeR was expressed as a GST–
MpeR fusion. The mpeR gene was amplified by PCR using primers
Table 2. Oligonucleotides used in this study
Name Sequence* Restriction sitesD
1719-F AATACCGCTTCTGAATTGGG –
1719-R CCGAGGGAATGAAAGATGAT –
1879-2 CGGAGCGGACATAGGTTTGG –
1879-3 attcaggatCCTTCGGATGTGAAGAAGTGCTGATG BamHI
1879-4 attcagccatggTTACCACCAGCCTGTCCGACGATC NcoI
1879-F attcaggatccGGTAGATGGCGGCGGTGTTC BamHI
1878-F2 cggatccatATGAACACCGCCGCCATCTACCG NdeI
1878-GEX attcagctcgagGCACTTCTTCACATCCGAAGGC XhoI
1879-R AttcagaattcGCGGTTTCACGGTGTGCGGTTCC EcoRI
1878-R2 attcagggatccTCAGCACTTCTTCACATCCGAAGG BamHI
1879-RN attcagatgcatTCAGCACTTCTTCACATCCGAAGG NsiI
1880-F attcagaattcGCAAATCATCGTCATGCCTGCCCG EcoRI
1880-NS attcagcatgcatCGGAGCGGACATAGGTTTGG NsiI/SphI
1880-R attcagccatggCGGAGCTTCTGAAATCGCAGC NcoI
1880-RT-F ATTGAAGGCGCAGATTGAC –
1880-RT-R CGTGTATCCAACTTGCCAAC –
1880-S1 CGGTCGGCACGGTCAGCGTGGC –
1880-S2 GGAACGAGTTGTCTAACAAATGAATTcAATAGG EcoRI
1882-RT-F CAACGACGGCTACACTGTTT –
1882-RT-R CATTTGTTGCGATGTGATGA –
adk-PE1 CGCGCCTAAAAGTAATGC –
Eri R atatatggatccgggacctctttagcttcttgg BamHI
*Capital letters indicate N. meningitidis-derived sequences, small letters indicate sequences added for cloning
purposes and underlined letters indicate recognition sites.
DRestriction enzyme sites added for cloning purposes.
L. Fantappie
`, V. Scarlato and I. Delany
2238 Microbiology 157
1878-F2/1878-GEX and cloned into pGexNN (Amersham) generat-
ing pGex-1878NN. To increase the quantity and folding of the
overexpressed MpeR soluble protein, the heat-shock response in the
E. coli BL21 expression culture was induced by growing for 90 min
at 42 uC, as previously described (Roncarati et al., 2007). Cells were
harvested after 4 h induction with IPTG and resuspended in 16
PBS. The protein was purified by affinity chromatography with
Glutathione Sepharose 4B (Pharmacia Biotech) using 16PBS as
washing buffer and 10 mM reduced glutathione in 50 mM Tris/HCl,
pH 8, as elution buffer, according to the manufacturer’s instructions
and dialysed for 12 h against binding buffer (10 mM HEPES pH 7,
50 mM NaCl, 10 mM KCl, 1 mM DTT, 0.01 % NP-40 and 10 %
glycerol) at 4 uC. A final concentration of 1 mg ml
21
was obtained
and used for DNA-binding assays.
Western blot analysis. Liquid cultures were grown in 7 ml GC
medium in 15 ml tubes to OD
600
0.5. For iron chelation 25 mM
desferal (Sigma) was added to the GC medium. For induction of the
MpeR protein in strain MC-P
ind
MpeR, IPTG was added to 0.03, 0.1,
0.3 or 1 mM final concentration. A 1 ml volume of 7 ml liquid
culture was pelleted in a benchtop centrifuge and resuspended in
100 ml SDS-PAGE loading buffer. A 10 ml volume of each total
protein sample was separated by SDS-PAGE and transferred onto
nitrocellulose filter by standard methods (Sambrook et al., 1989). The
filters were blocked for 1 h at room temperature by agitation in
blocking solution (3 % skimmed milk and 0.1 % Triton X-100 in
PBS), followed by incubation for a further 1 h with a 1 :1000 dilution
of the MpeR antibody, 1 : 500 anti-NMB1880 and 1 : 500 anti-TdfF
sera in blocking solution. After a washing step, the filters were
incubated in a 1 : 2000 dilution of peroxidase-conjugated anti-mouse
immunoglobulin (Dako) in blocking solution for 1 h, and the
resulting signal was detected using the SuperSignal West Pico
chemiluminescent substrate (Pierce).
RESULTS
The AraC-like locus: mpeR
In the MC58 genome, the locus encoding an AraC-like
regulator consists of a pseudogene, which has been
annotated as two ORFs, NMB1879 and NMB1878, due to
a stop codon at 309 bp from the predicted translational
start (Fig. 1a). In other available meningococcal genomes, a
full-length gene of 960 bp encodes a protein of the AraC
family with a tryptophan codon (TGG) in place of the stop
codon (TGA) of the MC58 sequence. Previous microarray
studies suggested that the NMB1879/8 locus is regulated by
Fe and by Fur (Delany et al., 2006), and footprint studies
showed that Fur binds two sites in the upstream intergenic
region (Delany et al., 2006; Fig. 1b). These data suggest that
Fig. 1. (a) Structural organization of the N. mengitidis MC58 mpeR locus. The annotated genes are indicated by the NMB
number or gene name. The black boxes represent the two Fur-binding sites previously identified (Delany et al., 2006). The
genes divergently oriented from mpeR appear to be in an operon, as they are all in the same orientation, with no terminator or
promoter-like sequences in the intergenic regions. A putative rho-independent terminator is located immediately downstream of
tdfF and is indicated by a stem–loop. (b) Nucleotide sequence of the mpeR–NMB1880 intergenic sequence. The bent arrows
indicate transcriptional start sites, including the transcriptional start site of NMB1880 under iron-limitation (P9). Underlined
letters indicate ”10 and ”35 promoter consensus sequences of the P
mpeR
and P
NMB1880
promoters. Bold type indicates
Fur-binding sites as identified previously (Delany et al., 2006). The rectangle indicates the MpeR-binding site.
The MpeR regulator of meningococcus
http://mic.sgmjournals.org 2239
Fur directly binds to the promoter region of this gene and
may regulate its transcription. From now on, we refer to
NMB1879/8 as a single gene that we call mpeR according to
the name of its orthologue in N. gonorrhoeae (Folster &
Shafer, 2005).
In order to investigate if other strains of N. meningitidis
contain a mutation in the mpeR gene similar to strain MC58,
we selected 19 clinical isolates from serogroup B including
various clonal complexes. We also included isolates from
serogroups A and C and an isolate of the closely related
pathogenic bacterium N. gonorrhoeae. We amplified the
corresponding mpeR region from their chromosomal DNA
and sequenced these regions. The results we obtained are
shown in Table 1. The majority of strains have the full-
length gene, including N. gonorrhoeae and N. meningitis A, C
and most of serogroup B. Six of the 19 serogroup B strains
contain the stop mutation, and surprisingly these all
correspond to members of the ST32 clonal complex (ST-
32cc), while 13 strains from the other hypervirulent clonal
complexes of serogroup B do not contain the mutation, nor
do the strains from serogroups A and C, nor the N.
gonorrhoeae tested. Furthermore, the strains used were
isolated from different parts of the world from 1963 to 2001;
thus this panel represents a good geographical distribution
of N. meningitidis strains isolated over a significant period of
time. We conclude that mpeR is a pseudogene in all the ST-
32cc strains tested, and in none of the other 16 ST types
tested, indicating a significant association of the mutation
with the ST32cc (Fisher’s exact P-value51.3610
25
). As the
ST-32cc complex is one of the most virulent complexes of N.
meningitidis,mpeR might have a redundant function, and its
inactivation has not hindered the ST-32 complex during the
process of infection. Alternatively, it is also possible that the
mutation gives an advantage to the ST-32cc strains, and
deregulation of its target gene(s) renders the complex more
successful in its transmission.
The divergent ORF (NMB1880) directly upstream of mpeR
is annotated as encoding a putative periplasmic solute-
binding protein that has significant homology to a family of
periplasmic lipoproteins involved in transporting side-
rophores through the periplasm (49 % identity to FetB,
thought to transport enterobactin across the periplasm)
(Carson et al., 1999). Downstream of and in the same
orientation as NMB1880, there are two ORFs encoding a
hypothetical protein and TdfF (TonB-dependent family
protein F). Most members of this family of outer-membrane
TonB-dependent receptors are thought to function as
channels that, opening in presence of a ligand, allow the
access of the ligand into the periplasmic space. TdfF shows
approximately 30 % identity to hydroxamate siderophore
receptor proteins such as FhuE and FpvA, which are
involved in high-affinity binding of the coprogen (produced
by fungi) and ferripyoverdin (produced by pseudomonads)
siderophores by other bacteria. The mpeR locus including
these divergently oriented NMB1880-TdfF genes is only
present in the genomes of the pathogens N. meningitidis and
N. gonorrhoeae and is absent in the other genome sequences
of the genus Neisseria, including the commensal species.
Since footprinting experiments previously identified a Fur-
binding site proximal to this divergent locus, we decided to
further characterize the transcriptional regulation of the
mpeR and NMB1880 promoters.
Mapping the P
mpeR
and P
NMB1880
promoters
Due to the organization of the locus, within the 234 bp of
DNA upstream of the mpeR gene there is the possibility of at
least two promoter elements controlling the transcription of
the divergent genes mpeR and NMB1880 (Fig. 1). To identify
the position of these promoters with respect to the two Fur-
binding sites identified by footprinting studies, primer
extension was performed on total RNA from N. meningitidis
with multiple primers complementary to their transcripts.
We decided to perform the analysis on total RNA from the
MC58 Fur mutant strain (Fko) because in previous studies
of Fur-regulated genes (Delany et al., 2003, 2006), no bands
corresponding to elongation products were visible in the
MC58 wild-type strain due to the Fur-dependent repression
of the promoters.
A clear elongation product was generated using an mpeR-
specific primer on total RNA from the Fko strain (Fig. 2a,
lane Fko). This band maps to 26 bp upstream of the ATG
translational start site of the mpeR gene and probably
defines the mpeR promoter start site of transcription.
Analysis of the DNA sequence revealed the presence of 210
TTTAAT and 235 TTGATT regions upstream of the mpeR
promoter (Fig. 1b), which show conservation with the E.
coli sigma
70
210 TATAAT and 235 TTGACA-recognized
promoters.
We were unable to obtain reproducible results by primer
extension with NMB1880-specific primers; therefore in
order to map the NMB1880 promoter we set up an S1
nuclease protection assay with the radioactively labelled
DNA probe. The results show an S1-resistant band migrating
at a position corresponding to 149 nt of protected probe
(Fig. 2b). This corresponds to 25 bp upstream of the GTG
translational start site of NMB1880 and probably defines the
NMB1880 promoter start site of transcription. Analysis of
the DNA sequence revealed the presence of poorly conserved
210 TAAACA and 235 TCTGCA regions upstream of the
NMB1880 promoter (Fig. 1b)
.
Using these two techniques we identified two divergent
promoters in the intergenic region between mpeR and
NMB1880 which we called P
mpeR
and P
NMB1880
.Itis
interesting to note that all promoters are overlapped, in
part, by the Fur-binding sites (Fig. 1b).
Iron and Fur regulation of mpeR and NMB1880
transcription
To understand the effects of Fur and iron on the
transcription level of mpeR and NMB1880, we monitored
the accumulation of specific transcripts in total RNA
L. Fantappie
`, V. Scarlato and I. Delany
2240 Microbiology 157
extracted from MC58 wild-type cells and Fko cells exposed
to iron-replete or iron-limiting conditions. The strains were
grown under iron-replete conditions to exponential phase
and treated for 15 min with 100 mM2,29-dipyridyl, and
total RNA was extracted from the cells before and after
treatment. These RNAs were used in primer extension
experiments to measure the relative accumulation of mRNA
at the P
mpeR
promoter (Fig. 3a). In the wild-type MC58
background, treatment with the iron chelator resulted in an
increase of the mpeR transcript, indicating that this
promoter is induced during iron limitation. The amount
of transcript initiating at the P
mpeR
is high in Fko cells
exposed to iron-replete or iron-limiting conditions, indic-
ating that transcription from this promoter no longer
responds to iron in the fur mutant, and is equivalent to that
in the iron-depleted treatment from the MC58 wild-type
strain. This indicates that the absence either of iron or of the
Fur protein has the same effect in derepressing the P
mpeR
.As
expected we obtained similar levels of adk transcript in all
RNA preparations (negative control) (Fig. 3b).
We carried out S1 nuclease protection assays with an
NMB1880-specific probe hybridized to an equal amount of
total RNA from MC58 and Fko cells grown under iron-
replete and iron-limiting conditions (Fig. 3c). Only very
weak bands were obtained, possibly indicating that
NMB1880 is not highly expressed. However, there is a slight
Fig. 2. (a) Mapping of the 59end of the mpeR gene by primer
extension. A 20 mg sample of total RNA prepared from culture of
the MC58 Fur knockout mutant (Fko) strain grown to mid-
exponential phase was hybridized with an mpeR-specific primer
(1879-2) and elongated with reverse transcriptase. Sequencing
reactions (G, A, T and C) were performed with the same primer on
the cloned promoter region (pGemT-1879) and run in parallel. The
elongated primer band mapping the 59end of the mpeR gene
transcript is indicated. The corresponding +1 nt of transcriptional
initiation and the upstream promoter sequences are indicated on
the left. The 59end of the mpeR transcript was confirmed using a
second mpeR-specific primer (data not shown). (b) Mapping of the
59end of the NMB1880 gene by S1 nuclease protection assay.
The DNA probe was radioactively labelled at one end, hybridized to
30 mg total RNA prepared from a culture of the Fur mutant strain
(Fko) grown to mid-exponential phase and digested with S1
nuclease for mapping of the 59end of the NMB1880 transcript.
Two control samples with E. coli tRNA instead of total RNA were
processed in parallel with (lane +) and without (lane ”) addition of
S1 nuclease. The position of the RNA-specific S1 nuclease-
protected band corresponding to the 59end of the NMB1880
transcript is indicated. Lane G+A contained a G-A sequence
reaction of the DNA probe used as a size marker (Maxam & Gilbert,
1977). Lane Fko is from a longer exposure of the same gel, as the
RNA-protected signal was very low with respect to the other
samples. The corresponding +1 nt of transcriptional initiation and
the upstream promoter sequences are indicated on the left.
Fig. 3. Iron and Fur regulation of mpeR and NMB1880. Total RNA
was prepared from the wild-type (MC58) and the Fur-null mutant
(Fko) grown to mid-exponential phase under iron-replete condi-
tions before (+) and after (”) 15 min treatment with iron chelator
(2,29-dipyridyl), and then primer extension analysis on the P
mpeR
promoter (a) or S1 nuclease protection assay on the P
NMB1880
promoter (c) was performed. The level of adk housekeeping gene
transcript was also quantified by primer extension using the adk-
PE1 primer as a negative control in total RNA samples from each
tested strain (b). The figure shows a representative experiment of
triplicate RNA preparations from independent bacterial cultures.
The MpeR regulator of meningococcus
http://mic.sgmjournals.org 2241
increase of the NMB1880 transcript under iron-limiting
conditions in the MC58 wild-type, as well as in Fko cells
exposed to iron-replete or iron-limiting conditions.
Interestingly, a second, higher, band is seen under iron-
limiting conditions, migrating at a position corresponding
to 154 nt of protected probe. This corresponds to 30 bp
upstream of the GTG translational start site of NMB1880.
Analysis of the DNA sequence revealed the presence of 210
AATAAT and 235 TGGTTT regions upstream of this
putative promoter that we called P9
NMB1880
(Fig. 1b). This
could represent another promoter or it could arise from a
repositioning of the RNA polymerase.
We conclude that transcription from the P
mpeR
and
P
NMB1880
promoters is regulated during iron limitation
and is also mediated by the Fur regulator, which represses
transcription in response to iron.
Analysis of MpeR expression in different strains
of N. meningitidis
In an attempt to understand the role of MpeR in the possible
regulation of the upstream genes from the P
NMB1880
promoter, we generated a strain of MC58 that could
overexpress the full-length protein in an IPTG-inducible
manner (namely MC-P
ind
MpeR). Furthermore, we made a
knockout of the mpeR gene (named M-2D) in the M1239
strain, which is predicted to express a full-length protein
(Table 1). In order to evaluate the expression of the MpeR
protein in the different N. meningitidis strains generated, we
cloned and expressed a His-tagged form of the protein and
purified it under denaturing conditions (as described in
Methods) and raised antibodies against it in mice.
We grew parallel cultures of MC58, M1239 and its mpeR
knockout derivative strain M-2Dunder iron-replete and
iron-limiting conditions. Fig. 4(a) shows the Western blot
results obtained. A band of approximately 34 kDa, which
should correspond to MpeR protein, is seen when the
M1239 strain was grown with iron chelator while in iron-
replete conditions no band is visible. This confirms the iron-
regulated production of this regulatory protein. As expected,
in MC58 cells grown under iron-replete and -limiting
conditions no band corresponding to MpeR was detected.
The MC-P
ind
MpeR strain was grown in liquid culture with
increasing amounts of IPTG, to induce expression of the
mpeR gene and aliquots of each sample were collected and
tested by Western blotting (Fig. 4b). The antibodies
recognized a protein band migrating at approximately
34 kDa in the MC-P
ind
MpeR strain when cells were grown
in the presence of 0.03 mM IPTG (Fig. 4b, lane 3) and the
amount increased with higher amounts of IPTG in the
culture medium.
We performed Western blot analysis with polyclonal anti-
NMB1880 and anti-NMB1882 antiserum on the extracts of
the wild-type, the mpeR mutant or overexpressing strains
(as well as a NMB1880 knockout for anti-NMB1880)
grown under iron-replete and iron-limiting conditions, but
no band corresponding to the predicted molecular mass of
NMB1880 or NMB1882 was detectable in any of the cell
extracts (results not shown), suggesting that these proteins
are not expressed in any of these strains or that the antisera
did not recognize the native proteins. Furthermore, we
prepared RNA from the M-2Dand the MC-P
ind
MpeR
strains to assess the accumulation of the transcript from the
divergent P
NMB1880
promoter; however, by S1 nuclease
protection assays no significant differential regulation
could be detected between M1239 and the M-2Dknockout
nor the MC58 and MC-P
ind
MpeR strains (data not shown).
Taken together, these experiments suggest either that
MpeR is not involved in the regulation of this putative
operon or that under the conditions of the experiment the
MpeR protein was not active as a transcriptional regulator.
In N. gonorrhoeae, this homologous regulator has been
called MpeR as its inactivation resulted in a twofold
increase in the in b-galactosidase activity from an mtrF
Fig. 4. Western blot analysis of MpeR expression. (a) Western blot
analysis showing iron-regulated MpeR expression. Wild-type
MC58 and M1239 and the mperR knockout strain M-2Dwere
grown under iron-replete (+) (supplemented GC medium) and
iron-limiting (”) (supplemented GC medium with 25 mM desferal)
conditions and bacteria were harvested at OD
600
0.5. Equal
amounts of total protein from each culture were fractionated by
SDS-PAGE, blotted onto nitrocellulose filters, and stained with
antiserum raised against the MpeR protein (34 kDa). A faint band
of approximately 34 kDa was detected at a very low level in the
mpeR knockout mutant of M1239 (lane 6) that was treated with
iron chelator. This weak band may represent a cross-reactive band
of a similar-sized protein which may also respond to iron. The
figure shows a representative experiment from duplicate inde-
pendent bacterial cultures. (b) Western blot analysis showing
MpeR expression in the MC-P
ind
MpeR complemented strain. For
induction of MpeR, IPTG was added to the growth medium (lanes
3–6 correspond to 0.03, 0.1, 0.3 and 1 mM, respectively) and the
figure shows a representative experiment.
L. Fantappie
`, V. Scarlato and I. Delany
2242 Microbiology 157
fusion (Folster & Shafer, 2005). The mtrF gene encodes a
membrane protein required for high-level HA resistance
associated with the mtrCDE efflux pump. We measured, by
RT-PCR, the level of mtrF transcript in the wild-type
M1239 and mpeR mutant M-2Dstrains in high- or low-
iron conditions from mid-exponential-phase cultures in
GC and also from overnight plate cultures similar to the
conditions under which gonococcal MpeR was reported to
modulate the mtrF reporter (Folster & Shafer, 2005). While
we could detect a reproducible increase in steady-state
levels of mtrF (2.8±0.8-fold) under conditions of iron
chelation, we were unable to detect differences due to the
mpeR mutation in M-2D(data not shown), suggesting that
mtrF is not affected by the mpeR gene in N. meningitidis.
In a final attempt to detect active regulation of any gene by
MpeR, we compared the global transcriptional profile of
the M1239 wild-type and M-2Dmutant strains by
microarray analysis. Three independent two-colour micro-
array experiments were performed comparing pooled RNA
from triplicate cultures of each strain grown to mid-
exponential phase in GC medium and exposed for 15 min
to iron-limitation for the induction of MpeR expression.
The results obtained from these three experiments were
averaged after slide normalization, and differentially
expressed genes were identified with a threshold of twofold
transcriptional change and a t-test statistics P-value ¡0.01
(see Supplementary Table S1, available with the online
version of this paper). The only genes that are significantly
deregulated by the mpeR mutation appear in the mpeR
locus, i.e. NMB1878 (mpeR) which is 9.6-fold down-
regulated and the divergent NMB1880 (4.9-fold),
NMB1881 (4-fold) and NMB1882/tdfF (2.5-fold) which
appear upregulated. While RT-PCR analysis confirmed the
increase in transcript levels of these genes in the M-2D
mutant (data not shown), these data are in contrast to the
results of our S1 nuclease analysis of transcript levels
initiating at the P
NMB1880
promoter. This is likely to be due
to polar effects of the insertion of the antibiotic cassette,
which is orientated in the same direction as these genes.
Complementation of the mpeR mutation in the MC58
background (MC-PindMpeR) resulted in no significant
effect on transcript levels of either NMB1880 or tdfF as
measured by RT-PCR (data not shown), confirming the
suggested polar effects of the mutation in M-2D. Therefore
we conclude that from transcriptional profiling we are
unable to identify a gene regulated by MpeR activity,
although the experiments were performed in conditions
maximizing MpeR expression. This strongly suggests that
the MpeR protein is not actively regulating gene expression
under the conditions of these experiments.
Binding of MpeR to the NMB1880 promoter
AraC-like proteins are known to be very difficult to express
and purify in their native forms (Schleif, 2003). Expressing
MpeR with an N-terminal or C-terminal histidine tag gave
rise to insoluble proteins (results not shown). In order to
obtain an active form of the MpeR protein for use in DNA-
binding studies, we expressed it with a GST tag on the N-
terminus in E. coli. To increase the quantity of soluble
protein being expressed we induced the heat-shock response
in the E. coli expression culture by growth for 90 min at
42 uC as previously described (Roncarati et al., 2007).
Although no detectable band of the GST-MpeR protein was
visible in the soluble fraction we succeeded in purifying the
protein under native conditions (Fig. 5a). We used this
protein in DNA-binding assays with the upstream intergenic
region. We prepared a radioactively labelled probe, contain-
ing P
mpeR
and P
NMB1880
promoter regions, which was
incubated with increasing amounts of GST-MpeR protein,
and a gel shift analysis was performed. When 0.8 mg GST-
MpeR protein was added, a slower-migrating band appeared
(results not shown), which may be due to the formation of a
DNA–protein complex. This result suggests that the MpeR
protein is able to bind to the DNA intergenic region. In
order to identify where this binding occurs we performed
DNase I footprinting experiments. With the addition of
increasing amounts of MpeR, a region of protection and
DNase I hypersensitivity is clearly seen (Fig. 5c) that
corresponds to the region spanning from nucleotides 236
to 255 with respect to the +1 transcription site of the
P
NMB1880
promoter. This strongly suggests that the MpeR
protein could regulate NMB1880 expression by binding to a
region proximal to its promoter.
DISCUSSION
In this study we begin the characterization of a regulator
from the AraC family in the meningococcus, previously
named MpeR in the gonococcus, which may be important
for expression of proteins specifically in vivo. We have
identified a single promoter, P
mpeR
, which is regulated in
response to iron due to direct repression by the Fur
regulator. Therefore the MpeR protein will be induced in the
iron-limiting environment of the host. In the gonococcus,
the MpeR regulator has also been reported to be induced
under iron limitation (Ducey et al., 2005; Jackson et al.,
2010) and therefore the regulation of these homologues
appears to be conserved. Interestingly, in contrast to the
other two AraC regulators of the meningococcus which are
also encoded by the commensal species, the MpeR protein is
only present in the pathogenic Neisseria species N.
gohorrhoeae and N. meningitidis.
Several regulators within the AraC family control the
expression of genes known or thought to be required for
virulence of bacterial pathogens (Gallegos et al., 1997;
Munson et al., 2001). A small group of AraC-like regulators
is involved in regulating the expression of specialized iron
uptake systems where the substrate of the uptake system
functions as the inducer signal. These include the
Pseudomonas aeruginosa PchR protein (Heinrichs & Poole,
1996), the YbtA regulator of Yersinia pestis (Fetherston et al.,
1996) and the AlcR and BfeR proteins of Bordetella (Pradel
et al., 1998; Anderson & Armstrong, 2004), all of which
The MpeR regulator of meningococcus
http://mic.sgmjournals.org 2243
regulate siderophore synthesis and uptake genes. Fur and
iron regulate both the AraC regulators and their targets in
these circuits (Ochsner et al., 1995; Gao et al.,2008;
Brickman & Armstrong, 2009). Therefore, iron limitation
and the presence of the cognate siderophore inducer are
required for maximal expression.
Fig. 5. MpeR binding to the mpeR and NMB1880 promoter regions. (a) Expression and purification of the GST-MpeR protein
under native conditions. SDS-PAGE was performed with protein extracts from uninduced (lane ”) and IPTG-induced (lane +)
cultures of E. coli containing the pGex-1879NN expression plasmid, the cleared soluble fraction before (lane SF) and after (lane
FT: flow-through) binding to the Glutathione Sepharose 4B resin, the wash fraction (lane W) and the elution fraction (lane E).
The GST–MpeR fusion protein has an estimated molecular mass of 60 kDa. (b) DNase I footprinting analysis with purified
meningococcal Fur protein and a radioactively labelled DNA probe, 59-end labelled at the NcoI site, corresponding to the mpeR
and NMB1880 promoter regions. The arrows to the left show the direction of the mpeR and NMB1880 genes. The probe was
incubated with increasing concentrations of Fur protein and exposed to DNase I digestion for 1 min (lanes 2–4 correspond to
concentrations of 0, 137 nM and 550 nM, respectively). The Fur-protected regions are indicated to the right as vertical black
bars, and the numbers indicate the boundaries of the binding sites with respect to the +1 transcriptional initiation site of
NMB1880. The region of the MpeR-binding site is indicated to the right as a square bracket. Lane 1 corresponds to the G+A
sequence reaction run as the molecular mass marker in parallel to the footprinting reactions. (c) DNase I footprinting analysis
with purified meningococcal GST-MpeR protein and the same radioactively labelled DNA probe used in (b). The probe was
incubated with increasing concentrations of GST–MpeR protein and exposed to DNase I digestion for 1 min (lanes 1–4
correspond to concentrations of 0, 180 nM, 720 nM and 2.9 mM, respectively); the figure shows results from a representative
experiment. The MpeR-protected region is indicated to the right as a vertical black bar, and the numbers indicate the boundaries
of the binding site with respect to the +1 transcriptional initiation site of NMB1880. The asterisks indicate DNase
I-hypersensitive sites.
L. Fantappie
`, V. Scarlato and I. Delany
2244 Microbiology 157
Divergently upstream of mpeR we mapped the P
NMB1880
promoter, which overlaps the second Fur-binding site within
the intergenic region. This promoter weakly responds to iron
limitation and is slightly derepressed in the Fur mutant
strain, although transcription from this promoter appears to
be very low. Footprinting analysis showed that MpeR binds
to the P
NMB1880
promoter region directly upstream of the
235 hexamer, which is a position reflective of the operators
of transcriptional activators (Busby & Ebright, 1994) and
therefore strongly suggests the role of MpeR as an activator
of the P
NMB1880
promoter. Furthermore, to the best of our
knowledge, it is the first time that the target binding site of an
AraC regulator of a Neisseria species has been determined.
This promoter drives transcription of a likely operon, which
encodes proteins predicted to be involved in high-affinity
iron uptake across the outer membrane and through the
periplasmic space, TdfF and NMB1880, respectively.
Although the meningococcus and gonococcus do not secrete
siderophores they are able to scavenge iron-loaded side-
rophores synthesized by other micro-organisms. The FetA/
FetB system encodes an analogous receptor and periplasmic
transporter system, which allows neisseriae to utilize
exogenous enterobactin as an iron source (Carson et al.,
1999). Furthermore, pathogenic neisseriae have evolved
TonB-dependent receptors that sequester host iron-binding
proteins including transferrin-binding protein, lactoferrin-
binding protein and two haemoglobin receptors (Rohde &
Dyer, 2003; Perkins-Balding et al., 2004), as well as many
other genes encoding TonB-dependent receptors (Turner
et al., 2001) whose roles remain elusive. Fur is known to
regulate all of the characterized iron uptake systems, and
Fur-binding sites have been described overlapping their
promoter regions in the meningococcus (Grifantini et al.,
2003; Delany et al., 2006).
We were unable to observe detectable amounts of either the
NMB1880 or TdfF proteins by Western blotting, suggesting
that derepression of the promoter did not lead to
detectable expression. This is in agreement with previous
studies, in which TdfF expression could not be detected in
the gonococcus grown in vitro (Hagen & Cornelissen,
2006) nor in a broad panel of iron-stressed neisseriae
including pathogenic and commensal species (Turner et al.,
2001). While the MpeR protein could be detected in the
M1239 wild-type strain, neither its deletion nor its
overexpression affected the transcription of the upstream
P
NMB1880
promoter, suggesting that although MpeR clearly
targets the P
NMB1880
promoter it is not transcriptionally
active under in vitro growth conditions. Indeed through
transcriptional profiling of the M1239 wild-type and the
M-2Dnull mutant we were unable to detect any regulation
of genes due to MpeR-dependent activity, suggesting that,
as with many AraC like proteins, a signal may be needed to
induce the regulatory activity of this protein.
Nevertheless, transcription of the tdfF gene has been
reported, by two separate groups, to be induced when the
gonococcus infects human cervical epithelial cells (Agarwal
et al., 2008; Hagen & Cornelissen, 2006), suggesting that the
regulation of this gene responds to a signal provided by the
eukaryotic cell. The TdfF receptor has been implicated in the
ability of the gonococcus to acquire iron intracellularly, and
mutants in TdfF are incapable of intracellular replication
(Hagen & Cornelissen, 2006). It has also been shown that
intracellular replication of the meningococcus requires
TonB-dependent uptake of a host-derived iron source
(Larson et al., 2002). Intracellular meningococci trigger
rapid degradation of ferritin within infected epithelial cells
(Larson et al., 2004) and iron derived from ferritin
degradation supports survival. It is tempting to speculate
that this novel host iron source may be the inducer for
MpeR and the substrate of the high-affinity iron uptake
system encoded by the NMB1880/tdfF genes. In this model,
under iron limitation the iron-uptake operon is expressed to
a minimal basal level to allow for the sensing of the iron
source and MpeR expression is induced and, on interaction
with the iron source, activates the P
NMB1880
promoter
driving maximal expression of the NMB1880/TdfF system
allowing active uptake and survival within niches with
limited iron sources such as the eukaryotic intracellular
environment. However, this remains to be investigated.
The importance of iron acquisition in the development of
meningococcal disease has been established in animal
models, where the inability to acquire iron corresponds
with a strong attenuation of virulence (Calver et al., 1976;
Schryvers & Gonzalez, 1989; Stojiljkovic et al., 1995; Klee
et al., 2000). We believe that the iron regulation of MpeR,
its restricted presence in pathogenic Neisseria species, and
its targeting of iron-uptake genes that have been associated
with survival in the host, implicate this regulator as having
an important role in host adaptation.
ACKNOWLEDGEMENTS
We thank Giorgio Corsi for artwork, Luca Fagnocchi for help in RT
experiments, and Maurizio Comanducci and Stefania Bambini for the
use of chromosomal DNA and bacterial cells from the collection of
pathogenic isolates of Neisseria species. We thank Ana Antunes and
Kate Seib for critical reading of the manuscript. Anti-NMB1880 and
anti-NMB1882 polyclonal antiserum was provided by the Novartis
Vaccines MenB serology group. L. F. is the recipient of a Novartis
fellowship from the PhD programme in Functional Biology of
Molecular and Cellular Systems of the University of Bologna.
REFERENCES
Agarwal, S., Sebastian, S., Szmigielski, B., Rice, P. A. & Genco, C. A.
(2008). Expression of the gonococcal global regulatory protein Fur
and genes encompassing the Fur and iron regulon during in vitro and
in vivo infection in women. J Bacteriol 190, 3129–3139.
Anderson, M. T. & Armstrong, S. K. (2004). The BfeR regulator
mediates enterobactin-inducible expression of Bordetella enterobactin
utilization genes. J Bacteriol 186, 7302–7311.
Banerjee-Bhatnagar, N. & Frasch, C. E. (1990). Expression of
Neisseria meningitidis iron-regulated outer membrane proteins,
including a 70-kilodalton transferrin receptor, and their potential
for use as vaccines. Infect Immun 58, 2875–2881.
The MpeR regulator of meningococcus
http://mic.sgmjournals.org 2245
Brickman, T. J. & Armstrong, S. K. (2009). Temporal signaling and
differential expression of Bordetella iron transport systems: the role of
ferrimones and positive regulators. Biometals 22, 33–41.
Busby, S. & Ebright, R. H. (1994). Promoter structure, promoter
recognition, and transcription activation in prokaryotes. Cell 79, 743–
746.
Calver, G. A., Kenny, C. P. & Lavergne, G. (1976). Iron as a
replacement for mucin in the establishment of meningococcal
infection in mice. Can J Microbiol 22, 832–838.
Carson, S. D., Klebba, P. E., Newton, S. M. & Sparling, P. F. (1999).
Ferric enterobactin binding and utilization by Neisseria gonorrhoeae.
J Bacteriol 181, 2895–2901.
Childers, B. M. & Klose, K. E. (2007). Regulation of virulence in
Vibrio cholerae: the ToxR regulon. Future Microbiol 2, 335–344.
Delany, I., Ieva, R., Alaimo, C., Rappuoli, R. & Scarlato, V. (2003). The
iron-responsive regulator fur is transcriptionally autoregulated and
not essential in Neisseria meningitidis.J Bacteriol 185, 6032–6041.
Delany, I., Grifantini, R., Bartolini, E., Rappuoli, R. & Scarlato, V.
(2006). Effect of Neisseria meningitidis fur mutations on global
control of gene transcription. J Bacteriol 188, 2483–2492.
Ducey, T. F., Carson, M. B., Orvis, J., Stintzi, A. P. & Dyer, D. W.
(2005). Identification of the iron-responsive genes of Neisseria
gonorrhoeae by microarray analysis in defined medium. J Bacteriol
187, 4865–4874.
Egan, S. M. (2002). Growing repertoire of AraC/XylS activators.
J Bacteriol 184, 5529–5532.
Escolar, G., Lozano, M., Dı
´az-Ricart, M., Rao, G. H., Ordinas, A. &
White, J. G. (1999a). Modifications in accessibility of membrane
glycoproteins, binding of specific ligands and coagulation factor V
during the activation of platelets in blood emerging from bleeding
time wounds. Am J Hematol 60, 260–267.
Escolar, L., Pe
´rez-Martı
´n, J. & de Lorenzo, V. (1999b). Opening the
iron box: transcriptional metalloregulation by the Fur protein.
J Bacteriol 181, 6223–6229.
Fantappie
`, L., Metruccio, M. M., Seib, K. L., Oriente, F., Cartocci, E.,
Ferlicca, F., Giuliani, M. M., Scarlato, V. & Delany, I. (2009). The RNA
chaperone Hfq is involved in stress response and virulence in
Neisseria meningitidis and is a pleiotropic regulator of protein
expression. Infect Immun 77, 1842–1853.
Fantappie
`, L., Oriente, F., Muzzi, A., Serruto, D., Scarlato, V. &
Delany, I. (2011). A novel Hfq-dependent sRNA that is under FNR
control and is synthesized in oxygen limitation in Neisseria
meningitidis.Mol Microbiol 80, 507–523.
Fetherston, J. D., Bearden, S. W. & Perry, R. D. (1996). YbtA, an
AraC-type regulator of the Yersinia pestis pesticin/yersiniabactin
receptor. Mol Microbiol 22, 315–325.
Finlay, B. B. & Falkow, S. (1997). Common themes in microbial
pathogenicity revisited. Microbiol Mol Biol Rev 61, 136–169.
Folster, J. P. & Shafer, W. M. (2005). Regulation of mtrF expression in
Neisseria gonorrhoeae and its role in high-level antimicrobial
resistance. J Bacteriol 187, 3713–3720.
Fowler, M. I., Weller, R. O., Heckels, J. E. & Christodoulides, M.
(2004). Different meningitis-causing bacteria induce distinct inflam-
matory responses on interaction with cells of the human meninges.
Cell Microbiol 6, 555–567.
Francis, M. S., Wolf-Watz, H. & Forsberg, A. (2002). Regulation of
type III secretion systems. Curr Opin Microbiol 5, 166–172.
Gallegos, M. T., Williams, P. A. & Ramos, J. L. (1997). Transcriptional
control of the multiple catabolic pathways encoded on the TOL plasmid
pWW53 of Pseudomonas putida MT53. JBacteriol179, 5024–5029.
Gao, H., Zhou, D., Li, Y., Guo, Z., Han, Y., Song, Y., Zhai, J., Du, Z.,
Wang, X. & other authors (2008). The iron-responsive Fur regulon in
Yersinia pestis.J Bacteriol 190, 3063–3075.
Grifantini, R., Sebastian, S., Frigimelica, E., Draghi, M., Bartolini, E.,
Muzzi, A., Rappuoli, R., Grandi, G. & Genco, C. A. (2003).
Identification of iron-activated and -repressed Fur-dependent genes
by transcriptome analysis of Neisseria meningitidis group B. Proc Natl
Acad Sci U S A 100, 9542–9547.
Hagen, T. A. & Cornelissen, C. N. (2006). Neisseria gonorrhoeae
requires expression of TonB and the putative transporter TdfF to
replicate within cervical epithelial cells. Mol Microbiol 62, 1144–
1157.
Hanahan, D. (1983). Studies on transformation of Escherichia coli
with plasmids. J Mol Biol 166, 557–580.
Heinrichs, D. E. & Poole, K. (1996). PchR, a regulator of ferripyochelin
receptor gene (fptA) expression in Pseudomonas aeruginosa, functions
both as an activator and as a repressor. J Bacteriol 178, 2586–2592.
Ieva, R., Alaimo, C., Delany, I., Spohn, G., Rappuoli, R. & Scarlato, V.
(2005). CrgA is an inducible LysR-type regulator of Neisseria
meningitidis, acting both as a repressor and as an activator of gene
transcription. J Bacteriol 187, 3421–3430.
Jackson, L. A., Ducey, T. F., Day, M. W., Zaitshik, J. B., Orvis, J. & Dyer,
D. W. (2010). Transcriptional and functional analysis of the Neisseria
gonorrhoeae Fur regulon. J Bacteriol 192, 77–85.
Klee, S. R., Nassif, X., Kusecek, B., Merker, P., Beretti, J. L., Achtman,
M. & Tinsley, C. R. (2000). Molecular and biological analysis of eight
genetic islands that distinguish Neisseria meningitidis from the closely
related pathogen Neisseria gonorrhoeae.Infect Immun 68, 2082–
2095.
Labigne-Roussel, A., Courcoux, P. & Tompkins, L. (1988). Gene
disruption and replacement as a feasible approach for mutagenesis of
Campylobacter jejuni.J Bacteriol 170, 1704–1708.
Larson, J. A., Higashi, D. L., Stojiljkovic, I. & So, M. (2002). Replication
of Neisseria meningitidis within epithelial cells requires TonB-
dependent acquisition of host cell iron. Infect Immun 70, 1461–1467.
Larson, J. A., Howie, H. L. & So, M. (2004). Neisseria meningitidis
accelerates ferritin degradation in host epithelial cells to yield an
essential iron source. Mol Microbiol 53, 807–820.
Maiden, M. C., Bygraves, J. A., Feil, E., Morelli, G., Russell, J. E.,
Urwin, R., Zhang, Q., Zhou, J., Zurth, K. & other authors (1998).
Multilocus sequence typing: a portable approach to the identification
of clones within populations of pathogenic microorganisms. Proc Natl
Acad Sci U S A 95, 3140–3145.
Maxam, A. M. & Gilbert, W. (1977). A new method for sequencing
DNA. Proc Natl Acad Sci U S A 74, 560–564.
Munson, G. P., Holcomb, L. G. & Scott, J. R. (2001). Novel group of
virulence activators within the AraC family that are not restricted to
upstream binding sites. Infect Immun 69, 186–193.
Ochsner, U. A., Vasil, A. I. & Vasil, M. L. (1995). Role of the ferric
uptake regulator of Pseudomonas aeruginosa in the regulation of
siderophores and exotoxin A expression: purification and activity on
iron-regulated promoters. J Bacteriol 177, 7194–7201.
Oriente, F., Scarlato, V. & Delany, I. (2010). Expression of factor H
binding protein of meningococcus responds to oxygen limitation
through a dedicated FNR-regulated promoter. J Bacteriol 192, 691–
701.
Perkins-Balding, D., Ratliff-Griffin, M. & Stojiljkovic, I. (2004). Iron
transport systems in Neisseria meningitidis.Microbiol Mol Biol Rev 68,
154–171.
Pradel, E., Guiso, N. & Locht, C. (1998). Identification of AlcR,
an AraC-type regulator of alcaligin siderophore synthesis in
L. Fantappie
`, V. Scarlato and I. Delany
2246 Microbiology 157
Bordetella bronchiseptica and Bordetella pertussis.J Bacteriol 180, 871–
880.
Rohde, K. H. & Dyer, D. W. (2003). Mechanisms of iron acquisition by
the human pathogens Neisseria meningitidis and Neisseria gonor-
rhoeae.Front Biosci 8, d1186–d1218.
Roncarati, D., Spohn, G., Tango, N., Danielli, A., Delany, I. & Scarlato, V.
(2007). Expression, purification and characterization of the membrane-
associated HrcA repressor protein of Helicobacter pylori.Protein Expr
Purif 51, 267–275.
Rouquette, C., Harmon, J. B. & Shafer, W. M. (1999). Induction of the
mtrCDE-encoded efflux pump system of Neisseria gonorrhoeae
requires MtrA, an AraC-like protein. Mol Microbiol 33, 651–658.
Rouquette-Loughlin, C. E., Balthazar, J. T., Hill, S. A. & Shafer, W. M.
(2004). Modulation of the mtrCDE-encoded efflux pump gene complex
of Neisseria meningitidis due to a Correia element insertion sequence.
Mol Microbiol 54,731–741.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning:
A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor
Laboratory.
Schleif, R. (2003). AraC protein: a love-hate relationship. Bioessays
25, 274–282.
Schryvers, A. B. & Gonzalez, G. C. (1989). Comparison of the
abilities of different protein sources of iron to enhance Neisseria
meningitidis infection in mice. Infect Immun 57, 2425–2429.
Stojiljkovic, I., Hwa, V., de Saint Martin, L., O’Gaora, P., Nassif, X.,
Heffron, F. & So, M. (1995). The Neisseria meningitidis haemoglobin
receptor: its role in iron utilization and virulence. Mol Microbiol 15,
531–541.
Studier, F. W. & Moffatt, B. A. (1986). Use of bacteriophage T7 RNA
polymerase to direct selective high-level expression of cloned genes.
J Mol Biol 189, 113–130.
Turner, P. C., Thomas, C. E., Stojiljkovic, I., Elkins, C., Kizel, G.,
Ala’Aldeen, D. A. & Sparling, P. F. (2001). Neisserial TonB-dependent
outer-membrane proteins: detection, regulation and distribution of
three putative candidates identified from the genome sequences.
Microbiology 147, 1277–1290.
Edited by: J. Moir
The MpeR regulator of meningococcus
http://mic.sgmjournals.org 2247
