Content uploaded by Tomonori Hayashi
Author content
All content in this area was uploaded by Tomonori Hayashi on Mar 08, 2014
Content may be subject to copyright.
2005;65:9771-9778. Cancer Res
Takahiko Ogawa, Tomonori Hayashi, Masahide Tokunou, et al.
Containing Connexin 43 Gene Locus
Intercellular Communication via Acetylation of Histone
Suberoylanilide Hydroxamic Acid Enhances Gap Junctional
Updated version
http://cancerres.aacrjournals.org/content/65/21/9771
Access the most recent version of this article at:
Cited Articles
http://cancerres.aacrjournals.org/content/65/21/9771.full.html#ref-list-1
This article cites by 46 articles, 19 of which you can access for free at:
Citing articles
http://cancerres.aacrjournals.org/content/65/21/9771.full.html#related-urls
This article has been cited by 3 HighWire-hosted articles. Access the articles at:
E-mail alerts
related to this article or journal.Sign up to receive free email-alerts
Subscriptions
Reprints and
.pubs@aacr.orgDepartment at
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Permissions
.permissions@aacr.orgDepartment at
To request permission to re-use all or part of this article, contact the AACR Publications
Research.
on June 8, 2013. © 2005 American Association for Cancercancerres.aacrjournals.org Downloaded from
Suberoylanilide Hydroxamic Acid Enhances Gap Junctional
Intercellular Communication via Acetylation of Histone
Containing Connexin 43 Gene Locus
Takahiko Ogawa,
1
Tomonori Hayashi,
1
Masahide Tokunou,
1
Kei Nakachi,
1
James E. Trosko,
3
Chia-Cheng Chang,
3
and Noriaki Yorioka
2
1
Department of Radiobiology and Molecular Epidemiology, Radiation Effects Research Foundation;
2
Department of Molecular and
Internal Medicine, Graduate School of Biomedical Sciences, Hiroshima University, Hiroshima, Japan; and
3
National Food Safety
Toxicology Center, Department of Pediatrics/Human Development, Michigan State University, East Lansing, Michigan
Abstract
A histone deacetylase (HDAC) inhibitor, suberoylanilide
hydroxamic acid (SAHA), induces apoptosis in neoplastic
cells, but its effect on gap junctional intercellular communi-
cation in relation to apoptosis was unclear. Therefore, we
carried out a comparative study of the effects of two HDAC
inhibitors, SAHA and trichostatin-A, on gap junctional
intercellular communication in nonmalignant human perito-
neal mesothelial cells (HPMC) and tumorigenic ras oncogene–
transformed rat liver epithelial cells (WB-ras) that showed a
significantly lower level of gap junctional intercellular
communication than did HPMC. Gap junctional intercellular
communication was assessed by recovery rate of fluorescence
recovery after photoble aching. Treatment of HPMC with
SAHA at nanomolar concentrations caused a dose-dependent
increase of recovery rate without inducing apoptosis. This
effect was accompanied by enhanced connexin 43 (Cx43)
mRNA and protein expression and increased presence of Cx43
protein on cell membrane. Trichostatin-A induced apoptosis
in HPMC but was less potent than SAHA in enhancing the
recovery rate. In contrast, treatment of WB-ras cells with
SAHA or trichostatin-A induced apoptosis at low concen-
trations, in spite of smaller increases in recovery rate, Cx43
mRNA, and protein than in HPMC. Chromatin immunopre-
cipitation analysis revealed that SAHA enhanced acetylated
histones H3 and H4 in the chromatin fragments associated
with Cx43 gene in HPMC. These results indicate that SAHA at
low concentrations selectively up-regulates Cx43 expression in
normal human cells without induction of apoptosis, as a result
of histone acetylation in selective chromatin fragments, in
contrast to the apoptotic effect observed in tumorigenic
WB-ras cells. These results support a cancer therapeutic and
preventive role for specific HDAC inhibitors. (Cancer Res 2005;
65(21): 9771-8)
Introduction
Histone deacetylase (HDAC) inhibitors have been suggested as
potential cancer therapeutic agents because of their different effect
on apoptosis in normal and cancer cells (1, 2). The prototype of
hydroxamic acid–based hybrid polar molecules, suberoylanilide
hydroxamic acid (SAHA), belongs to the second generation of this
class of potential therapeutic cancer drugs. It displays a greater
potency, on a molar basis, as an inducer of differentiation and,
therefore, is expected to be a safer analogue of trichostatin-A (3, 4).
SAHA functions as a HDAC inhibitor, with ID
50
values close to its
optimal differentiation-inducing concentration (5). Acetylation of
core nucleosomal histones is, in part, regulated by opposing
activities of histone acetyltransferases and HDACs (6, 7); the
increased acetylation of histones is associated with genes that are
transcriptionally activated (8, 9). Hyperacetylation induced by
HDAC inhibitors, such as SAHA, seems to be highly selective and
changed the expression of only 2% to 5% of all genes (10). SAHA
induces differentiation and/or apoptosis in certain transformed
cells through the increased expression of selected genes involved in
the cell cycle regulation, tumor suppression, differentiation, and
apoptosis (5, 6). It has been reported that increased gene
expression of the cell cycle kinase inhibitor p21
WAF1
might account
for the antitumor property of SAHA (6, 11), but the precise
mechanism remains to be elucidated.
Asklund et al. (12) recently reported that 4-phenylbutyrate, an
HDAC inhibitor, enhances gap junctional intercellular communi-
cation through increased levels of connexin 43 (Cx43) in malignant
glioma cells, although precisely how this HDAC inhibitor up-
regulates Cx43 has not been delineated. We previously reported
that hexamethylene bisacetamide (HMBA), a hybrid polar mole-
cule, enhanced gap junctional intercellular communication in
human peritoneal mesothelial cells (HPMC), which are nontumori-
genic primary cultured cells. This effect, induced by millimolar
concentrations, was accompanied by an increased expression of
both mRNA and phosphorylated isoforms of Cx43 (13, 14). Side
effects, such as myelotoxicity, have been reported for HMBA (15).
Gap junction channels transport small molecules (<2,000 Da)
important in growth regulation signaling between neighboring cells
(16, 17). Gap junctional intercellular communication is inv olved in
cell growth, differentiation, and apoptosis; aberrant control of gap
junctional intercellular communication might also play an
important role in cancer development (18–21). Several oncogene
products have been shown to reduce gap junction channe l
permeability and connexin expression in vitro and in vivo
(22, 23). It is anticipated that SAHA will work as an enhancer of
gap junctional intercellular communication in both normal and
cancer cells. It is then important to elucidate (a) whether SAHA
enhances Cx43 expression and gap junctional intercellular
communication in normal human cells and neoplastically trans-
formed cells, with specific target molecules at lower concentrations
than with trichostatin-A; (b) whether apoptosis is induced also in
Note: T. Ogawa and T. Hayashi contributed equally to this work.
Requests for reprints: Takahiko Ogawa or Tomonori Hayashi, Department of
Radiobiology and Molecular Epidemiology, Radiation Effects Research Foundation,
5-2, Hijiyama Park, Minami Ward, 732-0815 Hiroshima, Japan. Phone: 81-82-261-3131;
Fax: 81-82-261-3170; E-mail: tk-ogawa@hph.pref.hiroshima.jp or tomo@rerf.or.jp.
I2005 American Association for Cancer Research.
doi:10.1158/0008-5472.CAN-05-0227
www.aacrjournals.org
9771
Cancer Res 2005; 65: (21). November 1, 2005
Research Article
Research.
on June 8, 2013. © 2005 American Association for Cancercancerres.aacrjournals.org Downloaded from
normal cells or only in neoplastic cells; and (c) if so, what the
specific mechanisms are. Therefore, this study assesses the effects
of SAHA, an HDAC inhibitor, on Cx43 expression and apoptosis in
normal and neoplastically transformed cells, from the view of
cancer prevention and cancer chemotherapy, along with the
underlying molecular mechanisms.
Materials and Methods
Cells. HPMC was harvested from the omental tissues of three consenting
patients who had undergone elective abdominal surgery. As described
previously, the cells were isolat ed and cultured in M 199 medium,
supplemented with
L-glutamine, 10% FCS (Intergen, Co., Purchase, NY),
penicillin, and streptomycin. All experiments were done using the initial
primary culture or the third-passage cells. A cell line previously derived
from WB-F344 rat liver epithelial cells was also used in this study (24).
WB-ras cells are a neoplastically transformed line originating from infection
of WB-F344 rat liver epithelial cells with retrovirus (raszip6) containing viral
Ha-ras and the neomycin-resistant gene (25). WB-ras cells were cultured in
MEM medium, supplemented with
L-glutamine, sodium pyruvate, essential
amino acid, nonessential amino acid, MEM -vitamin solution, 7% FCS
(Intergen), penicillin, and streptomycin.
Drugs and chemicals. SAHA was kindly provided by Aton Pharma, Inc.
(Tarrytown, NY). Trichostatin-A, DMSO, and bovine serum albumin (BSA)
were purchased from Sigma Chemical Co. (St. Louis, MO). Trichostatin-A
and SAHA were prepared in a 100 mmol/L stock solution in DMSO and
stored at 20jC.
Experimental design. Cells were seeded at a density of 1.0
10
4
/cm
2
in
growth medium. After confluence was reached, SAHA or trichostatin-A was
added and the culture was continued, whereas DMSO was used as solvent
control. The incubation times and the co ncentrations of SAHA or
trichostatin-A used were based on the results of earlier studies (5–7,
26–28). Cells in the present study were incubated for 48 hours at 37jC with
50, 200, 800, and 2,000 nmol/L SAHA or trichostatin-A. These cells were then
used for cell proliferation and apoptosis assays. Measurements of gap
junctional intercellular communication and assessment of Cx43 protein and
acetylated histones H3 and H4 were done by Western blotting and
immunocytochemistry, along with mRNA quantitative analyses and chro-
matin immunoprecipitation assays. The p21
WAF1
protein levels were also
assessed.
Analysis of cell growth and cell cycle. To assess the effect of SAHA on
cell proliferation, viable cells were stained with a tetrazolium salt, 4-[3-(4-
iodophe nyl) -2 -(4 -nit roph eny l)-2H -5-tetrazolio]-1,3-benzene disulfon ate
(WST-1, Dojindo Laboratories, Kumamoto, Japan; ref. 29). In the present
experiments, HPMC was seeded at a density of 5.0
10
3
per well in a
96-well plate. After culture for 24 hours, the cells were exposed to the medium
containing SAHA or DMSO. SAHA was added to basal medium at final
concentrations of 50, 200, 800, and 2,000 nmol/L; staining was done after
24 and 48 hours. The absorbance at 450 nmol/L (with reference at 650 nmol/L)
was measured with microtiter plate spectrophotometer (EXPERT 98, ASYS
HITEC GmbH, Linz, Austria). The results are expressed as the ratios of viable
treated cells compared with the untreated control sample (arbitrary 1 unit).
For cell cycle analysis, cells were trypsinized, slowly resuspended in 70%
ethanol in PBS at 4jC for 5 minutes, washed in PBS, and incubated for
30 minutes in PBS containing 0.05 mg/mL propidium iodide (Sigma), and
1 mg/mL RNaseI (Sigma). The cell suspension was then analyzed on flow
cytometry (BD Biosciences, San Jose, CA).
Assessment of apoptosis by Annexin V/propidium iodide staining.
Cells were stained with FITC-labeled Annexin V for exposure of
phosphatidylserine on the cell surface as an indicator of apoptosis using
a FACScan flow cytometer, following the instructions of the manufacturer
(BD Biosciences). Briefly, SAHA- or trichostatin-A–treated cells (5
10
5
-10
10
5
) for 24 and 48 hours were collected by centrifugation at 3,500
g
for 2 minutes and washed with 500 AL of PBS with 1% FCS thrice. The
washed cells were resuspended in 180 AL PBS with 1% FCS and 0.5 AL
FITC-labeled Annexin V and 1 AL propidium iodide, from MEBCYTO
Apoptosis kit (MBL, Nagoya, Japan), were added to the cell suspension.
After reaction for 5 minutes at room temperature, 10,000 cells were
analyzed with FACScan. Obtained data were processed to the quadrant
population analysis, using CellQuest software (BD Biosciences). The living
cell population was determined as cells that were negative for both
Annexin V and propidium iodide (distributed in the lower left of
quadrant). The results are expressed as the percentage of living cell
numbers.
Fluorescence recover y after photobleaching assay for gap junctional
intercellular communication. The procedure was a modified version of
the standard method for measuring gap junctional intercellular commu-
nication by quantitative fluorescence recovery after photobleaching (30, 31).
Assays were done using an ACAS Ultima laser cytometer (Meridian
Instruments, Inc., Okemos, MI). After bleaching of randomly selected cells
with a microlaser beam, the rate of transfer of 5,6-carboxyfluorescein
diacetate (Molecular Probes, Inc., Eugene, OR) from the adjacent labeled
cells back into bleached cells was calculated. Recovery of fluorescence was
examined after 0.5 minute and the recovery rate was calculated as
percentage per minute (i.e., the percentage of photobleached fluorescence).
The recover y rate was corrected for the loss of fluorescence measured in
unbleached cells, and results are expressed as the ratio (mean F SD) of
recovery rate relative to that of untreated control cells.
Extraction of Cx43 RNA. C ells were grown in 6 cm dishes and were
prepared as described previously. In brief, after 48 hours of incubation, the
cells were trypsinized and suspended in M199 medium containing 10% FCS
or MEM containing 7% FCS. After cells were washed once with PBS, 100 AL
RNAlater (Ambion, Austin, TX) was added to pellets, which were then
stored in a freezer until use. Total RNA was isolated from cells by using
QIAshredder and RNeasy Mini kits (Qiagen, Inc., Chatsworth, CA). The
initial strand of cDNA was synthesized from 500 ng of RNA extracts in a
volume of 20 AL using avian myeloblastosis virus reverse transcriptase XL
(TaKaRa, Otsu, Japan) priming with random 9-mers at 42jC for 10 minutes.
The cDNA strand was stored at 20jC until use. Expression of hCx43 and
rCx43 mRNAs was evaluated by real-time reverse transcription-PCR (RT-
PCR) based on the TaqMan method. In brief, PCR was done in an ABI
PRISM 7900 sequence detector (Perkin-Elmer/Applied Biosystems, Foster
City, CA) in a final volume of 20 AL. The PCR mixture contained 10 mmol/L
Tris-HCl buffer (pH 8.3; Perkin-Elmer/Applied Biosystems), 50 mmol/L KCl,
1.5 mmol/L MgCl
2
, 0.2 mmol/L deoxynucleotide triphosphate mixture, 0.5
units of AmpliTaq Gold (Perkin-Elmer/Applied Biosystems), 0.2 Amol/L
primers, and probe. The primer and probe sequences for gene amplification
were as follows: (a) hCx43, 5-GGAAAGAGCGACCCTTACCAT-3 (forward
primer), 5-AGGAGCAGCCATTGAAATAAGCATA-3 (reverse primer), and
5-CTGAGCCCTGCC AAAGA-3 (probe); ( b) glyceraldehyde-3-phosphate
dehydrogenase (GAPDH): the housekeeping gene, 5-AATTCCATGG-
CACCGTCAA-3 ( forward primer), 5-CCAGCATCGCCCCACTT-3 (reverse
primer), and 5-CC ATCACCATCTTCCAGGAGCGA GA-3 (probe); (c) rCx43;
5-ATCAGCATCCTCTTC AAGTCTGTCT-3 ( for ward primer), 5-CAGG-
GATCTCTCTTGCAGGTGTA-3 (reverse pr imer), and 5-CCTGCTCATC-
CAGTGGT-3 (probe). The TaqMan probes carried a 5-FAM reporter label,
and 3V minor groove binder and nonfluorescence quencher groups were
synthesized by Applied Biosystems. The determination of rGAPDH used the
TaqMan rodent GAPDH control reagents (Applied Biosystems). The
AmpliTaq Gold enzyme was activated by heating for 10 minutes at 95jC
and all genes were amplified by a first step of heating for 15 seconds at 95jC
followed by 1 minute at 60jC for 50 cycles.
Quantification for Cx43 messenger RNA. For the construction of
standard curves of positive controls, the total RNA of HPMC was reverse-
transcribed into cDNA and serially diluted in water in 5 or 6 log steps to
give 4-fold serial dilutions of cDNA from f100 ng to 100 pg. This cDNA
serial dilution was prepared once for all examinations done in this study
and stored at 20jC. The coefficient of linear regression (r) for each
standard curve was calculated. When the cycle threshold value of a sample
was substituted in the formula for each standard curve, the relative
concentration of hCx43, GAPDH, rCx43,orrGAPDH could be calculated. To
normalize for differences in the amount of total RNA added to each reaction
mixture, GAPDH was selected as an endogenous RNA control. The data
Cancer Research
Cancer Res 2005; 65: (21). November 1, 2005
9772
www.aacrjournals.org
Research.
on June 8, 2013. © 2005 American Association for Cancercancerres.aacrjournals.org Downloaded from
represent the average expression of target genes: expression relative to
GAPDH F SD from three independent cultures.
Immunoblotting. Cells were grown to confluence in 6 cm dishes and
were cultured with SAHA or DMSO. At the end of the given treatment
period, the monolayers were rinsed thrice with ice-cold PBS and disposed of
according to the extraction method. Nuclear extracts: Trypsinized cells were
washed in PBS and resuspended in cell lysis buffer of Nuclear/Cytosol
Fractionation Kit (BioVision, Inc., Mountain View, CA) and cells were then
treated according to the protocol of the manufacturer. Whole cell samples:
Lysates were prepared with ice-cold lysis buffer containing 20 mmol/L TBS
(pH 7.5); 1% Triton X-100; 150 mmol/L NaCl; and 1 mmol/L each of EDTA,
EGTA, h-glycerophosphate, Na
3
VO
4
, and phenylmethylsulfonyl fluoride,
2.5 mmol/L sodium PPi, and 1 Ag/mL leupeptin. The lysates were then
sonicated. The samples were diluted 1:4 in water, and their protein
concentrations were determined using detergent-compatible protein assay
(Bio-Rad Corp., Richmond, CA). Samples (30 Ag for Cx43, 15 Ag for histones
and p21
WAF1
) of protein were then dissolved in Laemmli sample buffer,
separated on 12.5 ( for Cx43) and 15% polyacrylamide gels ( for acetylated
histones H3/H4 and p21
WAF1
), and transferred to polyvinylidene difluoride
(PVDF) membranes (Bio-Rad). As an internal control to determine whether
equal amounts of protein had been loaded on to the gel, the PVDF
membranes were stripped and reprobed with anti–a-tubulin (T5168, Sigma)
mouse monoclonal antibody (p21
WAF1
and Cx43). After being washed with
distilled water, the membranes were scanned with a flathead scanner, and
total band density as amount of loaded protein was analyzed by NIH Image.
The Cx43, acetylated histones H3/H4, or p21
WAF1
contents of the various
samples were determined by incubating them with anti-Cx43 monoclonal
antibody (diluted 1:2,000; Chemicon International, Inc., Temecula, CA),
antiacetylated hi stone H3 or H4 antibo dy (dilut ed 1:1,000; Upstate
Biotechnology, Lake Placid, NY), and anti-p21
WAF1
protein monoclonal
antibody (F-5; Santa Cruz Biotechnology, Inc., Santa Cruz, CA). Next, a
horseradish peroxidase–conjugated secondary antibody (diluted 1:2,000;
Amersham Co., Arlington Heights, IL) and an enhanced chemiluminescence
detection reagent (Renaissance Western blot chemiluminescence reagent;
NEN Life Science Products, Inc., Boston, MA) were added. The average
control value was assigned an arbitrary value of 1 unit, and relative band
intensities were standardized to this arbitrary unit. Exposed films were
scanned using a flathead scanner, and band density was quantified by NIH
Image.
Indirect immunofluorescence and confocal microscopy. HPMC and
WB-ras cells were cultured as described previously. The cells were plated on
a Lab-Tek Chamber Slide (Nalge Nunc Int., Naperville, IL) before culture
with SAHA or DMSO. The cells were then washed twice in PBS and fixed in
95% methanol/5% acetic acid for 1 minute at room temperature before
being washed and permeabilized thrice with 0.1% Triton X-100–PBS (PBST),
and then incubated in 5% BSA for 60 minutes. After this, slides were
incubated overnight at 4jC in anti-Cx43 monoclonal antibody (Chemicon)
at a 1:400 dilution, and antiacetylated histone H3 polyclonal antibody at a
1:200 dilution (Upstate Biotechnology). Next, the cells were washed thrice
with PBST and incubated in Alexa 546–conjugated goat anti-mouse
antibody and Alexa 488–conjugated goat anti-rabbit antibody (Molecular
Probes) at a dilution of 1:500 for 1 hour, in dark conditions. The slides were
then washed thrice in PBST and once in PBS before being mounted in Gel/
Mount (Biomeda, Corp., Foster City, CA). Finally, the cells were examined by
Zeiss LSM 510 laser-scanning confocal microscope (Carl Zeiss International,
Jena, Germany).
Chromatin immunoprecipitation assay. HPMC was plated at a
density of 2
10
6
cells/6 cm dish and incubated overnight at 37jC with
5% CO
2
. The next day, cells were cultured with SAHA (2,000 nmol/L) for 0,
2, or 24 hours. Chromatin immunoprecipitation assay was done according
to the protocol of the manufacturer (32). DNA extracted from both
Figure 1. SAHA-induced growth suppression occurred only at high
concentrations, and SAHA induced neither morphologic changes nor apoptosis
even with accumulation of acetylated histones in HPMC. A1, SAHA time
course and dose response in HPMC. Viable cell number was analyzed by WST-1
assay. Measurement at each time point was done in quadruplet. Points, mean;
bars, SD. A2, phase-contrast micrographs. HPMC and WB-ras cells were
cultured on Lab-Tek chamber slides with (b and d) or without (a and c ) SAHA
(2,000 nmol/L) for 48 hours. Bar, 100 Am. B, Western blot analysis of acetylated
histones H3 and H4 in HPMC. Histones were isolated by nuclear extraction
as described in Materials and Methods from the cells cultured for indicated hours
and with indicated concentrations of SAHA (B1). Acetylation was detected by
using antiacetylated H3 and H4 antibodies. Lane C, untreated HPMC or WB ras
cells (control).
SAHA Up-regulates Cx43 Expression
www.aacrjournals.org
9773
Cancer Res 2005; 65: (21). November 1, 2005
Research.
on June 8, 2013. © 2005 American Association for Cancercancerres.aacrjournals.org Downloaded from
immunoprecipitation steps was purified by phenol/chloroform extraction
and ethanol precipitation, and analyzed by real-time RT-PCR. The same
Cx43 primers and probe for the real-time RT-PCR analysis were used to
carry out real-time PCR of Cx43 DNA with samples obtained from
chromatin immunoprecipitation experiments. The amplification and
detection procedures were identical to the real-time RT-PCR analysis.
Statistical analysis. Data were analyzed using Statview II software
(Apple Computer, Inc., Cupertino, CA). The two-tailed unpaired t test was
used in comparing SAHA-treated cultures with control cultures; differ-
ences were considered significant at P < 0.05. Results are expressed as the
mean F SD.
Results
Suberoylanilide hydroxamic acid inhibits human peritoneal
mesothelial cell growth without inducing morphologic
changes. Figure 1A1 shows the results of the WST-1 assay of
viable cell numbers. In preliminary experiments, WST-1 staining of
HPMC (i.e., absorbance at 450 nm) was found to increase linearly
with the number of viable cells from 1
10
3
to 1
10
5
per well in a
96-well plate (data not shown). SAHA, at 800 and 2,000 nmol/L,
seemed to suppress cell proliferation of HPMC when compared
with the cells incubated in the untreated control, but this was not
associated with any loss of cell viability as determined by trypan
blue exclusion (data not shown). Phase-contrast micrographs of
control confluent HPMC revealed uniform monolayers of polygonal
cells that clearly exhibited contact inhibition (Fig. 1A2, a);
SAHA (2,000 nmol/L) did not change morphology of the HPMC
even after 48 hours (Fig. 1A2, b). On the other hand, WB-ras cells
revealed spindle-shaped morphologies and loss of contact inhibi-
tion (Fig. 1A2, c), and some of these cells became rounded with
detached from the dishes (Fig. 1A2, d).
Suberoylanilide hydroxamic acid time and dose dependently
accelerates acetylation of histones H3 and H4. We next
determined the level of histone acetylation at each time point
after culture with SAHA. Samples were collected from nuclear
fractions of the cells cultured with SAHA (2,000 nmol/L) for 2, 4, 9,
24, and 48 hours, or with various concentrations (50, 200, 800, and
2,000 nmol/L) of SAHA for 48 hours. Western blot analysis showed
that levels of acetylated histones H3 and H4 in untreated HPMC
were low, and that accumulation of both acetylated histones
Figure 2. A, SAHA induced apoptosis in WB ras cells but not in HPMC. Cells
were stained with FITC labeled Annexin V and propidium iodide after treatment
with trichostatin-A or SAHA. The living cell population was defined as cells
that were negative for both Annexin V and propidium iodide, being expressed as
the percentage of cell numbers distributed in each quadrant. Results are means
of at least three experiments; P values show significance levels compared
with control (C ). Columns, mean percentage of living cells in HPMC
(gray, treated with trichostatin-A; white, SAHA) or WB-ras cells (dark gray,
trichostatin-A; black, SAHA). B, SAHA induced p21
WAF1
protein in HPMC.
HPMC was cultured with SAHA (2,000 nmol/L) for the indicated hours; lane C,
untreated HPMC. Protein extracts (15 Ag) were prepared and resolved on
15% SDS gels; p21
WAF1
protein was detected with the mouse monoclonal
anti-p21
WAF1
antibody (F-5); the membrane was stripped and reprobed with
a-tubulin as a loading control.
Figure 3. A, typical digitized fluorescence images on fluorescence recovery
after photobleaching and plots of fluorescence recovery after photobleaching are
shown. After culture with 2,000 nmol/L SAHA for 48 hours, HPMC was labeled
with 5,6-carboxyfluorescein diacetate. Suitable fields of cells were identified
using a
40 objective lens. Each field was scanned to generate a digital image
of fluorescence (Prebleach). After the initial scan, selected cells were
photobleached (0 minute, 1-6 ). Sequential scans were then carried out at
15-second intervals to detect the recovery of fluorescence in bleached cells
(0.5 minute, 1-6 ). Images were digitally recorded for analysis. Several
unbleached cells were also monitored to provide control data (7). Typical plots of
fluorescence recovery after photobleaching are shown (percentage prebleach
versus time). An upward slope indicates the recovery of fluorescence. The
percentage recovery of fluorescence over time was determined for each cell, and
the data were corrected for background loss of fluorescence in one area (7 ).
Untreated cells were used as the control. B, dose-course analyses of the effect
of SAHA or trichostatin-A on gap junctional intercellular communication in
HPMC. Gap junctional intercellular communication was estimated by
fluorescence recovery after photobleaching assay in the cells cultured with
SAHA or trichostatin-A. Results are expressed as the relative recovery rate (RR).
The value from an untreated sample of HPMC (C, control) was taken as a unit to
determine fold increase after culturing with SAHA or trichostatin-A (this scale
is used for WB-ras cells for comparison). Results are means of at least three
experiments; P values show significance levels compared with the control.
Columns, relative recovery rate in the HPMC (gray, treated with trichostatin-A;
white, SAHA) or WB-ras cells (dark gray, trichostatin-A; black, SAHA).
Cancer Research
Cancer Res 2005; 65: (21). November 1, 2005
9774
www.aacrjournals.org
Research.
on June 8, 2013. © 2005 American Association for Cancercancerres.aacrjournals.org Downloaded from
occurred at 2 hours after SAHA addition. This accumulation
continued for 48 hours (Fig. 1B1). Incubation for 48 hours with
SAHA resulted in accumulation of acetylated histones, which
reached a peak at 800 nmol/L and was sustained at 2,000 nmol/L
(Fig. 1B1). In contrast, histone H3 was weakly acetylated in
untreated WB-ras cells. Treatment of WB-ras cells with SAHA
resulted in accumulated acetylated histones H3 and H4, which
reached a peak at 2,000 nmol/L (Fig. 1B2).
Suberoylanilide hydroxamic acid induces a poptosis in
WB-ras cells, but not in human peritoneal mesothelial cells.
Analyses of the cell cycle and apoptosis, using propidium iodide and
Annexin V/propidium iodide, respectively, were done at 24 and 48
hours after culturing confluent cells with SAHA or trichostatin-A.
SAHA exerted minimal effects on cell cycle progression in HPMC.
Treatment for 24 hours with SAHA reduced the S-phase fraction
(8.4% control versus 2.6% SAHA 2,000 nmol/L) but did not
significantly alter the G
0
-G
1
and G
2
-M populations, whereas no
subdiploid (apoptotic) population was detected. Treatment of
HPMC with 50 to 2,000 nmol/L SAHA did not cause apoptotic cell
death or reduce the living cell population in contrast to trichostatin-
A, which dose-dependently induced apoptosis at >200 nmol/L. Both
SAHA and trichostatin-A induced apoptotic cell death in WB-ras
cells, although trichostatin-A showed greater potency (Fig. 2A).
Suberoylanilide hydroxamic acid induces transient expres-
sion of p21
WAF1
. The eff ect of SAHA on p21
WAF1
protein levels was
examined by Western blot analysis. HPMC was cultured with and
without SAHA for 2, 4, 9, 24, and 48 hours. After culturing with
SAHA, p21
WAF1
protein levels slightly increased at 2 hours, reached
a peak at 9 hours, and decreased to control level after 48 hours
treatment (Fig. 2B).
Suberoylanilide hydroxamic acid enhances gap junctional
intercellular communication in human peritoneal mesothelial
cell and WB-ras cells. Figure 3A shows typical digitized images
obtained by the fluorescence recovery after photobleaching assay.
After photobleaching, sequential scans detected the recovery of
fluorescence in the bleached cells: The dye was transferred to
photobleached cells through gap junctional intercellular commu-
nication from surrounding nonbleached cells. Recovery of fluores-
cence after photobleaching was much more rapid in HPMC
cultured with SAHA (Fig. 3A, SAHA) than in untreated cells (Fig. 3A,
control). SAHA was more efficient than trichostatin-A in enhancing
the recovery rate in HPMC in a concentration-dependent manner.
In WB-ras cells, both SAHA and trichostatin-A treatments also
increased the recovery rate. Although their recovery levels were
much lower, their enhancing rates relative to the control were no
less than those in HPMC (Fig. 3B).
Suberoylanilide hydroxamic acid increases phosphorylated
isoforms of Cx43. Western blotting was carried out to determine
whether gap junctional intercellular communication activity was
related to total Cx43 protein level and/or to the extent of Cx43
phosphorylation. Three forms of Cx43 immunoreactive protein
(M
r
41,000-43,000) were obser ved in all samples in HPMC and
nontransformed WB-F344 cells, as reported in previous papers
(13, 14, 33, 34): A faster migrating band (P
0
) and two slower
migrating adjacent bands (two phosphorylated forms, P
1
and P
2
;
Figure 4. SAHA induced Cx43 protein in HPMC and WB-ras cells. HPMC and
WB-ras cells were cultured with or without SAHA for 48 hours at indicated
concentrations. A, Western blot analysis of Cx43 protein expression. Protein
extracts from whole cells were prepared and resolved (30 Ag) on 12.5% SDS/
PAGE. Cx43 protein was detected by using mouse monoclonal antibody.
WB-F344 (10 Ag) cells were used as a positive control of Cx43 and the
membrane was then stripped and reprobed with a-tubulin as a loading control.
B, densitometric analysis of Cx43 protein bands in blotting membrane. The value
from an untreated sample of HPMC (C, control) was taken as a unit to determine
fold increase after culturing with SAHA. Columns, fold increase of Cx43
protein in HPMC (white ) or WB-ras cells (black ). C, intracellular localization of
Cx43 and acetylated histone H3 protein was detected by immunofluorescence
microscopy using monoclonal antibodies. Red spots, Cx43; green spots,
acetylated histone H3. Images were acquired by confocal microscopy. HPMC:
a to e, WB-ras cells; f to j, a (f), control; b (g), c (h), d (i), and e (j) with 50, 200,
800, 2,000 nmol/L SAHA, respectively. Bars,20Am(a-e); 10 Am(f-j).
SAHA Up-regulates Cx43 Expression
www.aacrjournals.org
9775
Cancer Res 2005; 65: (21). November 1, 2005
Research.
on June 8, 2013. © 2005 American Association for Cancercancerres.aacrjournals.org Downloaded from
Fig. 4A). Densitometric analysis of the results for HPMC showed
that SAHA, at all concentrations, induced a significant dose-
dependent increase in P
1
+P
2
(active form of Cx43) and P
0
+P
1
+P
2
(total Cx43), compared with control cells; the increase of P
0
with
increased SAHA was less significant, compared with that of P
1
+P
2
.
As a result, (P
1
+P
2
)/P
0
was increased by the treatment. In
untreated WB-ras cells, P
0
was predominant, and the active forms
(P
1
+P
2
) were minor. SAHA also induced an increase in active and
total Cx43 protein in WB-ras cells, showing a peak at 800 nmol/L
SAHA, although the ratio of (P
1
+P
2
)/P
0
was very low compared
with that in HPMC (Fig. 4B).
The localization of Cx43 protein and acetylated histone H3 was
then examined by indirect immunofluorescence cytochemistry.
Figure 4C shows immunostaining of the cells for Cx43 (red) and
acetylated histone H3 (green) after 48-hour incubation with or
without SAHA in HPMC (a-e) or WB-ras cells (f-j). The negative
control, in which mouse or rabbit IgG was substituted for the
primary antibodies, showed no staining (data not shown). Control
cells showed that a few bright red spots (indicating Cx43 labeling)
were dominant in cytoplasm rather than at the areas of
intercellular contact. Incubation of HPMC with SAHA caused an
increase in the number and size of the labeled regions, resulting in
the cells displaying linear or dotted labeling along the membrane
between cells, in contrast to control cells where a few positive spots
were observed in cytoplasm. Although WB-ras cells showed altered
immunostaining patterns in the same fashion as HPMC after
treatment with SAHA, immunostaining was weaker for Cx43,
displaying fewer spots in a nonlinear pattern along the membrane.
The fluorescent levels of acetylated histone H3 seemed more
prominent and concentrated in the nuclei in SAHA-treated HPMC
and WB-ras cells compared with those in untreated cells.
Suberoylanilide hydroxamic acid induces a higher level of
Cx43 messenger RNA expression in human peritoneal meso-
thelial cell than in WB-ras cells. Cx43 mRNA levels, measured by
real-time RT-PCR, also increased in both HPMC and WB-ras cells
cultured with SAHA in a time-dependent manner. Cx43 mRNA in
HPMC increased 3-fold over that of control cells after 48 hours
culture with SAHA (Fig. 5A). Subsequently, we analyzed the Cx43
mRNA levels, at various SAHA concentrations in HPMC as well as
in WB-ras cells. Cx43 mRNA levels in HPMC and WB-ras cells after
48 hours treatment with various concentrations of SAHA revealed
dose-dependent increase of Cx43 mRNA, which is much more
remarkable in HPMC (3-fold increase at 2,000 nmol/L) than in WB-
ras cells (1.3-fold increase at 2,000 nmol/L; Fig. 5B).
Suberoylanilide hydroxamic acid increases acetylated his-
tones in chromatin fragments associated with Cx43 gene.
Chromatin immunoprecipitation analysis was used to study the
mechanism of SAHA-induced expression of Cx43. Chromatin
fragments from HPMC cultured with SAHA for 2 and 24 hours
were immuno precipitated with antibodies against acetylated
histones H3 and H4. DNA from the immunoprecipitates was
isolated, and real-time PCR, using Cx43 primers, was done
(Fig. 6A): The amounts of Cx43 gene in acetylated histones H3
and H4 increased remarkably with increased hours of culture with
SAHA (Fig. 6B). This observation confirms that histone acetylation
is involved in the transcriptional regulation of Cx43 expression, and
that Cx43 gene is a selective target for SAHA.
Figure 5. Real-time RT-PCR analysis of Cx43 mRNA expression in HPMC
and WB-ras cells. A, HPMC was cultured with 2,000 nmol/L SAHA for the
indicated hours. B, HPMC and WB-ras cells were cultured with the indicated
concentrations of SAHA for 48 hours. The value from untreated control of HPMC
was taken as a unit to determine fold increase after culturing with SAHA.
Cx43 mRNA levels were normalized by GAPDH mRNA, whose levels did not
change during culture with SAHA (data not shown). Results are means of at
least three experiments: P values show significance levels compared with
control (C ). Columns, fold increase of Cx43 mRNA in HPMC (white) or WB-ras
cells (black ).
Figure 6. SAHA-induced accumulation of acetylated histones H3 and H4 in
the chromatin fragments associated with Cx43 gene. Soluble chromatin
from HPMC cultured with 2,000 nmol/L SAHA for 2 or 24 hours was
immunoprecipitated with the antibodies against acetylated histone H3/H4. PCR
primers used for Cx43 mRNA were also used to amplify the DNA isolated from
immunoprecipitated chromatin as described in Materials and Methods. A, the
diagrams of real-time PCR analysis of the Cx43 gene indicate that HPMC
cultured with SAHA for 2 or 24 hours showed higher amplification levels when
compared with untreated control cells. B, the relative amounts of DNA contained
in acetylated histones were quantified by real-time PCR analysis. The value from
an untreated control (C ) was taken as a unit to determine fold increase.
Cancer Research
Cancer Res 2005; 65: (21). November 1, 2005
9776
www.aacrjournals.org
Research.
on June 8, 2013. © 2005 American Association for Cancercancerres.aacrjournals.org Downloaded from
Discussion
In this study, we showed that low concentrations (50-2,000
nmol/L) of SAHA enhanced gap junctional intercellular commu-
nication in normal HPMC via Cx43 gene–associated histone
acetylation without incurring apoptosis, whereas the same SAHA
treatment of tumorigenic WB-ras cells induced apoptosis along
with an increase of gap junctional intercellular communication.
When we used WB-vector control cells (WB-neo), 50-2,000 nmol/L
SAHA induced no apoptosis in these cells as it was the case in
HPMC (data not shown), implying little difference in response to
SAHA between rat and human nonmalignant cells. We also showed
that SAHA-induced Cx43 gene expression could be ascribed to
histone H3/H4 acetylation. Our findings are the first demonstration
of the efficacy of SAHA as an inhibitor of HDAC in nonmalignant
cells to induce the transcriptional activation of the Cx43 gene
through histone acetylation. Furthermore, we showed that SAHA
induced apoptosis in ras-transformed cells at a low concentration
despite a smaller increase in Cx43 mRNA and protein than in the
case of HPMC.
Micromolar concentrations of SAHA have been shown to induce
growth arrest and/or apoptosis in various transformed cells; the
precise mechanism involved has been discussed with regard to
variable transformed cells but not well defined (27, 35, 36). There
seem to be two types of tumor cells based on their inability to have
functional gap junctional intercellular communication: those whose
connexin genes are not transcribed (37, 38) and those whose
transcribed connexins have been rendered dysfunctional by a
number of mechanisms, including posttranslational modification of
connexin proteins by various activated oncogenes (18). Thus, one
might expect to find difference s in response t o SAHA and
trichostatin-A between normal cells that express connexins and
tumor cells that express either very low levels of connexins or
dysfunctional connexins. In confluent HPMC, nanomolar concen-
trations of SAHA generated a dose-dependent increase of Cx43
mRNA and protein, whereas SAHA induced neither cell cycling
arrest nor apoptosis. On the other hand, trichostatin-A induced
apoptosis at a concentration (200 nmol/L) that did not increase
recovery rate. Because we observed that histone H3 and H4
acetylation was also pronounced in cells treated with nanomolar
SAHA, it seems unlikely that this difference mirrors the potency of
the two HDAC inhibitors.
The cell cycle checkpoint gene p21
WAF1
was most commonly
induced in various transformed cells cultured with SAHA (39)
through histone acetylation (6, 40). In HPMC, p21
WAF1
level was
elevated soon after the addition of SAHA and reverted to control
level in 48 hours: This time course profile did not parallel the
change in Cx43 mRNA levels. Sodium butyrate, an HDAC inhibitor,
has been shown to induce G
1
arrest and pRb dephosphorylation in
3T3 cells lacking p21
WAF1
(41). Richon et al. (6) found that the level
of p21
WAF1
mRNA decreased within 24 hours after the addition of
SAHA similar to our observation in HPMC. In contrast, chromatin
immunoprecipitation analysis showed that Cx43 gene-associated
histone acetylation increased with increasing hours of culture
with SAHA, similar to SAHA-induced expression of Cx43 mRNA,
indicating a more probable cause-effect between the two.
Differential response between HPMC and WB-ras cells was noted
for SAHA-induced apoptosis, although histones H3/H4 acetylation
was observed in both cells treated with nanomolar SAHA. Previous
reports have shown that mitochondria played a central role during
HDAC inhibitor–mediated apoptotic response (42–45). The cellular
pathways via mitochondria and other apoptotic genes, targeted by
SAHA, might differ between normal and malignant cells. Our
results indicate that SAHA might suppress cancer cell growth
through up-regulation of gap junctional intercellular communica-
tion, but does not cause damage in surrounding normal cells.
The role of SAHA in enhancing gap junctional intercellular
communication in nonmalignant cells without serious adverse
effects could be a beneficial for cancer prevention. Zhang et al.
(46) recently reported that Cx43 displayed gap junction–indepen-
dent growth inhibition of various tumor cells. Another connexin
gene (i.e., Cx26) has been previously shown to be a tumor
suppressor gene (47). Therefore, up-regulation of Cx43 or other
connexin genes could suppress tumor growth or progression by
gap junction–dependent mechanism. Gap junctional intercellular
communication is essential for maintaining homeostatic balance
and normal differentiation through the modulation of cell growth
and arrest. It will also be important to elucidate the role of
histone acetylation and related proteins in the transcriptional
regulation of Cx43 and other connexin genes in selective tissues
or cells. Future study will likely provide some answers to these
questions.
Acknowledgments
Received 1/24/2005; revised 7/29/2005; accepted 8/19/2005.
Grant support: Baxter Limited Renal Division (T. Ogawa and T. Hayashi); Grants-
in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science
and Technology of Japan; Ministry of Health and Welfare of Japan; Smoking Research
Foundation (K. Nakachi); and National Institute of Environmental Health Sciences
grant 5 P42 ES04911 (J.E. Trosko).
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Aton Pharma, Inc., a wholly owned subsidiary of Merck & Co., Inc., for
providing SAHA.
References
1. Marks PA, Jiang X. Histone deacetylase inhibitors in
programmed cell death and cancer therapy. C ell Cycle
2005;4:549–51.
2. Papeleu P, Vanhaecke T, Elaut G, et al. Differential
effects of histone deacetylase inhibitors in tumor and
normal cells—what is the toxicological relevance? Crit
Rev Toxicol 2005;35:363–78.
3. Marks PA, Richon VM, Breslow R, Rifkind RA. Histone
deacetylase inhibitors as new cancer drugs. Curr Opin
Oncol 2001;13:477–83.
4. Melnick A, Licht JD. Histone deacetylases as thera-
peutic targets in hematologic malignancies. Curr Opin
Hematol 2002;9:322–32.
5. Richon VM, Emiliani S, Verdin E, et al. A class of
hybrid polar inducers of transformed cell differentiation
inhibits histone deacetylases. Proc Natl Acad Sci U S A
1998;95:3003–7.
6. Richon VM, Sandhoff TW, Rifkind RA, Marks PA.
Histone deacetylase inhibitor selectively induces
p21WAF1 expression and gene-associated histone acet-
ylation. Proc Natl Acad Sci U S A 2000;97:10014–9.
7. Butler LM, Agus DB, Scher HI, et al. Suberoylanilide
hydroxamic acid, an inhibitor of histone deacetylase,
suppresses the growth of prostate cancer cells in vitro
and in vivo . Cancer Res 2000;60:5165–70.
8. Grunstein M. Histone acetylation in chromatin
structure and transcription. Nature 1997;389:349–52.
9. Turner BM. Decoding the nucleosome. Cell 1993;75:5–8.
10. Van Lint C, Emiliani S, Verdin E. The expression of a
small fraction of cellular genes is changed in response to
histone hyperacetylation. Gene Expr 1996;5:245–53.
11. Sambuce tti LC, Fischer DD, Zabludoff S, et al.
Histone deacetylase inhibition selectively alters the
activity and expression of cell cycle proteins leading to
specific chromatin acetylation and antiproliferative
effects. J Biol Chem 1999;274:34940–7.
12. Asklund T, Appelskog IB, Ammerpohl O, Ekstrom TJ,
Almqvist PM. Histone deacetylase inhibitor 4-phenyl-
butyrate modulates glial fibrillary acidic protein and
connexin 43 expression, and enhances gap-junction
communication, in human glioblastoma cells. Eur J
Cancer 2004;40:1073–81.
13. Ogawa T, Hayashi T, Kyoizumi S, Ito T, Trosko JE,
SAHA Up-regulates Cx43 Expression
www.aacrjournals.org
9777
Cancer Res 2005; 65: (21). November 1, 2005
Research.
on June 8, 2013. © 2005 American Association for Cancercancerres.aacrjournals.org Downloaded from
Yorioka N. Up-regulation of gap junctional intercellular
communication by hex amethylene bisacetamide in
cultured human peritoneal mesothelial cells. Lab Invest
1999;79:1511–20.
14. Ogawa T, Hayashi T, Yorioka N, Kyoizumi S,
Trosko JE. Hexamethylene bisacetamide protects peri-
toneal mesothelial cells from glucose. Kidney Int 2001;
60:996–1008.
15. Andreeff M, Stone R, Michaeli J, et al. Hexamethylene
bisacetamide in myelodysplastic syndrome and acute
myelogenous leukemia: a phase II clinical trial with a
differentiation-inducing agent. Blood 1992;80:2604–9.
16. Loewenstein WR. The cell-to-cell channel of gap
junctions. Cell 1987;48:725–6.
17. Loewenstein WR. Junctional intercellular communi-
cation and the control of growth. Biochim Biophys Acta
1979;560:1–65.
18. Trosko JE, Ruch RJ. Cell-cell communication in
carcinogenesis. Front Biosci 1998;3:208–36.
19. Yamasaki H, Naus CC. Role of connexin genes in
growth control. Carcinogenesis 1996;17:1199–213.
20. Bruzzone R, White TW, Paul DL. Connections with
connexins: the molecular basis of direct intercellular
signaling. Eur J Biochem 1996;238:1–27.
21. Evans WH, Martin PE. Gap junctions: structure and
function (review). Mol Membr Biol 2002;19:121–36.
22. Trosko JE, Chang CC, Madhukar BV, Klaunig JE.
Chemical, oncogene and growth factor inhibition
gap junctional intercellular communication: an integra-
tive hypothesis of carcinogenesis. Pathobiology 1990;58:
265–78.
23. Klaunig JE, Ruch RJ. Role of inhibition of intercellular
communication in carcinogenesis. Lab Invest 1990;62:
135–46.
24. Tsao MS, Smith JD, Nelson KG, Grisham JW. A
diploid epithelial cell line from normal adult rat liver
with phenotypic properties of ‘‘oval’’ cells. Exp Cell Res
1984;154:38–52.
25. De Feijter AW, Ray JS, Weghorst CM, et al.
Infection of rat liver epithelial cells with v-Ha-ras:
correlation between oncogene expression, gap junc-
tional communication, and tumorigenicity. Mol Carci-
nog 1990;3:54–67.
26. Munster PN, Troso-Sandoval T, Rosen N, Rifkind R,
Marks PA, Richon VM . The histone deacetylase
inhibitor suberoylanilide hydroxamic acid induces
differentiation of human breast cancer cells. Cancer
Res 2001;61:8492–7.
27. Richon VM, Webb Y, Merger R, et al. Second
generation hybrid polar compounds are potent inducers
of transformed cell differentiation. Proc Natl Acad Sci
U S A 1996;93:5705–8.
28. Leoni F, Zaliani A, Bertolini G, et al. The antitumor
histone deacetylase inhibitor suberoylanilide hydroxa-
mic acid exhibits antiinflammatory properties via sup-
pression of cytokines. Proc Natl Acad Sci U S A 2002;
99:2995–3000.
29. Ishiyama M, Tominaga H, Shiga M, Sasamoto K,
Ohkura Y, Ueno K. A combined assay of cell viability and
in vitro cyt otoxicity with a highly water-soluble
tetrazolium salt, neutral red and crystal violet. Biol
Pharm Bull 1996;19:1518–20.
30. Trosko JE, Chang CC, Wilson MR, Upham B, Hayashi
T, Wade M. Gap junctions and the regulation of cellular
functions of stem cells during development and
differentiation. Methods 2000;20:245–64.
31. Wade MH, Trosko JE, Schindler M. A fluorescence
photobleaching assay of gap junction-mediated com-
munication between human cells. Science 1986;232:
525–8.
32. Luo RX, Postigo AA, Dean DC. Rb interacts with
histone deacetylase to repress transcription. Cell 1998;
92:463–73.
33. de Feijter AW, Matesic DF, Ruch RJ, Guan X, Chang
CC, Trosko JE. Localization and fu nction of the
connexin 43 gap-junction protein in normal and various
oncogene-expressing rat liver epithelial cells. Mol
Carcinog 1996;16:203–12.
34. Esinduy CB, Chang CC, Trosko JE, Ruch RJ. In vitro
growth inhibition of neoplastically transformed cells by
non-transformed cells: requirement for gap junctional
intercellular communication. Carcinogenesis 1995;16:
915–21.
35. Chen H, Lin RJ, Xie W, Wilpitz D, Evans RM.
Regulation of hormone-induced histone hyperacetyla-
tion and gene activation via acetylation of an acetylase.
Cell 1999;98:675–86.
36. Vrana JA, Decker RH, Johnson CR, et al. Induction of
apoptosis in U937 human leukemia cells by suberoylani-
lide hydroxamic acid (SAHA) proceeds through pathways
that are regulated by Bcl-2/Bcl-XL, c-Jun, and p21CIP1,
but independent of p53. Oncogene 1999;18:7016–25.
37. Momiyama M, Omori Y, Ishizaki Y, et al. Connexin26-
mediated gap junctional communication reverses the
malignant phenotype of MCF-7 breast cancer cells.
Cancer Sci 2003;94:501–7.
38. King TJ, Fukushima LH, Donlon TA, Hieber AD,
Shimabukuro KA, Bertram JS. Correlation between
growth control, neoplastic potential and endogenous
connexin43 expression in HeLa cell lines: implica-
tions for tumor progression. Carcinogenesis 2000;21:
311–5.
39. Marks PA. The mechanism of the anti-tumor activity
of the histone deacetylase inhibitor, suberoylanilide
hydroxamic acid (SAHA). Cell Cycle 2004;3:534–5.
40. Bunz F, Dutriaux A, Lengauer C, et al. Requirement
for p53 and p21 to sustain G
2
arrest after DNA damage.
Science 1998;282:1497–501.
41. Vaziri C, Stice L, Faller DV. Butyrate-induced G
1
arrest results from p21-independent disruption of
retinoblastoma protein-mediated signals. Cell Growth
Differ 1998;9:465–74.
42. Zhu WG, Lakshmanan RR, Beal MD, Otterson GA.
DNA methyltransferase inhibition enhances apoptosis
induced by histone deacetylase inhibitors. Cancer Res
2001;61:1327–33.
43. Ruefli AA, Ausserlechner MJ, Bernhard D, et al. The
histone deacetylase inhibitor and chemotherapeutic
agent suberoylanilide hydroxamic acid (SAHA) induces
a cell-death pathway characterized by cleavage of Bid
and production of reactive oxygen species. Proc Natl
Acad Sci U S A 2001;98:10833–8.
44. Medina V, Edmonds B, Young GP, James R, Appleton
S, Zalewski PD. Induction of caspase-3 protease activity
and apoptosis by butyrate and trichostatin A (inhibitors
of histone deacetylase): dependence on protein synthe-
sis and synergy with a mitochondrial/cytochrome
c-dependent pathway. Cancer Res 1997;57:3697–707.
45. Herold C, Ganslmayer M, Ocker M, et al. The histone-
deacetylase inhibitor trichostatin A blocks proliferation
and triggers apoptotic programs in hepatoma cells.
J Hepatol 2002;36:233–40.
46. Zhang YW, Kaneda M, Morita I. The gap junction-
independent tumor-suppressing effect of connexin 43.
J Biol Chem 2003;278:44852–6.
47. Lee SW, Tomasetto C, Sager R. Positive selection of
candidate tumor-suppressor genes by subtractive hy-
bridization. Proc Natl Acad Sci U S A 1991;88:2825–9.
Cancer Research
Cancer Res 2005; 65: (21). November 1, 2005
9778
www.aacrjournals.org
Research.
on June 8, 2013. © 2005 American Association for Cancercancerres.aacrjournals.org Downloaded from
