Content uploaded by Thomas Walker
Author content
All content in this area was uploaded by Thomas Walker on Aug 28, 2018
Content may be subject to copyright.
Medical and Veterinary Entomology (2015) 29, 448–452 doi: 10.1111/mve.12137
SHORT COMMUNICATION
Tick abundances in South London parks and the
potential risk for Lyme borreliosis to the general public
C. NELSON, S. BANKS, C. L. JEFFRIES, T. WALKER and
J. G. LOGAN
Department of Disease Control, London School of Hygiene & Tropical Medicine, London, U.K.
Abstract. Tick abundances and prevalences of infection with Borrelia burgdorferi
sensu lato, the causative agent of Lyme disease, were investigated in four South London
parks. A total of 360 transects were sampled using three methods of collection (blanket,
leggings and ags) simultaneously. No ticks were found on Wimbledon Common or
at Hampton Court, but 1118 Ixodes ricinus (Ixodida: Ixodidae) ticks were collected at
Richmond and Bushy Parks. At Richmond Park, lower canopy humidity [odds ratio
(OR) 0.94; P=0.005], increased mat depth (OR 1.15; P<0.001) and increased soil
moisture (OR 1.40; P=0.001) predicted the presence of I. ricinus, and increased sward
height [incidence rate ratio (IRR) 1.01; P=0.006] and decreased ground temperature
(IRR 0.90; P=0.009) predicted increased abundance. At Bushy Park, thicker mat depth
predicted tick presence (OR 1.17; P=0.006) and increasing temperature correlated with
tick absence (OR 0.57; P=0.023). A total of 279 ticks were screened for the presence
of B. burgdorferi using quantitative polymerase chain reaction. Point prevalences of 0%
for larvae (n=78), 2.14% for nymphs (n=174) and 0% for adult ticks (n=7) related
to an acarological risk of 0.22 infected ticks per 40 m transect in Richmond Park. The
abundance of ticks and the acarological risk, particularly at Richmond Park, highlight
the need for appropriate communication of the associated risk to the general public
frequenting these recreational areas.
Key words. Borrelia burgdorferi, acarological risk, methods of tick sampling, point
prevalence, quantitative PCR, tick habitat type and variables.
The most important pathogens transmitted by ticks in the U.K.
belong to the Borrelia burgdorferi sensu lato group and cause
the disease Lyme borreliosis (Lyme disease) (Burgdorfer et al.,
1982). In England and Wales, the incidence of infection is now
1.73 per 100 000 population (2011) and may potentially be
3.53–5.34 per 100 000 according to the level of under-reporting
(Public Health England, 2013). In the U.K., Ixodes ricinus is
the most abundant and widespread tick species. For example,
81% (n=4172) of ticks submitted to Public Health England’s
enhanced tick surveillance programme, set up in 2005, were
identied as I. ricinus (Jameson & Medlock, 2011). Across
Europe, the mean prevalence of B. burgdorferi infection in
I. ricinus ticks is 13.7% (range: 0–49.1%) (Rauter & Hartung,
2005); however, U.K. studies have found lower prevalences. A
Correspondence: Dr James G. Logan, Department of Disease Control, London School of Hygiene & Tropical Medicine, Room 443, Keppel St.,
London WC1E 7HT, U.K. Tel.: +44 (0)20 7927 2008; Fax:+44 (0)20 7637 2918; E-mail: james.logan@lshtm.ac.uk
recent study by Dobson et al. (2011), conducted in Richmond
Park, London, estimated prevalences of infection to be 2.8% in
nymphs and 5.9% in adult ticks.
Sampling of I. ricinus is conducted using an approach known
as the ‘blanket method’, which involves slowly dragging a piece
of material across an area of vegetation (Milne, 1943). Blanket
dragging has some limitations. For example, some ticks are lost
by the end of a transect as they are scraped off by the vegetation
or because they recognize the blanket as a non-host, decreasing
uniformity of the vegetation surface reduces the efciency of
the method, and blankets also lose efciency after repeated
use (Milne, 1943). However, alternatives such as agging are
associated with further problems as there is a greater degree
of variation between researchers because of the difculty of
448 © 2015 The Royal Entomological Society
Tick abundances in South London parks 449
controlling the sweep length and pressure applied (Milne, 1943).
The blanket dragging method has been combined with heel
ags attached to cotton trousers for a more accurate measure of
tick abundance (Dobson et al., 2011). The simultaneous use of
different methods reduces the likelihood that false conclusions
will be drawn as a result of the biases associated with any
particular method (Schulze et al., 1997). The aim of this study
was to compare tick abundances in different vegetation types,
using various tick collection methods simultaneously, in four
South London parks. Abundances of ticks collected using
the different methods were correlated with different habitat
variables for Bushy and Richmond Parks, and the prevalence of
B. burgdorferi s.l. in the ticks caught was determined.
Sampling was conducted over a period of 1 month, between
24 June and 22 July 2013. This time period was chosen to
coincide with the end of the peak in tick abundance and
beginning of the peak in tourist and summer recreational usage
of the parks. Field studies were conducted at four sites in
southwest London: Bushy Park (0∘19–21′W, 51 ∘24–25′N),
Hampton Court Palace (0∘18–19′W, 51 ∘23–24′N), Richmond
Park (0∘15–17′W, 51 ∘25–27′N) and Wimbledon and Putney
Common (0∘13–15′W, 51∘25–26′N). Each of the four parks
included four habitat types. Sampling was performed six times
(i.e. on 6 days) at each park over the course of 24 days. The
order in which a park was sampled was randomized. During a
single day at a park, each of the four habitat types was sampled
once in a random order. Thus six collections per habitat type
were conducted at each of the four parks. The four habitat types
sampled within a park were spaced at least 10 m apart.
In order to compare tick abundances between sites, a broad
denition of habitat type was used. Four differing habitat types
were dened: (a) open grassland; (b) open vegetation (any
area of vegetation separated by at least 10 m from woodland
or shrubbery); (c) bordering woodland (any vegetation lying
immediately adjacent to and within 5 m of the edge of an area of
woodland), and (d) woodland (mature woodland with specimens
of at least 5 m in height).
Sixteen drags of 10 m (four for each habitat type) were
performed. The order in which habitat types were sampled was
assigned using a Latin square design. Ticks were collected as
per Dobson et al. (2011), using a blanket, leggings (75 cm long
and 60 cm wide when opened and spread at) and heel ags
(25 ×25 cm) (Fig. 1). The blanket apparatus was amended so
that the investigator held a pole at shoulder height, parallel to
the ground and perpendicular to the body, which was attached
using garden twine to another pole that had been woven into
the hem of the blanket in order to maintain pressure on the
vegetation. The leggings were adapted by the addition of Velcro
down each side to facilitate quick removal. All three stages of
tick were collected from the legs in the eld (in line with the
ags and blanket). Beige 50/50 cotton and wool mix material
was used. This material was selected because its light colouring
made it easier to spot any ticks and its brous texture facilitated
tick attachment. Ticks were removed from the blanket, ags and
leggings at the end of each drag using forceps and stored in
Eppendorf tubes in 70% ethanol.
A random subsample of 279 ticks was selected for anal-
ysis to detect the prevalence of B. burgdorferi s.l. in ticks
from each habitat type. All adults and a maximum of 10
Fig. 1. Tick sampling using three methods simultaneously, including a
blanket drag, ags and leggings.
larvae and 28 nymphs were selected at random. DNA was
extracted from individual ticks using the DNeasy 96 Blood
and Tissue Kit (Qiagen GmbH, Hilden, Germany). Ticks were
homogenized by piercing with pipette tips rather than cutting
with a scalpel in view of their size. The pipette serves as
a smaller tool with which to break apart the tick structure,
whereas the scalpel called for in the original protocol would
have been too large and inefcient for the size of the tick.
Repeatedly piercing the body of the tick in an Eppendorf tube
allowed for homogenization of smaller specimens. Tick DNA
extracts were screened for the presence of B. burgdorferi s.l.
using quantitative polymerase chain reaction (qPCR). Primers
used for qPCR targeted a 139-bp sequence of the conserved
region of the Borrelia 16s rRNA gene (5′-AGGATATAGTT
AGAGATAATTATTCCCCGTTTGGGGTCTATATACAGGTG
CTGCATGGTTGTACCCTTGTTATCTGTTACCAGCATGTA
ATGG-3′) (O’Rourke et al., 2013) (primers: p16Swt-fwd 5′-GG
ATATAGTTAGAGATAATTATTCCCCGTTTG-3′and p16
Swtrev 5′-CATTACATGCTGGTAACAGATAACAAGG-3′).
Polymerase chain reactions (PCR) were prepared using 5 μLof
FastStart SYBR Green Master mix (Roche Diagnostics, Basel,
Switzerland), a nal concentration of 1 μ of each primer,
1μL of PCR-grade water and 2 μL of template DNA, to a nal
reaction volume of 10 μL. Prepared reactions were run on a
Roche LightCycler 96 System for 10 min at 95 ∘C, followed by
40 cycles of 95 ∘C for 10 s, 60 ∘C for 10 s and 72 ∘C for 10 s.
Amplication was followed by a dissociation curve (95 ∘Cfor
10 s, 65 ∘C for 60 s and 97 ∘C for 1 s) to ensure the correct target
sequence was being amplied. The PCR results were anal-
ysed using the LightCycler 96 software (Roche Diagnostics).
A positive control was generated from DNA extracted from
B. burgdorferi cells (Kirkegaard & Perry Laboratories, Inc.,
Gaithersburg, MD, U.S.A.) using the DNeasy Blood & Tissue
Kit (Qiagen GmbH). A concentrated and diluted (1 : 1000)
Borrelia-positive DNA extract in addition to no-template con-
trols (NTCs) were included on each qPCR run. The inter-assay
Cq values produced by the Borrelia-positive control DNA
extracts were comparable and all tick DNA extracts were
repeated to conrm positive amplication of the Borrelia 16s
rRNA gene. Absolute quantication of tick DNA extracts was
© 2015 The Royal Entomological Society, Medical and Veterinary Entomology,29, 448–452
450 C. Nelson et al.
performed using a synthetic oligonucleotide of the target gene
sequence serially diluted to produce 107to 103copies/μL.
Wilcoxon signed-rank tests were employed to determine
the relationships between sampling method (blanket, leggings
and ags) and tick abundance (per m2). Multivariate analyses
were conducted between variables. A logistic regression model
was employed to analyse the presence/absence of ticks and
a negative binomial model was used to analyse abundance.
For each statistical model, only covariates (including canopy
humidity, temperature of the canopy, temperature of the ground,
mat depth, soil moisture, sward height) signicant at the 10%
level (when considered bivariately) were initially included.
A backward elimination strategy was then employed, as per
Medlock et al. (2012), to leave only covariates signicant at
the 5% level. The acarological risk (R) was calculated using
the formula R =1−(e−(𝜇in+𝜇ia )),whereμin and μia are the
mean numbers of infected nymphs and adults, respectively.
Condence intervals (95% CIs) for R were calculated using a
bootstrap method. All data analyses were performed in
IC Version 12.1 for Windows (StataCorp LP, College Station,
TX, U.S.A.) and Microsoft Ofce Excel 2007 (Microsoft Corp.,
Redmond, WA, U.S.A.). Additional help with was gained
from the Institute for Digital Research and Education (2013).
Over the course of the study, 360 transects were sampled; these
included a total of 96 at each site (four habitats, four repeats)
except Hampton Court, at which 72 transects (three habitats,
four repeats) were sampled. No ticks were found at Wimbledon
Common or Hampton Court. In total, 1118 I. ricinus ticks were
collected. Of these, 1109 ticks (532 larvae, 568 nymphs, six
males, three females) were collected at Richmond Park and nine
ticks (nymphs) were collected at Bushy Park. Of the 67 transects
positive for ticks, Richmond Park accounted for 58 (86.6%). Of
96 transects undertaken at Richmond Park, 58 (60.4%) resulted
in tick collection, whereas only nine (9.4%) transects sampled
at Bushy Park did so.
Sampling with blankets obtained 124 larvae, 188 nymphs and
two adults. Collections on leggings amounted to 258 larvae,
295 nymphs and seven adults. Flags caught 150 larvae, 85
nymphs and no adults. After conversion into densities (Table 1),
Wilcoxon signed-rank tests (between life stages) within each
sampling method yielded signicant differences (P<0.01),
showing that ags caught signicantly more larvae than nymphs
and signicantly more nymphs than adults. Of the ticks caught
by blankets or leggings, nymphs were sampled in greater abun-
dance than larvae, and larvae in greater abundance than adults.
The greatest number of ticks were collected on leggings,
which accounted for 560 (50.0%) ticks of all life stages collected
at Richmond Park, compared with 314 collected on blankets and
235 on ags (Table 1). Sampling with blankets collected the
lowest density of ticks (P<0.0001). The blanket caught fewer
ticks in habitats associated with taller vegetation (woodland and
open vegetation), whereas the leggings caught consistently high
proportions of ticks, which increased further in the woodland
habitat, and the ags caught a greater proportion of the total ticks
in the open vegetation habitat (Table 1).
Logistic regression on the presence/absence of questing
ticks revealed signicant interactions between lower canopy
humidity [odds ratio (OR) 0.94, 95% CI 0.91–0.98; P=0.005],
increased mat depth (OR 1.15, 95% CI 1.07–1.25; P<0.001)
and increased soil moisture (OR 1.40, 95% CI 1.15–1.70;
P=0.001) at Richmond Park. At Bushy Park, an increased
temperature of the canopy was associated with a reduced
presence of questing nymphs (OR 0.57, 95% CI 0.35–0.92;
P=0.023), whereas a thicker mat depth was associated with
an increased presence of questing nymphs (OR 1.17, 95% CI
1.05–1.30; P=0.006). In terms of the abundance of ticks at
Richmond Park, the consequent signicant covariates included
increased soil moisture [incidence rate ratio (IRR) 1.24, 95% CI
1.14–1.36; P<0.001], increased mat depth (IRR 1.03, 95% CI
1.01–1.06; P=0.012) increased sward height (IRR 1.01, 95%
CI 1.00–1.02; P=0.006), decreased temperature of the ground
(IRR 0.90, 95% CI 0.84–0.97; P=0.009) and, as in the bivariate
analysis, decreased humidity of the canopy (IRR 0.96, 95% CI
0.94–0.98; P=0.0067). Abundance, as a variable, was not con-
sidered for Bushy Park as a maximum of one tick per transect
was collected. All other statistically important variables from the
bivariate analysis were not signicant when using multivariate
analysis, which suggests potential previous confounding.
A total of 279 ticks were screened for the presence of
B. burgdorferi s.l. These included seven nymphs collected at
Bushy Park, 259 ticks collected at Richmond Park (78 lar-
vae, 174 nymphs, ve males, two females), four nymphs and
additional adults (four males, one female) collected during a
preliminary study at Richmond, and four nymphs extracted
from the researcher’s legs at Richmond Park. Six ticks, from
Richmond Park, provided evidence of B. burgdorferi s.l. infec-
tion. Five nymphs were collected in vegetation bordering
Tab l e 1 . Numbers and densities of ticks collected using different methods of sampling at Richmond Park.
Blanket Leggings Flags
Life stage
Total
ticks, n
Ticks
collected, %
Density,
ticks/m2
(A and LE)
Ticks
collected, %
Density,
ticks/m2
(A)
Density,
ticks/m2
(LE)
Ticks
collected,
%
Density,
ticks/m2
(A)
Density,
ticks/m2
(LE)
Total
ticks, %
Larvae 532 23.31% 0.1722 48.50% 0.2986 0.5972 28.20% 1.2500 0.3125 100%
Nymphs 568 33.10% 0.2611 51.94% 0.3414 0.6829 14.96% 0.7083 0.1771 100%
Males 6 16.67% 0.0014 83.33% 0.0058 0.0116 0% 0.0000 0.0000 100%
Females 3 33.33% 0.0014 66.67% 0.0023 0.0046 0% 0.0000 0.0000 100%
Total density 0.4361 0.6481 1.2963 1.9583 0.4896
A, area method calculation; LE, leading edge method.
© 2015 The Royal Entomological Society, Medical and Veterinary Entomology,29, 448–452
Tick abundances in South London parks 451
woodland and one nymph was found in open vegetation; all of
these were collected by agging. Point prevalence at Richmond
Park was 2.14% for nymphs. None of the ticks extracted from
the blanket or from Bushy Park were infected. At Richmond
Park, the probability of collecting at least one infected tick (the
acarological risk) in a 40-m transect (four 10-m transects per
habitat type, per day) was calculated to be 0.22.
Comparisons between sampling methods indicated that each
approach signicantly targets a particular life stage. Blankets
and leggings are associated with nymphs, and ags with larvae.
This is attributable to the questing height of the particular life
stage; larvae quest nearer to the ground and represent the greatest
proportion of ticks collected by ags. Nymphs and adults quest
higher in the vegetation and hence come into contact with the
blanket on the surface of the vegetation and with the sampler’s
legs (Mejlon & Jaenson, 1997). Three important conclusions can
be drawn from these comparisons among sampling methods.
Firstly, the blanket collection consistently showed the lowest
tick density, which implies that this may be the least appropriate
of the three methods, particularly in contexts in which sward
height is high and the blanket simply rides across the surface.
Secondly, the simultaneous use of the different methods ensures
that all levels of the vegetation are included in the sampling.
Thirdly, the use of leggings provides a more accurate measure of
the tick hazard for humans and shows a consistently high density
of ticks and also the greatest absolute numbers of ticks (Dobson
et al., 2011).
This study also conrms the importance of abiotic and biotic
factors to tick abundance. The signicance of increasing mat
depth in determining I. ricinus presence and increasing abun-
dance, at Bushy and Richmond Parks, is not surprising. An
increased mat depth gives refuge from desiccation, provides
a more suitable habitat for small mammalian hosts and also
provides a degree of protection from predation (Randolph,
2004). Similarly, the association between increased tempera-
ture of the canopy and absence of questing ticks at Bushy
Park is likely as ticks must seek refuge from desiccation
(Randolph, 2004).
Whereas the association between tick abundance and soil
moisture was expected (Medlock et al., 2008), that with lowered
relative humidity (RH) was surprising. However, the thick
mat layer overlying the highly moist soil at Richmond may
provide an environment in which I. ricinus ticks can more easily
restore their water balance and thus gain the ability to be
active when humidity is lower than the level ideal for their
survival (80%).
A trend towards decreasing abundance, as the temperature
rises, should be expected as all temperatures in this study
were above that required for questing. The trend reects the
reduction in water balance at higher temperatures. With respect
to sward height, lower swards provide less cover to protect the
underlying mat layer from desiccation. Therefore, reduced tick
abundance at lower swards simply reects the reduced suitability
of conditions.
A greater than expected abundance of ticks was found in
the bordering woodland habitat type. This may be because the
habitat type provides an ideal balance between cover and forage
for I. ricinus hosts, despite providing less suitable conditions
than woodland (Tack et al., 2012). Although light intensity,
elevation and cloud cover have been shown previously to be
associated with tick abundance (Greeneld, 2011), no such
associations emerged in this study.
It is interesting that no ticks were sampled from Hampton
Court or Wimbledon Common. Although this study cannot
provide conclusive evidence that I. ricinus is not present at either
of these locations, given the relatively short sampling period,
abundances and consequential risk for tick bites and associated
disease are probably lower than at Richmond. Hampton Court
would be expected to have fewer, if any, ticks because it
is characterized by lower soil moisture, mat depth and RH,
and higher temperatures and wind speed (directly reducing
RH). Therefore, although suitable hosts (i.e. deer) are present,
this unsuitable combination of abiotic factors means Hampton
Court cannot sustain a high tick population at the time of
year in which ticks can be sampled by the methods used in
this study. The conditions were highly suitable for I. ricinus
survival at Wimbledon, however, there are fewer large hosts at
that location.
The point prevalence of infection of 2.14% for nymphs at
Richmond Park, and 0% for larvae and adults at Richmond,
and for nymphs at Bushy Park, represents a low risk to users
of the parks (Estrada-Pena et al., 2011). This is conrmed via
translation into an acarological risk of 0.22 infected ticks per
40-m transect. Importantly, ve of six infected ticks were found
in the area most frequented by the general public, represented
by bordering woodland. From observations during the sampling
period, and by others previously (Dobson et al., 2011), members
of the general public tend to frequent areas of open grassland,
although some people seek shade in areas bordering woodland.
One tick was found in open vegetation, which represented the
least populated area. Hence, although the risk for infection is
low as a result of overall low prevalence and the presence of
fewer ticks, infected ticks are likely to be found in areas that
are highly frequented and thus the potential risk to the general
public should not be overlooked.
Point prevalences for nymphs and adults were considerably
lower than expected. The prevalence of infection is usually
greater in adults than in nymphs (Rauter & Hartung, 2005).
The low point prevalence in the present study may reect the
fact that only 14 adults were collected. Similarly, based on an
expected prevalence of 2–10% in nymphs (Kurtenbach et al.,
2006), 0.2–0.9 infected ticks would be expected among the nine
nymphs collected at Bushy Park. Therefore, to nd an infection
prevalence of 0% in adult ticks at Richmond and in nymphs
at Bushy is not surprising. Work undertaken by Dobson et al.
(2011) at Richmond Park found the prevalence in nymphs to be
2.8%. The prevalence found in this study appears to be similar.
Given its high footfall and proximity to Richmond Park, tick
presence should be routinely monitored at Wimbledon Com-
mon. Despite suitable hosts for I. ricinus, the abiotic conditions
appear to be unfavourable at Hampton Court and the consequent
risk to the general public is low. At Richmond and Bushy Parks,
I. ricinus is irrefutably present and preventative measures should
be taken to avoid tick bites. The Royal Parks, which own and run
Richmond and Bushy Parks, should be encouraged to provide
leaets on the risk of Lyme borreliosis and further activities to
increase public awareness.
© 2015 The Royal Entomological Society, Medical and Veterinary Entomology,29, 448–452
452 C. Nelson et al.
Acknowledgements
The authors would like to thank Mary Oguike and Mary-Grace
Dacuma, Infectious and Tropical Diseases Faculty at the London
School of Hygiene & Tropical Medicine, for providing support
with the PCR process. The authors are also grateful to Dr Jolyon
Medlock, Public Health England, who provided advice at the
start of the project, and to Peter Haldane, Wimbledon and Putney
Commons, London, U.K., Nicholas Garbutt, Tree & Wildlife
Conservation Hampton Court Palace, Surrey, U.K., and Dr Nigel
Reeve, Head of Ecology Royal Parks, Surrey, U.K., who granted
permission to sample at the four sites used in this study.
References
Burgdorfer, W., Barbour, A.G., Hayes, S.F., Benach, J.L., Grunwaldt,
E. & Davis, J.P. (1982) Lyme disease – a tick-borne spirochetosis.
Science,216, 1317–1319.
Dobson, A.D.M., Taylor, J.L. & Randolph, S.E. (2011) Tick (Ixodes
ricinus) abundance and seasonality at recreational sites in the U.K.:
hazards in relation to ne-scale habitat types revealed by com-
plementary sampling methods. Ticks and Tick-Borne Diseases,2,
67–74.
Estrada-Pena, A., Ortega, C., Sanchez, N., Desimone, L., Sudre, B.,
Suk, J.E. & Semenza, J.C. (2011) Correlation of Borrelia burgdorferi
sensu lato prevalence in questing Ixodes ricinus ticks with specic
abiotic traits in the Western Palearctic. Applied and Environmental
Microbiology,77, 3838–3845.
Greeneld, B.P.J. (2011) Environmental Parameters Affecting Tick
(Ixodes ricinus) Distribution during the Summer Season in Rich-
mond Park, London. Bioscience Horizons/Oxford University Press,
Oxford.
Institute for Digital Research and Education (2013) Resources to
help you learn and use . University of California, Insti-
tute for Digital Research and Education, Los Angeles, CA.
http://www.ats.ucla.edu/stat/stata/ [accessed on 1 September 2013].
Jameson, L.J. & Medlock, J.M. (2011) Tick surveillance in Great
Britain. Vector-Borne and Zoonotic Diseases,11, 403–412.
Kurtenbach, K., Hanincova, K., Tsao, J.I., Margos, G., Fish, D. &
Ogden, N.H. (2006) Fundamental processes in the evolutionary
ecology of Lyme borreliosis. Nature Reviews Microbiology,4,
660–669.
Medlock, J.M., Pietzsch, M.E., Rice, N.V.P. et al. (2008) Investigation
of ecological and environmental determinants for the presence of
questing Ixodes ricinus (Acari: Ixodidae) on Gower, South Wales.
Journal of Medical Entomology,45, 314–325.
Medlock, J.M., Shuttleworth, H., Copley, V., Hansford, K.M. & Leach,
S. (2012) Woodland biodiversity management as a tool for reducing
human exposure to Ixodes ricinus ticks: a preliminary study in an
English woodland. Journal of Vector Ecology,37, 307–315.
Mejlon, H.A. & Jaenson, T.G.T. (1997) Questing behaviour of Ixodes
ricinus ticks (Acari: Ixodidae). Experimental & Applied Acarology,
21, 747–754.
Milne, A. (1943) The comparison of sheep-tick populations (Ixodes
ricinus L.). Annals of Applied Biology,80, 240–250.
O’Rourke, M., Traweger, A., Lusa, L., Stupica, D., Maraspin, V.,
Barrett, P. N., Strle, F., Livey, I. (2013) Quantitative detection of
Borrelia burgdorferi sensu lato in erythema migrans skin lesions using
internally controlled duplex real time PCR. PLoS ONE,8, e63968.
Public Health England (2013) Epidemiology of Lyme borreliosis
in the U.K. Department of Health, London, U.K. https://www.
gov.uk/government/publications/lyme-borreliosis-epidemiology/
lyme-borreliosis-epidemiology-and-surveillance [accessed on 25
August 2015].
Randolph, S.E. (2004) Tick ecology: processes and patterns behind the
epidemiological risk posed by ixodid ticks as vectors. Parasitology,
129 (Suppl.), 37–65.
Rauter, C. & Hartung, T. (2005) Prevalence of Borrelia burgdorferi
sensu lato genospecies in Ixodes ricinus ticks in Europe: a metaanal-
ysis. Applied and Environmental Microbiology,71, 7203–7216.
Schulze, T.L., Jordan, R.A. & Hung, R.W. (1997) Biases associated
with several sampling methods used to estimate abundance of Ixodes
scapularis and Amblyomma americanum (Acari: Ixodidae). Journal
of Medical Entomology,34, 615–623.
Tack, W., Madder, M., Baeten, L., Vanhellemont, M., Gruwez, R. &
Verheyen, K. (2012) Local habitat and landscape affect Ixodes ricinus
tick abundances in forests on poor, sandy soils. Forest Ecology and
Management,265, 30–36.
Accepted 14 August 2015
First published online 24 September 2015
© 2015 The Royal Entomological Society, Medical and Veterinary Entomology,29, 448–452
