Methylation of the long control region of HPV16 is related to the severity of cervical neoplasia

Abstract

Oncogenic human papillomavirus (HPV) is the cause of cervical cancer. Hypermethylation of the CpG islands located at the long control region (LCR) of the HPV genome may regulate the expression of the major oncogenes E6 and E7, and may relate to cancer progression. The goal of the present study was to investigate the methylation patterns of CpG dinucleotides contained within the LCR of the HPV16 genome in a collection of clinical specimens comprising the full spectrum of cervical carcinogenesis.
The status of LCR methylation was investigated in HPV16-infected cervical precancer and cancer cell lines, and in HPV16-infected low-grade squamous intraepithelial lesion of cervix (LSIL, n=17), high-grade squamous intraepithelial lesion (HSIL, n=21) and invasive squamous cell carcinoma (SCC, n=15) by bisulfite sequencing.
Among the three CpG islands of HPV16 LCR, methylation was found in three in the CaSki cell, in two upstream ones in SiHa cell, and none in the precancerous Z172 cell. Reactivation of E6 gene expression upon demethylation by 5-aza-dC and TSA treatments was noted in CaSki cells. In HPV-infected cervical specimens, progressive methylation of HPV16 LCR was noted, with rates of 5.9%, 33.3% and 53.3% in LSIL, HSIL and SCC, respectively (P<0.01). A trend toward increasing density of CpG methylation was also noted. Topologically, more methylated sites were found at the E6/E7 promoter region in SCC, compared with LSIL and HSIL.
The study disclosed downregulation of E6 gene transcription by LCR methylation in cervical cancer cells. Methylation of HPV 16 LCR is highly associated with severity of cervical neoplasm.

Full text

Methylation of the long control region of HPV16 is related to the severity of
cervical neoplasia
Dah-Ching Ding
a
, Ming-Hsien Chiang
b
, Hung-Cheng Lai
c
, Chao Agnes Hsiung
d,g
,
Chang-Yao Hsieh
e,g
, Tang-Yuan Chu
a,f,g,
*
a
Department of Obstetrics and Gynecology, Buddhist Tzu Chi General Hospital, Tzu Chi University, Hualien, Taiwan, ROC
b
Graduate Institute of Public Health, National Defense Medical Center, Taipei, Taiwan, ROC
c
Department of Obstetrics and Gynecology, Tri-Service General Hospital, Taiwan, ROC
d
Division of Biostatistics and Bioinformatics, National Health Research Institutes, Taiwan
e
Department of Obstetrics and Gynecology, National Taiwan University Medical College, Taiwan
f
Graduate Institute of Clinical Medicine, Tzu Chi University, Hualien, Taiwan, ROC
g
Taiwan Clinical Oncology Group, National Health Research Institute, Taiwan, ROC
1. Introduction
The carcinogenic role of human papillomavirus (HPV) lies
mainly on the E6 and E7 oncoproteins which turn down p53 and
pRB, respectively [1,2]. Expression of E6 and E7 genes, which is
highly related to the progression of cervical neoplasia, is controlled
by the upstream long control region (LCR) where the promoter and
enhancers driving viral transcription are located. Upon cancer
progression, the episomal HPV genomes are often integrated into
the host genome. The integration usually disrupts the E2
suppressor physically, leading to the loss of repression of the
E6/E7 promoter at LCR [3]. In addition to the control by trans-
acting protein, during carcinogenesis, HPV DNA may become
methylated like any type of foreign DNA in response to
recombination with cellular DNA. Methylation at the CpG sites
during the productive HPV16 life cycle, usually at the low grade
and premalignant lesions, is not yet understood, but may be linked
to the binding of sequence-specific transcription factors and affect
the development of cervical cancer.
The goal of the present study was to investigate the
methylation patterns of CpG dinucleotides contained within
the LCR of the HPV16 genome, in a collection of clinical specimens
comprising the full spectrum of cervical carcinogenesis. The
effect of HPV16 DNA methylation on the expression of the
downstream genes was also investigated in cervical cancer and
precancer cell lines.
European Journal of Obstetrics & Gynecology and Reproductive Biology 147 (2009) 215–220
ARTICLE INFO
Article history:
Received 9 March 2009
Received in revised form 29 June 2009
Accepted 18 August 2009
Keywords:
Human papillomavirus
Methylation
Long control region
Cervical cancer
ABSTRACT
Objective:
Oncogenic human papillomavirus (HPV) is the cause of cervical cancer. Hypermethylation of
the CpG islands located at the long control region (LCR) of the HPV genome may regulate the expression
of the major oncogenes E6 and E7, and may relate to cancer progression. The goal of the present study
was to investigate the methylation patterns of CpG dinucleotides contained within the LCR of the HPV16
genome in a collection of clinical specimens comprising the full spectrum of cervical carcinogenesis.
Study design: The status of LCR methylation was investigated in HPV16-infected cervical precancer and
cancer cell lines, and in HPV16-infected low-grade squamous intraepithelial lesion of cervix (LSIL,
n= 17), high-grade squamous intraepithelial lesion (HSIL, n= 21) and invasive squamous cell carcinoma
(SCC, n= 15) by bisulfite sequencing.
Results: Among the three CpG islands of HPV16 LCR, methylation was found in three in the CaSki cell, in
two upstream ones in SiHa cell, and none in the precancerous Z172 cell. Reactivation of E6 gene
expression upon demethylation by 5-aza-dC and TSA treatments was noted in CaSki cells. In HPV-
infected cervical specimens, progressive methylation of HPV16 LCR was noted, with rates of 5.9%, 33.3%
and 53.3% in LSIL, HSIL and SCC, respectively (P<0.01). A trend toward increasing density of CpG
methylation was also noted. Topologically, more methylated sites were found at the E6/E7 promoter
region in SCC, compared with LSIL and HSIL.
Conclusion: The study disclosed downregulation of E6 gene transcription by LCR methylation in cervical
cancer cells. Methylation of HPV 16 LCR is highly associated with severity of cervical neoplasm.
ß2009 Elsevier Ireland Ltd. All rights reserved.
* Corresponding author at: Department of Obstetrics and Gynecology, Buddhist
Tzu Chi General Hospital, Hualien, 707, Sec. 3, Chung Yang Road, Hualien 970,
Taiwan, ROC. Tel.: +886 3 8561825x2224; fax: +886 3 8577161.
E-mail address: tychu@mail2000.com.tw (T.-Y. Chu).
Contents lists available at ScienceDirect
European Journal of Obstetrics & Gynecology and
Reproductive Biology
journal homepage: www.elsevier.com/locate/ejogrb
0301-2115/$ – see front matter ß2009 Elsevier Ireland Ltd. All rights reserved.
doi:10.1016/j.ejogrb.2009.08.023

2. Materials and methods
2.1. Studied patients and HPV genotyping
The study included HPV16-infected women with diagnoses of
low-grade squamous intraepithelial lesion of cervix (LSIL, n= 17),
high-grade squamous intraepithelial lesions (HSIL, n=21) and
invasive squamous cell carcinoma (SCC, n= 15) of the uterine
cervix. They were histology-proved cases nested to a multi-center
cohort (the TCOG-1899 cohort of National Health Research
Institute) (for LSIL and HSIL cases) and a hospital-based cohort
(the Tri-Service General Hospital or TSGH cohort) (for SCC cases)
in Taiwan, as described previously [4,5]. All patients were
investigated and managed according to a standard guideline.
HPV was detected in 269 LSIL, 324 HSIL and 263 SCC, and 20 (9.0%),
92 (31.7%) and 115 (44%) of them showed single HPV16 infection,
respectively [6,7]. All the HPV 16-positive LSIL cases except for
three who developed HSIL within 3 months upon follow-up,
entered the study. In addition,21 and 15 HPV16-infected HSIL and
SCC were randomly selected from the HPV16-positive pools. The
SCC cases included 11 FIGO stage 1b, 3 stage 2a and 1 stage 2b
cases. The study was approved by the Institutional Review Board
of the Tri-Service General Hospital and National Health Research
Institute, TCOG. Informed consent was obtained from each
subject.
2.2. Clinical specimens and preparation of genomic DNA
Cervical scrapings of LSIL and HSIL subjects were collected by
Cervirex brush and stored in phosphate buffered saline, and
tumor tissues were procured from SCC patients as previously
described [5]. DNA was extracted by using a Qiagen DNA
extraction kit (Hilden, Germany). The concentration of DNA
was determined by the PicoGreen fluorescence absorption
method, and its quality was checked by agarose gel electrophor-
esis. HPV in cervical scrapings was detected by L1 consensus PCR
with PGMY09/11primers and reverse line blot hybridization as
described before [8].
2.3. Bisulfite modification, methylation-specific PCR (MS-PCR) and
bisulfite sequencing [9]
Sodium bisulfite (Chemicon, Ternecula, CA, USA) was used to
convert unmethylated cytosine residues to uracils, whereas
methylated cytosines remained unmodified. The modified DNA
was amplified in four amplicons as shown in Fig. 1A[10]:LCR01
Fig. 1. (A) Structure of the HPV16 LCR, CpG sites and PCR amplification. The LCR region from nt 7200 to 7906 followed by 1–100 of close circular DNA of HPV16 genome was
shown. Poly-A tail (pA) of L1 gene and transcription start site (p97) of E6 gene was shown as single arrow in 5
0
and 3
0
end, respectively. Binding sites of transcription factors
(shown as boxes and circles) were shown. CpG sites were indicated as vertical bars on the lower line, with position of each site given as number in cycle. Three overlapped
DNA segments amplified by PCR in this study were shown as double arrows on top. The diagram of the gene structure was adopted from Stunkel et al. [10]. (B) CpG
methylation patterns of the LCR of HPV16 in cervical cancer and precancer cell lines. Status of methylation of individual CpG sites were shown as open (non-methylated) or
closed (methylated) cycles. Multiple clones derived from PCR products amplified from CaSki, SiHa and Z172 cells were shown as lines of cycles. Positions of individual CpG
sites were given as numbers in circles on top.
D.-C. Ding et al. / European Journal of Obstetrics & Gynecology and Reproductive Biology 147 (2009) 215–220
216

(positions 7298–7575; forward primer: ATTATTGTGTTATGTAATA-
TAAATAAATTT; reverse primer: AATCAAAAAAACAAAAATTTAA-
CAC), LCR02 (positions 7780–112; forward primer: ATTTT-
AGTTTATATATGAATTGTGTAAAGG; reverse primer: CTAAAACAT-
TACAATTCTCTTTTAATACAT), LCR03 (positions 7505–7788; forward
primer: TGTTAGTAATTATGGTTTAAATTTGTA; reverse primer: AAC-
TAAAATAACATTTAATTAACCTTAAAA), and LCR04 (positions 7283–
210; forward primer: TTAAATGTTTGTGTAATTATTGTGTTATGT;
reverse primer:TATTACTTACAATACACACATTCTAATATT).Amplified
products were gel purified and cloned into pCR4-TOPO vector
(Invitrogen, Carlsbad, CA) for DNA sequencing. At least 5 individual
clones derived from each amplicon were sequenced, by the 377
automatic sequencer (Applied Biosystems, Foster City, CA, USA).
2.4. Cell culture and demethylation treatment
CaSki and SiHa cervical cancer cells, which contain integrated
HPV16 genome of about 600 copies and 1–2 copies per cell,
respectively, were obtained from the American Type Culture
Collection. Z172 cells are HPV16 DNA-immortalized human
epithelial cells containing HPV16 E6 and E7 open reading frames
and exhibit the features of carcinoma in situ of cervix. Cells were
cultured in RPMI 1640 or Minimal Essential Medium (GIBCO BRL)
supplemented with 10% fetal bovine serum. For demethylation,
cells were treated with different concentrations of 5
0
-aza-2
0
-
deoxycytidine (5-aza-dC, Sigma Chemical Co.) and trichostatin A
(TSA, Sigma Chemical Co.). Typically, cells were treated with 5-aza-
dC for 4 days or TSA for 24 h, or with two regimens consecutively
[11].
2.5. RT-PCR
Total RNA was extracted by using a Qiagen RNeasy kit (Qiagen,
Valencia, CA). An additional DNase I digestion procedure (Qiagen)
was included in the isolation of RNA to remove DNA contamination
following the manufacturer’s protocol. One microgram of total
RNA from each sample was subject to cDNA synthesis using
Superscript II reverse transcriptase and random hexamer (Invitro-
gen). The cDNA generated was used for PCR amplification with
primers of E6, E7 and GAPDH (primer sequence can be requested).
2.6. Statistical analysis
The SPSS program (Version13) for Windows (SPSS, Chicago, IL,
USA) was used for statistical analyses. Associations between the
methylation of genes and clinical parameters were analyzed by
using Chi-square test and Fisher’s exact test. Logistic regression
and polytomous logistic regression were used to compare
methylation status and severity of lesions. Survival was assessed
using the life-table method. Survival time was calculated as time
from diagnosis of CC to death from cervical cancer or time of last
contact. Cox proportion hazards regression was used to develop
hazard ratio of mortality of different variables, with an adjustment
of correlated risk factors. Kaplan–Meier curves and log rank test
were developed to compare the survival of SCC patients stratified
by the status of HPV16 methylation. The alpha level of statistical
significance was set at P= 0.05.
3. Results
3.1. HPV16 LCR was highly methylated in cervical cancer cells with
resultant down regulation of E6 expression
As shown in Fig. 1B, hypermethylation of the LCR was noted in
CaSki cells, less in SiHa cells and not in Z172 cells. Topologically,
high density of methylation was noted in all the three CpG regions
in CaSki cells, in the 5
0
LCR and enhancer regions in the SiHa cells.
Upon treatment with 5-aza-dC, demethylation of these CpG sites
was noted (Fig. 2C), and reactivation of E6 gene expression was
noted in CaSki cells (Fig. 2A and B). The demethylation effect was
further augmented by adding histone deacetylase inhibitor
(Fig. 2B).
Fig. 2. Changes of expression of E6 and E7 genes upon demethylation treatment in cervical cancer and precancer cells. (A) Expression of the HPV E6 and E7 genes as well as the
GAPDH control were shown by RT-PCR in cells treated with no medication (1), 5
m
M of 5-aza-dC (2), 10
m
M of 5-aza-dC (3), 0.3
m
M TSA (4), and 5
m
M of 5-aza-dC and 0.3
m
M
of TSA (5). A no-DNA negative control was also shown (6). (B) An enlarged version of RT-PCR of E6 gene in CaSki cell was shown, with the densitometry ratio to no medication
product given below each bands. (C) The changes of CpG methylation in CaSki cells after 5-aza-dC treatment were confirmed by bisulfite sequencing. After demethylation
treatment, much less proportion of clones was found to be methylated; the distribution of CpG methylation was much decreased, as compared to the non-treated results
shown in this figure.
D.-C. Ding et al. / European Journal of Obstetrics & Gynecology and Reproductive Biology 147 (2009) 215–220
217

3.2. Progressive methylation of HPV16 LCR in different severities of
cervical carcinogenesis
By bisulfite sequencing, we determined the frequencies of
methylation at each of the 15 CpG sites of the LCR of HPV16 in
clinical specimens. As shown in Fig. 3A, progressive methylation of
HPV16 LCR was noted in cervical cells of different severities of
cervical carcinogenesis. In LSIL, there were only rare occasions of
CpG methylation at the 5
0
LCR region, whereas in HSIL, more
frequent methylation was noted at the enhancer and 5
0
LCR regions.
In SCC, much higher frequencies of CpG methylation were noted in
all the CpG sites, with E6/E7 promoter to be a more prominent
region than the milder lesions.
3.3. Clinical correlates of HPV16 LCR methylation
Methylation of at least one CpG site of the LCR was noted in
5.9% of LSIL, 33.3% of HSIL, and 53.3% of SCC (P<0.01). As shown in
Table 1, there was a trend toward increase of HPV16 LCR
methylation from LSIL, HSIL to SCC. The odds ratio of methylated
LCR in HSIL and SCC was 10.3 (95% CI = 1.0–109) and 20.2 times
(95% CI = 1.48–275.28) higher than that of LSIL, respectively. The
demographic, reproduction, and environmental exposure status
of the studies subjects were compared with the status of HPV16
LCR methylation. As shown in Table 2, there was no significant
association of HPV methylation with the age of diagnosis, live
birth number, smoking, vitamins supplement or smoking, but use
of oral contraceptives was associated with less frequent methyla-
tion of HPV LCR (P= 0.04). As to the prognostic factors of SCC
patients, the long-term survival was significantly related to the
FIGO stage at the time of diagnosis but not to the methylation
status of HPV16 LCR (Fig. 3B). The 5-year survival rate was higher
in HPV16 SCC without LCR methylation (86%) than those with
methylation (50%).
4. Discussion
We studied the methylation status of HPV16 genome encom-
passing the 15 CpG sites of the LCR in cervical cancer cell lines and
clinical specimens of different severities. A progressive methyla-
tion of HPV16 LCR was noted in cervical neoplasia of different
severities in cell lines as well as in cervical lesions. The odds ratio of
HPV16 LCR methylation in SCC was 20 times higher than in LSIL.
Possible mechanisms underlying this observation may be twofold.
First, methylation may block the binding sites of HPV E2 repressor,
preventing E6 and E7 oncogenes from being repressed by E2, thus
enhancing the carcinogenesis. E2 binding sites (E2BSs) contain CpG
dinucleotides within the conserved palindromic sequences and are
potential targets for DNA methylation in the host cell. Previous
studies have proved in vitro that the DNA binding and trans-
activation activity of E2 protein are inhibited by the CpG
methylation [12]. Indeed, as shown in this study, the locations
of the four E2BSs in HPV16 LCR were those found to be
progressively methylated along the course of cervical carcinogen-
esis (Figs. 1 and 3A). Second, the heavy methylation can be
interpreted as a genome defence of the host cell against a
chromosomally integrating virus [13]. Previous study has
shown that non-transforming infection of HPV depends on the
Fig. 3. (A) Distribution of methylated CpG sites in different severities of cervical
neoplasia. From results of bisulfite sequencing of HPV16 LCR, the proportions of
subjects showing methylation of different CpG sites were given as bars. CpG sites
regions at different areas of the LCR were given on the bottom. There showed a trend
of methylation of HPV16 LCR upon the progression of cervical neoplasia, with the
promoter region to be most different area. (B) Kaplan–Meier analysis of survival of
patients with squamous cell carcinoma with (solid line) or without (dotted line)
methylation of HPV16 LCR.
Table 1
Methylation of the LCR of HPV16 in cervical neoplasia of different severity.
Age (years) HPV16 methylation
*
OR (95% CI)
a
LSIL 36.9
11.4
1/17 (5.9%) 1.0
HSIL 42.9
10.5
7/21 (33.3%) 10.3 (0.9–109)
SCC 51.6
9.9
8/15 (53.3%) 20.2 (1.5–275)
Total 16/53 (30.2%)
a
Adjusted by age.
*
P= 0.01, Pfor trend <0.006.
Table 2
Methylation of HPV LCR and demographic status of women with cervical neoplasia.
Variables Methylation of LCR of HPV16 Pvalue
Unmethylated,
N(%)
Methylated,
N(%)
Age 30 (41.8) 8 (45.7) 0.97
Live birth 1.00
Yes 26 (76.5) 8 (23.5)
No 2 (100) 0 (0)
Parity 28 (3.0) 8 (2.5) 0.81
Smoking 0.31
Yes 7 (100) 0 (0)
No 23 (74.2) 8 (25.8)
Years of smoking 12.98
7.49
0ND
a
Oral contraceptive use 0.04
Yes 12 (100) 0 (0)
No 18 (69.2) 8 (30.8)
Years of OC use 3.21
2.62
0ND
Vitamin supplement 0.43
Yes 8 (100) 0 (0)
No 22 (73.3) 8 (26.7)
a
ND: not determined.
D.-C. Ding et al. / European Journal of Obstetrics & Gynecology and Reproductive Biology 147 (2009) 215–220
218

differentiation of the squamous epithelium to complete its life
cycle. HPV16 LCR was selectively hypomethylated in highly
differentiated cell populations but in poorly differentiated, basal
cell-like cells the LCR region was often hyper-methylated,
particularly at E2BSs [12]. Upon progression of the HPV disease,
differentiation was inhibited, immature and dysplastic cells
became dominant in the lesion, and more HPV genome became
integrated into the host genome. The host defence system will be
activated after foreign DNA integration followed by activation of de
novo methylation [14].
Obviously, the above mentioned possible underlying mechan-
isms of LCR methylation do not prevent the oncogenic expression
of E6/E7 in cervical cancer. It is generally known that the genome
of HPV integrates into the host genome mostly in tandem arrays
[15]. In the example of CaSki cells, around 50 copies of HPV
genomes integrate into the cellular genome in tandem arrays
[16], which are targets of methylation. But some of these
genomes remain unmethylated and still actively express the HPV
oncogenes [16]. Meanwhile, upon demethylation treatment, as
shown in this study, a twofold increase of E6 expression was
noted, suggesting methylation of LCR has partly limited the
expression of E6 gene but not to an extent to halt the process of
carcinogenesis.
The study also revealed that CpGs at the E6/E7 promoter region
were the most differentially methylated, followed by CpGs at 5
0
LCR
region and the enhancer region. The E6/E7 promoter region
contains binding sites of activator Sp1 [17], the viral factor E2, and
the TATA box (Fig. 1). This segment is organized in form of a
specifically positioned nucleosome, whose acetylation affects the
promoter activity [10]. Interestingly, as also found in a previous
study [18], a CpG site (CpG7862 in Fig. 1A) located in the linker
between two nucleosomes positioned over the enhancer and E6/E7
promoter had minimal methylation. This linker region forms part
of the HPV replication origin and is close to binding sites of master-
regulators of transcription during epithelial differentiation. The
biological significance of this methylation free-CpG is so far
unclear.
Previous studies of HPV16 LCR methylation were limited and
had controversial results. By using the restriction enzyme McrBC
method, Badal et al. reported a progressive hypomethylation of
HPV16 LCR in cervical neoplasia of different severities, and
suggested demethylation as the cause of neoplastic progression
[16]. On the contrary, this study and an earlier report [18], used
bisulfite sequencing to map the extent of methylation of the CpG
sites of HPV16 LCR. Both reports revealed a progressive methyla-
tion of HPV16 LCR during carcinogenesis. Another earlier report,
using methylation sensitive HpaII/MspI restriction digestion to
study the E2 binding site proximal to the E6/E7 promoter, also
showed a significantly higher methylation rate in cervical cancer
than in normal controls [19].
The same hypermethylation of LCR in the development of
cervical cancer seems not applicable to other HPV types. For
instance, the methylation pattern in HPV18 is opposed to the
pattern of HPV16 [20]. In HPV18, hypermethylation was detected
in L1 region, which is adjacent to LCR and a part of E6, in cancerous
lesions.
In this study, use of oral contraceptives was found to be
associated with less frequent methylation of HPV16 LCR. Oral
contraceptives containing estrogen have been reported to alter the
epigenome of hormone responsive cells [21]. In an estradiol -
induced carcinogenesis model in the rat, a rapid and sustained loss
of global DNA methylation was noted along with the initiation of
breast alveolar and ductular transformation [21]. Meanwhile, use
of oral contraceptives has been found to be an independent risk
factor of cervical cancer in women with HPV infection [22]. With
long-term exposure to oral contraceptives, the HPV genome may
be passively hypomethylated by estrogen, the major ingredient of
the oral pills.
In conclusion, a correlation between the HPV16 LCR methyla-
tion and cervical cancer formation was observed in this study.
Whether methylation of HPV16 LCR confers a poorer prognosis of
SCC deserves a larger scale study. So far, the biological meaning of
progressive HPV LCR methylation in the process of carcinogenesis
is not clear. It may be a defence mechanism of the host, an integral
part of the life cycle of the virus or a disease-related event.
Whatever the mechanism is, methylation of HPV16 LCR may serve
as a marker of severity of cervical neoplasia, adding to the well-
studied clinical significance of HPV16.
Acknowledgements
This study was supported by National Health Research Institute,
Taiwan, ROC (NHRI CA-95-PP-26), National Science Council,
Taiwan, ROC (NSC 96-2314-B-303-008) and Buddhist Tzuchi
General Hospital, Taiwan, ROC (TCRD96-1, TCRD97-09).
References
[1] Dyson N, Howley PM, Munger K, Harlow E. The human papilloma virus-16 E7
oncoprotein is able to bind to the retinoblastoma gene product. Science
1989;243:934–7.
[2] Werness BA, Levine AJ, Howley PM. Association of human papillomavirus
types 16 and 18 E6 proteins with p53. Science 1990;248:76–9.
[3] Demeret C, Desaintes C, Yaniv M, Thierry F. Different mechanisms contribute
to the E2-mediated transcriptional repression of human papillomavirus type
18 viral oncogenes. J Virol 1997;71:9343–9.
[4] Sun CA, Hsiung CA, Lai CH, et al. Epidemiologic correlates of cervical human
papillomavirus prevalence in women with abnormal Pap smear tests: a
Taiwan Cooperative Oncology Group (TCOG) study. J Med Virol 2005;77:
273–81.
[5] Chu TY, Hwang KS, Yu MH, Lee HS, Lai HC, Liu JY. A research-based tumor tissue
bank of gynecologic oncology: characteristics of nucleic acids extracted from
normal and tumor tissues from different sites. Int J Gynecol Cancer
2002;12:171–6.
[6]DingDC,HsuHC,HuangRL,etal.Type-specific distribution of HPV along
the full spectrum of cervical carcinogenesis in Taiwan: an indication of
viral oncogenic potential. Eur J Obstet Gynecol Reprod Biol 2008;140:
245–51.
[7] Chen CA, Liu CY, Chou HH, et al. The distribution and differential risks of
human papillomavirus genotypes in cervical preinvasive lesions: a Taiwan
Cooperative Oncologic Group Study. Int J Gynecol Cancer 2006;16:1801–8.
[8] Lai HC, Chang CC, Lin YW, et al. Genetic polymorphism of the interferon-
gamma gene in cervical carcinogenesis. Int J Cancer 2005;113:712–8.
[9] Herman JG, Graff JR, Myohanen S, Nelkin BD, Baylin SB. Methylation-specific
PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci
USA 1996;93:9821–6.
[10] Stunkel W, Huang Z, Tan SH, O’Connor MJ, Bernard HU. Nuclear matrix
attachment regions of human papillomavirus type 16 repress or activate
the E6 promoter, depending on the physical state of the viral DNA. J Virol
2000;74:2489–501.
[11] Danam RP, Howell SR, Brent TP, Harris LC. Epigenetic regulation of O6-
methylguanine-DNA methyltransferase gene expression by histone acetyla-
tion and methyl-CpG binding proteins. Mol Cancer Ther 2005;4:61–9.
[12] Kim K, Garner-Hamrick PA, Fisher C, Lee D, Lambert PF. Methylation patterns
of papillomavirus DNA, its influence on E2 function, and implications in viral
infection. J Virol 2003;77:12450–9.
[13] Doerfler W, Remus R, Muller K, Heller H, Hohlweg U, Schubbert R. The fate of
foreign DNA in mammalian cells and organisms. Dev Biol (Basel) 2001;
106:89–97 [discussion 143–60].
[14] Ego T, Tanaka Y, Shimotohno K. Interaction of HTLV-1 Tax and methyl-CpG-
binding domain 2 positively regulates the gene expression from the hyper-
methylated LTR. Oncogene 2005;24:1914–23.
[15] Daniel B, Mukherjee G, Seshadri L, Vallikad E, Krishna S. Changes in the
physical state and expression of human papillomavirus type 16 in the pro-
gression of cervical intraepithelial neoplasia lesions analysed by PCR. J Gen
Virol 1995;76(Pt 10):2589–93.
[16] Badal V, Chuang LS, Tan EH, et al. CpG methylation of human papillomavirus
type 16 DNA in cervical cancer cell lines and in clinical specimens: genomic
hypomethylation correlates with carcinogenic progression. J Virol 2003;77:
6227–34.
[17] Harrington MA, Jones PA, Imagawa M, Karin M. Cytosine methylation does not
affect binding of transcription factor Sp1. Proc Natl Acad Sci USA 1988;
85:2066–70.
[18] Kalantari M, Calleja-Macias IE, Tewari D, et al. Conserved methylation patterns
of human papillomavirus type 16 DNA in asymptomatic infection and cervical
neoplasia. J Virol 2004;78:12762–7.
D.-C. Ding et al. / European Journal of Obstetrics & Gynecology and Reproductive Biology 147 (2009) 215–220
219

[19] Bhattacharjee B, Sengupta S. CpG methylation of HPV 16 LCR at E2 binding site
proximal to P97 is associated with cervical cancer in presence of intact E2.
Virology 2006;354:280–5.
[20] Turan T, Kalantari M, Calleja-Macias IE, et al. Methylation of the human
papillomavirus-18 L1 gene: a biomarker of neoplastic progression? Virology
2006;349:175–83.
[21] Kovalchuk O, Tryndyak VP, Montgomery B, et al. Estrogen-induced rat breast
carcinogenesis is characterized by alterations in DNA methylation, histone
modifications and aberrant microRNA expression. Cell Cycle 2007;6:2010–8.
[22] Moreno V, Bosch FX, Munoz N, et al. Effect of oral contraceptives on risk of
cervical cancer in women with human papillomavirus infection: the IARC
multicentric case-control study. Lancet 2002;359:1085–92.
D.-C. Ding et al. / European Journal of Obstetrics & Gynecology and Reproductive Biology 147 (2009) 215–220
220