Content uploaded by Tatiana Lipina
Author content
All content in this area was uploaded by Tatiana Lipina on Oct 22, 2023
Content may be subject to copyright.
Full Terms & Conditions of access and use can be found at
https://www.tandfonline.com/action/journalInformation?journalCode=iwbp20
The World Journal of Biological Psychiatry
ISSN: (Print) (Online) Journal homepage: https://www.tandfonline.com/loi/iwbp20
The habenular volume and PDE7A allelic
polymorphism in major depressive disorder:
preliminary findings
Lyubomir I. Aftanas, Elena A. Filimonova, Maksim S. Anisimenko, Darya A.
Berdyugina, Maria V. Rezakova, German G. Simutkin, Nikolay A. Bokhan,
Svetlana A. Ivanova, Konstantin V. Danilenko & Tatiana V. Lipina
To cite this article: Lyubomir I. Aftanas, Elena A. Filimonova, Maksim S. Anisimenko, Darya A.
Berdyugina, Maria V. Rezakova, German G. Simutkin, Nikolay A. Bokhan, Svetlana A. Ivanova,
Konstantin V. Danilenko & Tatiana V. Lipina (2022): The habenular volume and PDE7A allelic
polymorphism in major depressive disorder: preliminary findings, The World Journal of Biological
Psychiatry, DOI: 10.1080/15622975.2022.2086297
To link to this article: https://doi.org/10.1080/15622975.2022.2086297
Accepted author version posted online: 08
Jun 2022.
Submit your article to this journal
View related articles
View Crossmark data
The habenular volume and PDE7A allelic polymorphism in major depressive disorder:
preliminary findings
Lyubomir I. Aftanas1,2*, Elena A. Filimonova1, Maksim S. Anisimenko1, Darya A.
Berdyugina1, Maria V. Rezakova1, German G. Simutkin3, Nikolay A. Bokhan4,5, Svetlana A.
Ivanova3,5, Konstantin V. Danilenko1 & Tatiana V. Lipina1
1Institute of Neurosciences and Medicine, Novosibirsk, Russia; 2Novosibirsk State University,
Novosibirsk, Russia, 3Mental Health Research Institute, Tomsk National Research Medical
Center of the Russian Academy of Sciences, Tomsk, Russia; 4National Research Tomsk State
University, Tomsk, Russia; 5Siberian State Medical University, Tomsk, Russia.
Correspondence: Aftanas LI, Institute of Neurosciences and Medicine, Timakova 4, 630117
Novosibirsk, Russia. E-mail: liaftanas@gmail.com
Running head: habenular volume & PDE7A polymorphism in MDD
Accepted Manuscript
2
Abstract
Objectives. The habenula is a brain structure implicated in depression, yet with unknown
molecular mechanisms. Several phosphodiesterases (PDEs) have been associated with a risk
of depression. Although the role of PDE7A in the brain is unknown, it has enriched
expression in the medial habenula, suggesting that it may play a role in depression. Methods.
We analyzed: (1) habenula volume assessed by 3-T magnetic resonance imaging (MRI) in 84
patients with major depressive disorder (MDD) and 41 healthy controls; (2) frequencies of 10
single nucleotide polymorphisms (SNPs) in PDE7A gene in 235 patients and 41 controls; and
(3) both indices in 80 patients and 27 controls. The analyses considered gender, age, body
mass index and season of the MRI examination. Results. The analysis did not reveal habenula
volumetric changes in MDD patients regardless of PDE7A SNPs. However, in the combined
group, the carriers of one or more mutations among 10 SNPs in the PDE7A gene had a lower
volume of the left habenula (driven mainly by rs972362 and rs138599850 mutations) and
consequently had the reduced habenular laterality index in comparison with individuals
without PDE7A mutations. Conclusions. Our findings suggest the implication of the PDE7A
gene into mechanisms determining the habenula structure.
Key words: Major depressive disorder, healthy subjects, habenular volume, magnetic
resonance imaging (MRI), PDE7A allelic polymorphism
Accepted Manuscript
3
Introduction
Major depressive disorder (MDD) is a widespread mental disorder (Lim et al. 2018) with
its key symptoms as severely low mood and/or anhedonia (APA, 2013). It may course as a
single MD episode, recurrent or persistent (chronic) (APA, 2013). The aetiology of MDD
includes a combination of genetic and environmental factors, with its heritability of about 38-
40% (Kendler et al. 2001). The pathogenesis of depression is accompanied by maladaptive
changes in neural circuits of emotions, including the lateral prefrontal cortex, anterior
cingulated cortex, orbitofrontal cortex, amygdala, and striatum (Dai et al. 2019). Over the last
25 years accumulating studies suggest that dysfunction of the habenula and its neural network
significantly contributes to the pathophysiology of MDD (Caldecott-Hazard et al. 1988;
Sartorius et al. 2010; Hu, 2019; Loonen and Ivanova, 2019; Liu et al. 2020).
The habenula is a small structure of the epithalamus connecting neural networks of the
striatum and the limbic system to control serotonergic and monoaminergic neurotransmission
from the midbrain to the forebrain (Savitz et al. 2011). Due to its unique location, the
habenula modulates motor responses and plays a key role in motivational behaviour and
participates in decision-making processes (Hikosaka et al. 2008, 2010). The negative stimuli,
prediction of aversion per se as well as frustration, i.e. stimuli which trigger scanty reward
than its expected, activate the habenula (Matsumoto and Hikosaka, 2007, 2009), whereas its
functioning is suppressed in anticipation of rewarding outcomes.
A post-mortem clinical study revealed a 24% reduction of the right medial habenular
volume and ~20% decrease in the volume of the right lateral habenula in patients with
unipolar/bipolar depression (Ranft et al. 2010), accompanied by a pronounced loss of neurons
by 30-40% as compared with the control group. The development of magnetic resonance
Accepted Manuscript
4
imaging (MRI) techniques provided the possibility of non-invasive in vivo assessment of the
structural and functional changes of the habenular complex associated with pathobiology of
affective disorders (Lawson et al. 2013; Strotmann et al. 2013; Hetu et al. 2016). Savitz with
colleagues (2011) demonstrated, for the first time, a decrease in habenular volume in patients
with affective disorders assessed by MRI. In MDD patients, they detected the reduced
habenula in women, not in men, supporting a significant contribution of gender to the
pathological mechanisms.
Nevertheless, some studies did not find any difference between MDD patients and healthy
volunteers (Lawson et al. 2017; Schmidt et al. 2017), while others reported an increased size
of the habenula, which correlated with the severity of clinical symptoms (Liu et al. 2017).
Interestingly, a recent study (Schmidt et al. 2017) showed such correlation in newly
diagnosed depressive patients rather than in the group with chronic forms of depression.
Moreover, an increased volume of white matter was detected in MDD patients, especially in
women with a first episode of depression (Carceller-Sidreu et al. 2015). Functional MRI
(fMRI) analysis identified higher resting-state functional connectivity between the left
habenula and left parahippocampal gyrus, the right amygdala, and the right precentral and
postcentral gyri in MDD patients with a history of suicidal ideation (Ambrosi et al. 2019).
Therefore, there is an urgent need to further study structural and functional correlates of the
habenula and its neural connections with the expression of clinical symptoms of depression.
It is highly desirable to discover the molecular-cellular regulations of the habenular-
associated mechanisms of depression. The first insight came from a quantitative proteomic
screen, where calcium/calmodulin-dependent protein kinase type II (βCaMKII) was
overexpressed in the lateral habenula of congenitally learned helpless rats, and antidepressants
corrected this overexpression (Li et al., 2013). CaMKIIβ fundamentally modulates
intracellular homeostasis via its association with phosphodiesterases (PDEs) (Mika et al.,
Accepted Manuscript
5
2015). Hu with colleagues proposed (2019) that the increased activity of the CaMKIIβ (Li et
al., 2013) regulate the synaptic trafficking of AMPA receptors at the excitatory synapses (Ma
et al., 2015), thereby increasing the habenular synaptic plasticity, and as result, triggering
depression-associated symptoms.
CaMKIIβ fundamentally modulates intracellular homeostasis via its association with
phosphodiesterases (PDEs) and cyclic adenosine monophosphate (cAMP)-dependent
signalling (Mika et al. 2015). Notably, several genes that encode PDEs, including PDE3,
PDE4B, PDE5, and PDE10 (Numata et al. 2009; Duarte-Silva et al. 2020), were identified as
increasing risk to develop MDD. For example, genetic mutations reducing PDE4B activity
underlie the symptoms of depression (Millar et al. 2007), caused by the increased neural
excitability in certain brain regions due to the accumulating cAMP. Notably, PDE4B is co-
localized intracellularly with PDE7, suggesting that PDE7A may play a potential role in the
pathogenesis of depression.
The PDE7 family includes two subtypes: PDE7A and PDE7B, which are encoded by two
distinct genes located on human chromosome 8 (Han et al. 1998) and chromosome 6 (Sasaki
et al. 2000), respectively. Notably, the brain distribution of PDE7A and PDE7B is different
(reviewed in Chen et al. 2021). So, PDE7A, not PDE7B, expression was detected in the
medial habenula, whereas PDE7B is mainly expressed in the caudate nucleus or substantia
nigra (Lakics et al. 2010), supporting the potential role of the PDE7A gene in the molecular
regulation of the habenula. However, the role of the PDE7A gene in the habenular-associated
mechanisms of depression was not studied yet.
The human PDE7A gene is located on human chromosome 6 (Han et al. 1998) and
includes 13 exons with 1449 bp as the total length of its coding region (according to the
reference CCDS56538.1). The PDE7A enzyme-like PDE4 and PDE8, elicits cAMP-specific
hydrolytic activity and consists of two main domains: regulatory and catalytic (Chen et al.
Accepted Manuscript
6
2021). Preclinical studies demonstrated that the selective PDE7 pharmacological inhibitors
showed beneficial effects on cognitive behaviour and neurological phenotypes using animal
models of Parkinson’s disease (Morales-Garcia et al. 2020), Alzheimer’s disease (Perez-
Gonzalez et al. 2013), or multiple sclerosis (Redondo et al. 2012). Dual GSK3/PDE7inhibitor
was able to correct amphetamine-induced schizophrenia-like behaviour in mice (Lipina et al.
2013).
Therefore, we hypothesized that PDE7A might be a novel molecular regulator of the
habenular neural activity and molecular-cellular target in MDD. The pathogenic mutation(s)
in the PDE7A gene may affect PDE7A enzymatic activity thereby increasing intracellular
cAMP level and facilitating neuronal activity of the habenula. In turn, the chronically
increased neuronal excitability of the habenula might be followed by the increased oxidative
stress and neurodegeneration (Saura et al., 2015), causing its structural changes in MDD
patients. However, PDE7A functions in the brain are largely unknown, especially related to
depression. Therefore, our study aimed to probe structural alterations of the habenula and
their potential correlations with single nucleotide polymorphisms (SNPs) in the PDE7A gene
in patients with MDD and healthy volunteers. Altogether, our preliminary findings
demonstrate the potential connection between PDE7A polymorphisms and habenular volume
in the MDD population. Hence, the combination of PDE7A genetic analysis with
neuroimaging of the habenula and its associated brain regions may improve MDD diagnostics
and ultimately lead to the generation of new antidepressants based on the modulation of
PDE7A functionality.
Accepted Manuscript
7
Methods
Subjects
The subjects for this study were hospitalized patients with moderate-to-severe depression and
healthy controls (all – of European descent) who participated in different clinical studies
performed in the Institute of Neurosciences and Medicine, Novosibirsk and Mental Health
Research Institute, Tomsk in 2009-2019. All studies were approved by local Ethics
Committees, and the signed informed consent included permission from the subjects to make
a genetic analysis of their DNA samples. The patients were diagnosed to have a major
depressive disorder (MDD), non-seasonal, according to DSM-IV or DSM-5 criteria (they are
almost identical; APA, 2013). The diagnosis in some of those who contacted a psychiatrist
longitudinally might be modified (e.g., single episode MDD may turn out to be with time a
recurrent or persisted MDD).
Exclusion criteria for both patients and controls in those studies included the presence of
severe somatic illness, addictive disorder, a history of severe head injury, gross organic brain
pathology according to MRI results, or pregnancy. An additional burden of exclusion in the
control group was a psychiatric history, including among first-line relatives.
Structural MRI
Magnetic resonance imaging MRI of the brain was performed on a GE Discovery 750w (GE
Healthcare, Germany), with a magnetic field strength of 3 Tesla. The examination included:
[a] a standard scanning protocol to exclude a serious structural pathology (T2-WI, FLAIR,
Accepted Manuscript
8
DWI); [b] T1-WI high-resolution protocol (3D SPGR in the sagittal plane) with the following
parameters: TR – 9.5 ms, TE –4.2 ms, FOV – 256 mm, Matrix – 256´256, slice thickness – 1
mm, the distance between the centres of the slices – 0, 5 mm, effective voxel size 0.5´0.5´0.5
mm. The total scanning duration was 20-25 minutes per person.
Automatic basic segmentation of structural T1 images was performed using the FreeSurfer
v5.3 package. Habenula segmentation was performed manually according to the well-
accepted algorithm as previously described (Lawson et al. 2013). Habenula boundaries were
selected in the ITK-SNAP program (Yushkevich et al. 2016), slice-by-slice in the frontal
plane (with subsequent correction of the boundaries in the axial and sagittal planes and
volume calculation), taking into account anatomical landmarks. The habenular nuclei were
visualized over 4-9 slices anterior to the last slice, on which the posterior commissure was
determined. The medial and lateral habenular nuclei were indistinguishable from each other
and were segmented as a single block.
The following variables were intended for the statistical analysis: [1] total brain volume,
[2] absolute and normalized on brain size volumes of the left habenula, right habenula, and
their sum, [3] habenula laterality index (%) calculated as 100 (R – L) / (R + L), where R and
L are the volumes of the left and right habenula, respectively.
Genetic analysis of PDE7A
DNA extraction was performed from the blood samples using Extract DNA Blood (Evrogen,
Russia). The concentration of extracted DNA was assessed using a NanoDropTM 2000
Microspectrophotometer (Thermo Scientific, USA).
Amplification of PDE7A gene fragments was carried out using 20 pairs of primers
covering the entire coding part of the gene with adjacent sections of introns (20-50
Accepted Manuscript
9
nucleotides). Primers were selected using the programs AmpliseqDesigner and BLAST. The
nucleotide sequences of the primers are shown in Table S1. Twenty selected fragments were
amplified in two pools containing 10 primer pairs each.
Amplification was performed in the following steps: initial denaturation of DNA at 95ºC
for 3 minutes, then 35 cycles: 95ºC for 15 s, 60ºC for 30 s, 72ºC for 40 s. The reaction
mixture was as follows: 3 mM MgCl2, 16 mM (NH4)2SO4, 67 mM Tris HCl, pH 8.8, 400
nM of each primer, 0.32 mM each dNTP, 1 U of Taq DNA polymerase, and 5–10 ng of the
analyzed DNA sample. Amplification was performed using BIS Thermocycler (BIS-N,
Russia).
For each DNA sample, 25 μl of the two PCR reactions were combined and purified by
Agencourt AMPure XP (Beckman Coulter, USA). The resulting amplicons were ligated with
the barcodes and A/P1 adapters. A and P1 adapters were used in the additional PCR round for
the enrichment. Qubit dsDNA HS Assay kit was used for resulting fragments concentration
measurement on a Qubit 3.0 fluorimeter (Thermosphere, USA). The lengths of the fragments
were determined using a High Sensitivity DNA kit (Agilent Technologies, USA) and the
2100 Bioanalyzer (Agilent Technologies, USA). Normalized libraries were used in emulsion
PCR with the Ion PGM Hi-Q OT2 kit and sequenced on Ion Torrent PGM (with Ion PGM HI-
Q sequencing kit) according to the manufacturer's instructions.
PRINSEQ (Schmieder and Edwards, 2011) was used for quality control, filtering and
trimming the reads. All reads were mapped to the human genome reference GRCh37/hg19
using BWA-MEM v. 0.7.5 (Li and Durbin, 2009). SAM tools (Li et al. 2009) were used for
SNVs detection. Selected variants were manually examined with Integrative Genomic Viewer
(Robinson et al. 2011).
Statistical analysis
Accepted Manuscript
10
Statistical analysis of the studied variables was performed using SPSS 20.0 and StatView 5.0
software by standard methods of unpaired comparison, correlation analysis, and analysis of
соvariances (ANOVA). The normalized habenula volume was the main independent variable
of interest in the analysis. For the probability (p), allowing to consider the result as
statistically significant, the threshold p<0.05 was chosen. The mean values of the studied
variables are reported together with ± standard deviation from the mean.
Results
Habenular data
The group of patients and the group of healthy controls were 84 and 41 persons, respectively.
The characteristics of the studied groups are presented in Table 1. Most patients had a
diagnosis of recurrent depression, others – chronic or single episode depression, in equal
frequency. The most of patients (72.6%) were unmedicated (as the current use of
antidepressants was an exclusion criterion in most clinical trials they participated in). The
values of each continuous variable were normally distributed (Kolmogorov-Smirnov test, all
p’s > 0.1).
The groups were not different regardless of age, gender, body mass index (BMI), and
season of the MRI (Table 1). Division on two seasons was made based on visual inspection of
monthly distribution of habenula normalized volumes which were somewhat larger in
November-April than in May-October (50.9 ± 9.2 vs. 48.3 ± 10.5 units, N=89/36,
respectively, p=0.17, Student test). This corroborates the seasonal data on the larger
supratentorial area (to which the habenula belongs) in winter than in summer (whereas some
other brain structures change in opposite direction; Book et al. 2021).
Accepted Manuscript
11
Brain and habenula values are also presented in Table 1. They did not differ significantly
between patients and controls. The habenula laterality index did not differ significantly from
zero in both groups (p>0.11, one-sample t-test). There was a tendency towards the reduced
habenula laterality in patients compared to controls (ANOVA's F=3.2, p=0.074). Although
brain and habenula volumes did not intercorrelate, there was a trend to be significant (r=0.16,
p=0.075, N=125, Pearson test).
Of all independent variables (group, age, gender, BMI, and season) used in ANOVA, BMI
was the closest to the significance in its influence on habenular volume: greater BMI tended
to predict larger normalized habenula volumes (left, right, bilateral) (F=2.6, p=0.107; F=3.5,
p=0.066; and F=3.3, p=0.070, respectively). Habenula belongs to the thalamus-surrounding
region where the left caudate and left amygdala are also located and which sizably (and
positively) correlate with BMI (Vakli et al. 2020; Murck et al. 2021).
PDE7A data
The genetic analysis was performed on subjects of European descent. The MDD group
consisted of 235 patients, age 48.3 ± 11.7 years, including 49 males. The diagnoses were:
recurrent (N=93), chronic (N=44), and single episode (N=98) depression. The healthy control
group consisted of 41 volunteers, age 40.6 ± 8.8 years, including 20 males. Although the
groups significantly differed by age and gender, these variables could not influence the
genetic results.
NGS analysis of the entire coding part of the PDE7A gene revealed ten different allelic
variants, which are shown in Table 2. For each allele, the frequencies did not differ
significantly between the MDD patients and healthy controls (according to the 2-test) and
corresponded well to the frequencies reported by international databases (ExAC, 1000
genomes, GO-ESP, TOPMED). Furthermore, the distribution of the carriers of 0, 1, 2 or 3
Accepted Manuscript
12
mutations over the 10 studied alleles was similar in the patients and control groups:
88/120/22/5 and 15/18/6/2, respectively (p=0.50, 2-test).
Three polymorphisms – presented in rows 1, 2, and 8 (Table 2), were found only once, a
single mutation in three different patients. One of these allelic variants (chr8:66631697, line
1) was novel and maybe important since it was found not in a control subject, but a patient
(therefore, may be specific to depression) and not in the intron, but the exon region (leading to
substitution the amino acid in the encoded protein by missense G→A nucleotide substitution).
Hence, the patient (ID 0080718) carrying this SNP (chr8:66631697) was studied in more
detail. In addition to persistent depressive disorder (PDD) with a persistent major depressive
episode, she had Crohn's disease (with severe colon damage) and connective tissue dysplasia,
unspecified. Therefore, if the identified mutation is clinically related to a disease, then,
perhaps, not to mental (PDD), but somatic (autoimmune colitis or inherited connective tissue
dysplasia). Secondly, the sister and daughter of this patient agreed to give venous blood for
genetic analysis (both signed informed consent), and the genetic analysis did not detect this
mutation. Therefore, the version that the identified genetic mutation is associated with any
hereditary diseases was not evolved.
Association between habenular volume and PDE7A
The association analysis included all 80 of 84 MRI-studied patients and all 27 of 41 MRI-
studied healthy individuals in whom the genetic analysis was performed (Table 3). As in
previous analyses (Tables 1 and 2) the group values did not differ significantly for any of the
dependent variables studied, showing only a tendency towards the reduced habenula laterality
in patients compared to controls (ANOVA's F=3.5, p=0.064)
The association between PDE7A polymorphism and habenula indices could be searched by
ANOVA only for those PDE7A loci, for which the number of carriers of each of the two
Accepted Manuscript
13
allelic variants, according to the statistical requirements, was at least 6 persons – these are loci
numbered 4, 6, 9 and 10 in Table 3. The analysis revealed associations between MRI data and
two PDE7A polymorphisms: carriers of rs972362 had a smaller normalized volume of the left
habenula and the heterozygote carriers of rs138599850 tended to have smaller both left and
right habenular normalized volumes (Table 4).
Moreover, there were significant associations between the global carriage of mutation (in
any of the 10 investigated loci) and habenula indices: the carriage was associated significantly
with a smaller normalized volume of the left habenula and a shift of the laterality index
towards a preponderance of the right habenula. The associations with all 10 loci were also
significant in the sample of patients separately (ANOVA, left habenula volume F=4.7,
p=0.035; habenula laterality F=4.4, p=0.042); depression diagnosis and antidepressant intake
did not influence the polymorphism distribution. Figure 1 illustrates the differences.
Discussion
Our study, which explored relationship between the habenular volume and PDE7A
polymorphism in MDD patients in comparison with healthy controls, did not reveal any
difference between the groups in the studied variables. Irrespective of the clinical group, in
the combined sample of patients and controls, an association was found between the smaller
left habenula volume (and the consequent shift of the laterality from right to left) and PDE7A
mutation alleles, mostly driven by rs972362 and rs138599850 variants.
The habenular volumetric and functional laterality is a normal phenomenon observed in
various vertebrate species (Aizava, 2013) and documented in some human studies e.g., study
where a larger volume of the left habenula was detected post-mortem (in individuals without
cerebral illness or neuropathy; Ahumada-Galleguillos et al. 2017) or in MRI study (in both
healthy and MDD individuals; Savitz et al. 2011). A recent study using a more powerful 7-T
Accepted Manuscript
14
MRI also found a lower lateralization coefficient in MDD patients, but not in controls (Cho et
al. 2021). Another study demonstrated a larger total habenular volume in MDD patients
compared to healthy controls, and no signs of lateralization (Liu et al. 2017). In our study, the
differences between patients and controls in habenular volumes and laterality were not
significant. Four other MRI studies also failed to find a difference between patients with
unipolar depression (on a group level) and healthy controls in both habenula volumes and
laterality (Savitz et al. 2011; Carceller-Sindreu et al. 2015; Lawson et al. 2017; Schmidt et al.
2017). One reason for such inconsistency might be related to the genetic peculiarities of the
studied depressive patients, which need further clarification.
Indeed, only combined genetic and MRI analysis was able to detect significant results. The
habenular asymmetry (with the left habenula being smaller) was characteristic for subjects
carrying PDE7A mutation(s) in one or several of the following ID variants: 66631697 (newly
discovered), 66636680_66636683, 66639230, 66646997_66646998, 66647015, 66651705,
66657765, 66659835, 66691934, 66692011, – regardless the diagnostic group.
There was no difference between patients and controls in frequencies of PDE7A allelic
polymorphisms. To our best knowledge, there is no study that demonstrates the involvement
of the PDE7A-expressed phosphodiesterase in the pathogenesis of depressive disorders.
Hence, our study explored, for the first time, the potential association between habenular
volume and PDE7A polymorphisms. Surprisingly, we detected a significant effect of
rs972362 mutation on the size of the left habenula among other studied SNPs (Table 4),
which is in the intronic region of the PDE7A gene but occurred with the highest frequency in
a homozygous state (Table 3).
Given that all PDE7A SNPs were not studied before, it is important to report our findings.
However, it was impossible to perform a powerful statistical analysis for individual PDE7A
SNP due to a small number of carriers for each one. Limitations of our study include a
Accepted Manuscript
15
relatively small number of subjects in the genetic analysis (N=276, Table 2) and a weak
significance of the habenula-genetic association results (Table 4), which would not survive
after correcting for multiple comparisons. Therefore, we consider our findings to be
preliminary, where MRI data have been grouped and analyzed according to the presence of
one or any PDE7A SNP(s) in MDD patients and controls.
To our best knowledge, there is no data about the functional effects of the PDE7A genetic
variants. Hence, follow up studies are needed to assess the effects of each ten studied
mutations individually and in combinations on the PDE7A enzymatic function, cAMP-
dependent intracellular signaling, structural and functional habenular alterations assessed by
the (f)MRI in depressive and control participants. Perhaps, PDE7A allelic polymorphism(s)
could inhibit its enzymatic activity, which could increase the cAMP concentration, coupled
with habenular neural hyperactivity and as result leading to depression. The chronic activation
of the habenula could gradually lead to its neurodegeneration and as result decrease its size.
Although the genetic regulation of the habenular morphology remains largely unknown, the
recent study linked a high expression of such genes as Brn3a, Nurr1, Tac1, and Kcnip to the
size of the medial habenula based on a comparative analysis of genetic rats bred to high or
low wheel-running motivation (Grigsby et al., 2018). Given that the aetiology of MDD is a
multifactorial, where susceptible genes interact with each other and with pathogenic
environment, potential epigenetic PDE7A modifications, triggered by e.g. severe traumatic
events in childhood (Park et al., 2019) cannot be excluded. Indeed, such epigenetic alterations
were demonstrated for PDE2A and PDE3A genes coupled with upregulation of their
expression in vitro (Wu et al., 2015).
The detected asymmetric effect (left habenula was more prone to the structural changes)
could be explained by the habenular neural circuitries. Thus, the left habenula may have
stronger connections with reward/punishment brain areas than the right habenula. Indeed, the
Accepted Manuscript
16
recent clinical study using resting-state functional connectivity (RSFC) analysis, revealed the
increased RSFC strength from the left angular gyrus to left habenula in MDD patients (Gao et
al. 2021).
Conclusion
Our results demonstrated that the inclusion of the genetic analysis into clinical MRI study is
essential to improve diagnostics of depression and accumulate fundamental knowledge, which
can benefit psychiatric neuroscience. The found association between the left habenula volume
and PDE7A polymorphisms needs to be further studied.
Funding
Supported by budgetary financing to Institute of Neurosciences and Medicine in 2014-2021,
Mental Health Research Institute in 2009-2017, Russian Science Foundation grants (## 17-
15-01294, 16-15-00128).
Statement of interest
None of the authors have any conflict of interest regarding this article.
References
Ahumada-Galleguillos P, Lemus CG, Diaz E, Osorio-Reich M, Hartel S, Concha ML. Directional
asymmetry in the volume of the human habenula. Brain structure & function. 2017; 222(2):1087–
92. Epub 2016/05/09.
Aizawa H. Habenula and the asymmetric development of the vertebrate brain. Anat Sci Int. 2013
Jan;88(1):1-9.
Ambrosi E, Arciniegas DB, Curtis KN, Patriquin MA, Spalletta G, Sani G, Frueh BC, Fowler JC,
Madan A, Salas R. Resting-State Functional Connectivity of the Habenula in Mood Disorder
Patients With and Without Suicide-Related Behaviors. J Neuropsychiatry Clin Neurosci. 2019
Winter;31(1):49-56.
Accepted Manuscript
17
APA, American Psychiatric Association, 2013. DSM-5: Diagnostic and Statistical Manual of Mental
Disorders. 5th ed. American Psychiatric Press, Washington, DC, USA.
Book GA, Meda SA, Janssen R, Dager AD, Poppe A, Stevens MC, Assaf M, Glahn D, Pearlson GD.
Effects of weather and season on human brain volume. PLoS One. 2021 Mar 24;16(3):e0236303.
Caldecott-Hazard S, Mazziotta J, Phelps M. Cerebral correlates of depressed behavior in rats,
visualized using 14C-2-deoxyglucose autoradiography. J Neurosci. 1988 Jun;8(6):1951-61.
Carceller-Sindreu M, de Diego-Adelino J, Serra-Blasco M, Vives-Gilabert Y, Martin-Blanco A,
Puigde- mont D, et al. Volumetric MRI study of the habenula in first episode, recurrent and chronic
major depres- sion. Eur Neuropsychopharmacol. 2015; 25(11):2015–21. Epub 2015/09/26.
Chen Y., Wang H., Wang W-z., Wang D., Skaggs K., Zhang H-T. Phosphodiesterase 7 (PDE7): A
unique drug target for central nervous system diseases. Neuropharmacology, 2021, 196: 108694
Cho SE, Park CA, Na KS, Chung C, Ma HJ, Kang CK, Kang SG. Left-right asymmetric and smaller
right habenula volume in major depressive disorder on high-resolution 7-T magnetic resonance
imaging. PLoS One. 2021 Aug 3;16(8):e0255459.
Dai L, Zhou H, Xu X, Zuo Z. Brain structural and functional changes in patients with major
depressive disorder: a literature review. PeerJ. 2019 Nov 29;7:e8170.
Duarte-Silva E, Filho AJMC, Barichello T, Quevedo J, Macedo D, Peixoto C. Phosphodiesterase-5
inhibitors: Shedding new light on the darkness of depression? J Affect Disord. 2020 Mar
1;264:138-149.
Gao J, Li Y, Wei Q, Li X, Wang K, Tian Y, Wang J. Habenula and left angular gyrus circuit
contributes to response of electroconvulsive therapy in major depressive disorder. Brain Imaging
Behav. 2021 Oct;15(5):2246-2253.
Grigsby KB, Kelty TJ, Booth FW. Medial habenula maturational deficits associate with low
motivation for voluntary physical activity. Brain Res. 2018, 1698: 187-194
Han P, Fletcher CF, Copeland NG, Jenkins NA, Yaremko LM, Michaeli T. Assignment of the mouse
Pde7A gene to the proximal region of chromosome 3 and of the human PDE7A gene to
chromosome 8q13. Genomics. 1998 Mar 1;48(2):275-6.
Hetu S, Luo Y, Saez I, D’Ardenne K, Lohrenz T, Montague PR. Asymmetry in functional
connectivity of the human habenula revealed by high-resolution cardiac-gated resting state
imaging. Hum Brain Mapp. 2016; 37(7):2602–15. Epub 2016/04/03.
Hikosaka O, Sesack SR, Lecourtier L, Shepard PD. Habenula: crossroad between the basal ganglia
and the limbic system. J Neurosci. 2008 Nov 12;28(46):11825-9.
Hikosaka, O. The habenula: from stress evasion to value-based decision-making / O.Hikosaka // Nat
Rev Neurosci . – 2010. –Vol.11(7). – P.503-513.
Hu H. Advances in Molecular and Circuitry Mechanisms of Depressive Disorder-A Focus on Lateral
Habenula. Adv Exp Med Biol. 2019;1180:135-146.
Accepted Manuscript
18
Kendler KS, Gardner CO, Neale MC, Prescott CA. Genetic risk factors for major depression in men
and women: similar or different heritabilities and same or partly distinct genes? Psychol Med.
2001;31:605-16.
Lakics, V., Karran, E.H., Boess, F.G., 2010 Nov. Quantitative comparison of phosphodiesterase
mRNA distribution in human brain and peripheral tissues. Neuropharmacology 59 (6), 367–374.
Lawson RP, Drevets WC, Roiser JP. Defining the habenula in human neuroimaging studies.
Neuroimage. 2013 Jan 1;64:722-7.
Lawson RP, Nord CL, Seymour B, Thomas DL, Dayan P, Pilling S, Roiser JP. Disrupted habenula
function in major depression. Mol Psychiatry. 2017 Feb;22(2):202-208.
Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform.
Bioinformatics. 2009 Jul 15;25(14):1754-1760.
Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R; 1000
Genome Project Data Processing Subgroup. The Sequence Alignment/Map format and SAMtools.
Bioinformatics. 2009 Aug 15;25(16):2078-9.
Li K, Zhou T, Liao L, Yang Z, Wong C, Henn F, Malinow R, Yates JR 3rd, Hu H. βCaMKII in lateral
habenula mediates core symptoms of depression. Science. 2013 Aug 30;341(6149):1016-20.
Lim GY, Tam WW, Lu Y, Ho CS, Zhang MW, Ho RC. Prevalence of Depression in the Community
from 30 Countries between 1994 and 2014. Sci Rep. 2018 Feb 12;8(1):2861.
Lipina TV, Palomo V, Gil C, Martinez A, Roder JC. Dual inhibitor of PDE7 and GSK-3-VP1.15 acts
as antipsychotic and cognitive enhancer in C57BL/6J mice. Neuropharmacology. 2013 Jan;64:205-
14.
Liu B, Cao Y, Wang J, Dong J. Excitatory transmission from ventral pallidum to lateral habenula
mediates depression. World J Biol Psychiatry. 2020 Oct;21(8):627-633.
Liu WH, Valton V, Wang LZ, Zhu YH, Roiser JP. Association between habenula dysfunction and
motivational symptoms in unmedicated major depressive disorder. Soc Cogn Affect Neurosci.
2017 Sep 1;12(9):1520-1533.
Loonen AJM, Ivanova SA. Circuits regulating pleasure and happiness: evolution and role in mental
disorders. Acta Neuropsychiatr. 2018 Feb;30(1):29-42.
Ma J, Duan Y, Qin Z, Wang J, Liu W, Xu M, Zhou S, Cao X. Overexpression of αCaMKII impairs
behavioral flexibility and NMDAR-dependent long-term depression in the medial prefrontal cortex.
Neuroscience. 2015 Dec 3;310:528-40.
Matsumoto M, Hikosaka O. Lateral habenula as a source of negative reward signals in dopamine
neurons. Nature. 2007 Jun 28;447(7148):1111-5.
Matsumoto M, Hikosaka O. Representation of negative motivational value in the primate lateral
habenula. Nat Neurosci. 2009 Jan;12(1):77-84.
Mika D, Richter W, Conti M. A CaMKII/PDE4D negative feedback regulates cAMP signaling. Proc
Natl Acad Sci U S A. 2015 Feb 17;112(7):2023-8.
Accepted Manuscript
19
Millar JK, Mackie S, Clapcote SJ, Murdoch H, Pickard BS, Christie S, Muir WJ, Blackwood DH,
Roder JC, Houslay MD, Porteous DJ. Disrupted in schizophrenia 1 and phosphodiesterase 4B:
towards an understanding of psychiatric illness. J Physiol. 2007 Oct 15;584(Pt 2):401-5.
Morales-Garcia JA, Alonso-Gil S, Santos Á, Perez-Castillo A. Phosphodiesterase 7 Regulation in
Cellular and Rodent Models of Parkinson's Disease. Mol Neurobiol. 2020 Feb;57(2):806-822.
Murck H, Luerweg B, Hahn J, Braunisch M, Jezova D, Zavorotnyy M, Konrad C, Jansen A, Kircher
T. Ventricular volume, white matter alterations and outcome of major depression and their
relationship to endocrine parameters - A pilot study. World J Biol Psychiatry. 2021 Feb;22(2):104-
118.
Numata S, Iga J, Nakataki M, Tayoshi S, Taniguchi K, Sumitani S, et al.. Gene expression and
association analyses of the phosphodiesterase 4B (PDE4B) gene in major depressive disorder in the
Japanese population.Am J Med Genet B Neuropsychiatr Genet. 2009;150B:527-34.
Park C, Rosenblat JD, Brietzke E, Pan Z, Lee Y, Cao B, Zuckerman H, Kalantarova A, McIntyre RS.
Stress, epigenetics and depression: A systematic review. Neurosci Biobehav Rev. 2019
Jul;102:139-152.
Perez-Gonzalez R, Pascual C, Antequera D, Bolos M, Redondo M, Perez DI, Pérez-Grijalba V,
Krzyzanowska A, Sarasa M, Gil C, Ferrer I, Martinez A, Carro E. Phosphodiesterase 7 inhibitor
reduced cognitive impairment and pathological hallmarks in a mouse model of Alzheimer's
disease. Neurobiol Aging. 2013 Sep;34(9):2133-45.
Ranft K, Dobrowolny H, Krell D, Bielau H, Bogerts B, Bernstein HG. Evidence for structural
abnormalities of the human habenular complex in affective disorders but not in schizophrenia.
Psychol Med. 2010 Apr;40(4):557-67.
Redondo M, Zarruk JG, Ceballos P, Pérez DI, Pérez C, Perez-Castillo A, Moro MA, Brea J, Val C,
Cadavid MI, Loza MI, Campillo NE, Martínez A, Gil C. Neuroprotective efficacy of quinazoline
type phosphodiesterase 7 inhibitors in cellular cultures and experimental stroke model. Eur J Med
Chem. 2012 Jan;47(1):175-85.
Robinson JT, Thorvaldsdóttir H, Winckler W, Guttman M, Lander ES, Getz G, et al. Integrative
genomics viewer. Nat. Biotechnol. 2011 Jan;29(1):24-26.
Sartorius A, Kiening KL, Kirsch P, von Gall CC, Haberkorn U, Unterberg AW, Henn FA, Meyer-
Lindenberg A. Remission of major depression under deep brain stimulation of the lateral habenula
in a therapy-refractory patient. Biol Psychiatry. 2010 Jan 15;67(2):e9-e11.
Sasaki, T., Kotera, J., Yuasa, K., Omori, K., 2000 May 19. Identification of human PDE7B, a cAMP-
specific phosphodiesterase. Biochem. Biophys. Res. Commun. 271 (3), 575–583.
Saura CA, Parra-Damas A, Enriquez-Barreto L. Gene expression parallels synaptic excitability and
plasticity changes in Alzheimer's disease. Front Cell Neurosci. 2015 Aug 25;9:318.
Accepted Manuscript
20
Savitz JB, Nugent AC, Bogers W, Roiser JP, Bain EE, Neumeister A, et al. Habenula volume in
bipolar disorder and major depressive disorder: a high-resolution magnetic resonance imaging
study. Biol Psychiatry. 2011; 69(4):336–43. Epub 2010/11/26.
Schmidt FM, Schindler S, Adamidis M, Strauss M, Trankner A, Trampel R, et al. Habenula volume
increases with disease severity in unmedicated major depressive disorder as revealed by 7T MRI.
Eur Arch Psychiatry Clin Neurosci. 2017; 267(2):107–15. Epub 2016/02/14.
Schmieder R, Edwards R. Quality control and preprocessing of metagenomic datasets. Bioinformatics.
2011 Mar15;27(6):863-864.
Strotmann B, Kögler C, Bazin PL, Weiss M, Villringer A, Turner R. Mapping of the internal structure
of human habenula with ex vivo MRI at 7T. Front Hum Neurosci. 2013 Dec 23;7:878.
Vakli P, Deák-Meszlényi RJ, Auer T, Vidnyánszky Z. Predicting Body Mass Index From Structural
MRI Brain Images Using a Deep Convolutional Neural Network. Front Neuroinform. 2020 Mar
20;14:10.
Wu H, Lee J, Vincent LG, Wang Q, Gu M, Lan F, Churko JM, Sallam KI, Matsa E, Sharma A, Gold
JD, Engler AJ, Xiang YK, Bers DM, Wu JC.. Epigenetic regulation of phosphodiesterases 2A and
3A underlies compromised b-adrenergic signaling in an iPSC model of dialted cardiomyopathy.
Cell Stem Cell, 2015 Jul 2; 17(1): 89-100.
Yushkevich PA, Wisse L, Adler D, Ittyerah R, Pluta JB, Robinson JL, Schuck T, Trojanowski JQ,
Grossman M, Detre JA, Elliott MA, Toledo JB, Weixia Liu, Pickup S, Das SR, Wolk DA. A
framework for informing segmentation of in vivo MRI with information derived from ex vivo
imaging: Application in the medial temporal lobe. Annu Int Conf IEEE Eng Med Biol Soc. 2016
Aug;2016:6014-6017.
Figure legend
Figure 1. A) The habenular volume normalized to the total brain volume and B) habenular
laterality index in MDD patients (“patients”) and healthy volunteers (“controls”) carrying
(“yes”) or not (“no”) PDE7A allelic mutattion. Each bar with line represents mean and
standard error of the mean. * - p<0.05 in comparison with “no mutation” within each clinical
group: N=26 (“patients/no”); N=54 (“patients/yes”); N = 11 (“controls/no"); N = 16
(“controls/yes").
Accepted Manuscript
21
Figure 2. Manual segmentation of the habenula on individual T1-weighted images in coronal
plane. Left – whole field-of-view coronal section, area of interest is outlined in red; central –
geometrical delineation of lateral and inferior borders of the habenula; right – one-slice
segmentation.
Accepted Manuscript
22
Table 1. Demographic, clinical and habenular characteristics of unipolar depression and
healthy control groups.
Variable
Patients (N=84)
Controls (N=41)
Comparison
Age, mean ± standard deviation (years)
43.2 ± 12.2 (23-61)
41.8 ± 9.0 (19-69)
ns (A)
Gender: males / females (N)
28 / 56
13 / 28
ns (2-test)
Body mass index, BMI (kg/m2)
25.5 ± 5.5
24.5 ± 3.5
ns (A)
Depression diagnosis: recurrent /
chronic / single episode (N)
34 / 25 / 25
––
––
Antidepressant intake: yes / no (N)
23 / 61
––
––
Season of MRI: Nov-Apr / May-Oct (N)
58 / 26
31 / 10
ns (2-test)
Brain volume (m3)
1,114 ± 0,105
1,084 ± 0,103
ns (A)
Habenula volume left (mm3)
27.6 ± 6.2
26.8 ± 5.1
ns (A)
Habenula volume right (mm3)
27.7 ± 5.2
27.7 ± 6.0
ns (A)
Habenula volume left normalized (units)
25.0 ± 5.1
24.8 ± 4.6
ns (A)
Habenula volume right normalized (units)
25.1 ± 5.1
25.6 ± 5.3
ns (A)
Habenula volume bilateral normalized (units)
50.1 ± 9.7
50.4 ± 9.6
ns (A)
Habenula laterality (%) =
100 (right – left) / (right + left) volume
0.25 ± 6.22
1.33 ± 5.35
ns (A)
ns – non-significant (p>0.05) difference by 2-test or full factorial analysis of variances (ANOVA, A)
which included all possible factors/covariates from among: Group, Age, Gender, BMI, and Season.
Accepted Manuscript
23
Table 2. Frequencies of allelic variants in PDE7A gene in patients with unipolar depression
and healthy controls.
IVS – intervening sequence; *from left to right: ExAC, 1000 genomes, GO-ESP, TOPMED genome
databases; "–" no data on the frequency for this mutant allele in the corresponding database.
Table 3. Characteristics of patients with unipolar depression and healthy controls who
underwent both MRI and genetic investigations.
Variable
Patients (N=80)
Controls (N=27)
Comparison
Age, mean ± standard deviation (years)
43.4 ± 12.2
40.2 ± 8.7
ns (A)
Gender: males / females (N)
26 / 54
11 / 16
ns (2-test)
Body mass index, BMI (kg/m2)
25.7 ± 5.6
24.2 ± 3.1
ns (A)
Depression diagnosis: recurrent /
chronic / single episode MDD (N)
34 / 24 / 22
––
––
Antidepressant intake: yes / no (N)
22 / 58
––
––
MRI data
Season of MRI: Nov-Apr / May-Oct (N)
26 / 54
10 / 17
ns (2-test)
Brain volume (mm3)
1,112 ± 0,106
1,104 ± 0,108
ns (A)
Habenula volume left (mm3)
27.5 ± 4.9
26.5 ± 4.9
ns (A)
Habenula volume right (mm3)
27.5 ± 5.8
27.6 ± 5.8
ns (A)
PDE7A gene:
variant position
(according to GRCh37),
variant ID, base change,
change type
Patients (N=235),
N and %:
Controls (N=41),
N and %:
Frequency of mutant
alleles, %
#
homo-
zygotes
'wild
type'
hetero-
zygotes
homo-
zygotes
mutant
homo-
zygotes
'wild
type'
hetero-
zygotes
homo-
zygotes
mutant
Patients /
controls
according
to 4
databases*
1
chr8:66631697, no ID,
G→A, missense
234
99,57
1
0,43
0
0,00
41
100,00
0
0,00
0
0,00
0,21 /
0,00
– –
– –
2
chr8:66636680_ 66636683,
rs536182238, delATAA,
IVS
234
99,57
1
0,43
0
0,00
41
100,00
0
0,00
0
0,00
0,21 /
0,00
– 0,16
– 0,24
3
chr8:66639230,
rs144980728, T→C, IVS
230
97,87
5
2,13
0
0,00
39
95,12
2
4,88
0
0,00
1,06 /
2,44
1,09 0,74
0,88 0,75
4
chr8:66646997_ 66646998,
rs138599850, insT, IVS
224
95,32
11
4,68
0
0,00
38
92,68
3
7,32
0
0,00
2,34 /
3,66
4,39 2,82
4,23 4,05
5
chr8:66647015,
rs80355475, T→C, IVS
233
99,15
2
0,85
0
0,00
40
97,56
1
2,44
0
0,00
0,43 /
1,22
2,34 2,94
1,96 2,10
6
chr8:66651705,
rs10089128, C→G, IVS
229
97,45
6
2,55
0
0,00
38
92,68
3
7,32
0
0,00
1,28 /
3,66
2,18 0,66
1,95 1,54
7
chr8:66657765,
rs80209446, G→T, IVS
231
98,30
4
1,70
0
0,00
40
97,56
1
2,44
0
0,00
0,85 /
1,22
– 2,16
1,78 2,10
8
chr8:66659835,
rs955273814, C→T, IVS
234
99,57
1
0,43
0
0,00
41
100,00
0
0,00
0
0,00
0,21 /
0,00
– –
– 0,003
9
chr8:66691934, rs972362,
T→A, IVS
112
47,66
97
41,28
26
11,06
18
43,90
17
41,46
6
14,63
31,70 /
35,37
37,9 42,35
48,05 49,98
10
chr8:66692011,
rs11557049, C→T,
missense
210
89,36
24
10,21
1
0,43
38
92,68
3
7,32
0
0,00
5,53 /
3,66
4,06 1,88
4,62 3,96
Accepted Manuscript
24
Habenula volume left normalized (units)
25.0 ± 5.2
24.0 ± 4.1
ns (A)
Habenula volume right normalized (units)
24.9 ± 5.1
25.0 ± 5.0
ns (A)
Habenula volume bilateral normalized (units)
49.9 ± 9.9
49.1 ± 8.7
ns (A)
Habenula laterality (%) = 100 (right – left) /
(right + left) habenula volume
-0.03 ± 6.15
1.84 ± 5.81
ns (A)
Gene PDE7A: variant position (according to
GRCh37), variant ID, base change, change type
'wild type' homozygotes / hetero-
zygotes / mutant homozygotes (N)
1. chr8:66631697, no ID, G→A, missense
79 / 1 / 0
27 / 0 / 0
ns (2-test)
2. chr8:66636680_ 66636683, rs536182238,
delATAA, IVS
79 / 1 / 0
27 / 0 / 0
ns (2-test)
3. chr8:66639230, rs144980728, T→C, IVS
79 / 1 / 0
27 / 0 / 0
ns (2-test)
4. chr8:66646997_ 66646998, rs138599850,
insT, IVS
74 / 6 / 0
25 / 2 / 0
ns (2-test)
5. chr8:66647015, rs80355475, T→C, IVS
78 / 2 / 0
27 / 0 / 0
ns (2-test)
6. chr8:66651705, rs10089128, C→G, IVS
76 / 4 / 0
25 / 2 / 0
ns (2-test)
7. chr8:66657765, rs80209446, G→T, IVS
77 / 3 / 0
27 / 0 / 0
ns (2-test)
8. chr8:66659835, rs955273814, C→T, IVS
80 / 0 / 0
27 / 0 / 0
ns (2-test)
9. chr8:66691934, rs972362, T→A, IVS
36 / 35 / 9
14 / 11 / 2
ns (2-test)
10. chr8:66692011, rs11557049, C→T,
missense
73 / 6 / 1
25 / 2 / 0
ns (2-test)
Carriers of 0 / 1 / 2 / 3 mutations across all 10
loci
26 / 42 / 9 / 3
11 / 13 / 3 / 0
ns (2-test)
IVS – intervening sequence; ns – non-significant (p>0.05) difference by 2-test or full factorial
analysis of variances (ANOVA, A) which included all possible factors/covariates from among: Group,
Age, Gender, BMI, and Season.
Table 4. Association between PDE7A polymorphism and habenula indices in combined group
of depressed patients and healthy controls (N=107).
Allele and presence
of mutation
N
Habenula normalized volume (mean ± SD units)
Habenula
laterality, %
left
right
bilateral
4. rs138599850
no
yes
99
8
24.9 ± 4.9
22.3 ± 4.6
F=3.6, p=0.061
25.2 ± 5.2
22.2 ± 2.4
F=2.9, p=0.091
50.1 ± 9.7
44.5 ± 6.2
F=3.6, p=0.061
–
6. rs10089128
–
–
–
–
9. rs972362
no
yes
50
57
25.3 ± 4.9
24.2 ± 5.0
F=5.0, p=0.028
–
–
–
10. rs11557049
–
–
–
–
All 10 loci
no
yes
37
70
25.8 ± 4.6
24.2 ± 5.1
F=5.5, p=0.022
–
51.1 ± 8.8
48.9 ± 9.9
F=2.6, p=0.108
-0.97 ± 5.5
1.18 ± 6.3
F=6.5, p=0.012
"–" – non-significant (p > 0.05) influence of the “PDE7A SNP” factor based on the full factorial
analysis of variances (ANOVA) which included habenula index as dependent variable and all possible
independent variables from among: Clinical group (patients/controls), Age, Gender, Body mass index
(BMI), Season of MRI, Depression diagnosis, Antidepressant intake (see Table 1 for clarification).
Table S1. Primer structure for amplification of target fragments of the PDE7A gene.
Accepted Manuscript
25
#
Forward primer (5'→3')
Reverse primer (5'→3')
1
AGGAAATCTTGGAAATAAATAATGCTGGC
GCTGAATAAAGCCAGCTGGAAG
2
GTCCTCACTGCTCGACTGTT
AGGATGTAGGAAGGTTAATGTTGTATAGATGA
3
TTCCCTTCTTGATAAAAACAGTGGCA
AGAAATGCACAGGTATGTTCAAGCC
4
TTGTTACTAAAAATGTCAAGACTCTACTGCTAG
TGCTAGATGGCTTTGAAATGTGC
5
CTGCTTGCTTAATTCCCACGTC
ACAAGATTAGGGTACCAATTAAGAAATAGCATT
6
TACCTGTAAAACCAAATGTCTGTGTCT
AGGGTTCTATAAAGCCTTCCGATTATTATG
7
AGTATGAAAAACACGTAAGCAATGATGC
GTCCCATTTGGATAGAGGTGATTTATG
8
ACACTGAAAACTGTGGAACACCT
TTGTTAGTAATGATATGTCCAGAAAGAGACG
9
ATTCTACAACAAAGGACGTTTCTGAGT
TCATCCAGGTGTTAATCAACCTTTCC
10
GCACTAACCTTGTATAAAGTTGCCAAGTAAT
CATTGGCTGCTAATTCAAAACTACTGT
11
TTCAGTCAAAGCAGTAACTTCAGGAG
CACAATTTTTGTCCTTGTATATGTTGCTCA
12
AACCGATATAACTGAGATAAAACTTAAACAGGTT
GTATTTCAAAGCATAATATAATTGTGTTGACTTG
13
GCAGTAATCTAGACTACATTAACTTGAGCAA
GAGCCAGTTGAAAAAGTCATGATTAAAAGAA
14
TATACACACCTTGGCTTGTCCATTATAATC
AGTGGTATTGCAAAGATAGCATGTGTAT
15
TTTCGTGGTACTGCGGTTTCAA
TTTCCCTTGCTCTGTAATGGCTAA
16
CACACGGACCTTTGTTGCAT
TTCCCTTGGAAAACTGTGTAATTT
17
GGTGAGAACCTCTTCTTTCTGATTCAA
TTCAGCCTTACAATTAATTACTGAGATTTTGTG
18
AACAGTGATGAAAAGCTATCTAATGAAAGATACC
CTCTTGCACAGTGCTTCACAAATAATAAA
19
ATCAGAGAATAAAAACTGAGGCAAAAGGA
TCTCTTTTGCCTCGGGACAG
20
GGTTGTAGAGGAGGTGAAGCTG
AGGGCGGGCGTATTCAATGGAA
Accepted Manuscript
