Nucleotide sequence of pOLA52: A conjugative IncX1 plasmid from Escherichia coli which enables biofilm formation and multidrug efflux

Abstract

The large conjugative multidrug resistance (MDR) plasmid pOLA52 was sequenced and annotated. The plasmid encodes two phenotypes normally associated with the chromosomes of opportunistic pathogens, namely MDR via a resistance-nodulation-division (RND)-type efflux-pump (oqxAB), and the formation of type 3 fimbriae (mrkABCDF). The plasmid was found to be 51,602 bp long with 68 putative genes. About half of the plasmid constituted a conserved IncX1-type backbone with predicted regions for conjugation, replication and partitioning, as well as a toxin/antitoxin (TA) plasmid addiction system. The plasmid was also classified as IncX1 with incompatibility testing. The conjugal transfer and plasmid maintenance regions of pOLA52 therefore seem to represent IncX1 orthologues of the well-characterized IncX2 plasmid R6K. Sequence homology searches in GenBank also suggested a considerably higher prevalence of IncX1 group plasmids than IncX2. The 21 kb 'genetic load' region of pOLA52 was shown to consist of a mosaic, among other things a fragmented Tn3 transposon encoding ampicillin resistance. Most notably the oqxAB and mrkABCDF cassettes were contained within two composite transposons (Tn6010 and Tn6011) that seemed to originate from Klebsiella pneumoniae, thus demonstrating the capability of IncX1 plasmids of facilitating lateral transfer of gene cassettes between different Enterobacteriaceae.

Full text

Nucleotide sequence of pOLA52: A conjugative IncX1 plasmid from
Escherichia coli which enables biofilm formation and multidrug efflux
Anders Norman
a
, Lars Hestbjerg Hansen
a,*
, Qunxin She
b
, Søren Johannes Sørensen
a
a
Department of Biology, Evolution and Microbiology Section, University of Copenhagen, Sølvgade 83H, DK-1307 Copenhagen K, Denmark
b
Department of Biology, Functional Genomics Section, Biocenter, University of Copenhagen, Ole Maaløes Vej 5, DK-2200 Copenhagen N, Denmark
article info
Article history:
Received 6 February 2008
Revised 11 March 2008
Available online 28 April 2008
Communicated by Ellen Zechner
Keywords:
Plasmid
IncX1
Composite transposon
Biofilm formation
Multidrug resistance
abstract
The large conjugative multidrug resistance (MDR) plasmid pOLA52 was sequenced and
annotated. The plasmid encodes two phenotypes normally associated with the chromo-
somes of opportunistic pathogens, namely MDR via a resistance-nodulation-division
(RND)-type efflux-pump (oqxAB), and the formation of type 3 fimbriae (mrkABCDF). The
plasmid was found to be 51,602 bp long with 68 putative genes. About half of the plasmid
constituted a conserved IncX1-type backbone with predicted regions for conjugation, rep-
lication and partitioning, as well as a toxin/antitoxin (TA) plasmid addiction system. The
plasmid was also classified as IncX1 with incompatibility testing. The conjugal transfer
and plasmid maintenance regions of pOLA52 therefore seem to represent IncX1 ortho-
logues of the well-characterized IncX2 plasmid R6K. Sequence homology searches in Gen-
Bank also suggested a considerably higher prevalence of IncX1 group plasmids than IncX2.
The 21 kb ‘genetic load’ region of pOLA52 was shown to consist of a mosaic, among other
things a fragmented Tn3transposon encoding ampicillin resistance. Most notably the
oqxAB and mrkABCDF cassettes were contained within two composite transposons
(Tn6010 and Tn6011) that seemed to originate from Klebsiella pneumoniae, thus demon-
strating the capability of IncX1 plasmids of facilitating lateral transfer of gene cassettes
between different Enterobacteriaceae.
Ó2008 Elsevier Inc. All rights reserved.
1. Introduction
The Enterobacteriaceae is a large family of gram-nega-
tive bacteria, which mainly include enteric bacteria, such
as the familiar pathogens Salmonella spp., Klebsiella spp.
and Escherichia coli that thrive in the gut environment of
humans and other animals. The increasing dissemination
of multidrug-resistant Enterobacteriaceae (MRE) has been
a substantial cause of concern in recent years, due to a dra-
matic rise in virtually untreatable nosocomial infections
(Paterson, 2006). The propagation of multidrug resistance
is highly dependent upon mobile genetic elements (MGEs)
such as conjugative plasmids, integrons and transposons,
which permit the accumulation and horizontal transfer of
resistance genes or whole arrays of genes (Harbottle
et al., 2006; Thomas and Nielsen, 2005). Close monitoring
of the spread and evolution of MGEs in general, and conju-
gative plasmids in particular, is therefore an important
means of curtailing these developments (D’Costa et al.,
2006; Frost et al., 2005).
The IncX group of plasmids is narrow host-range plas-
mids common in Enterobacteriaceae, even in isolates from
before the widespread use of antibiotics (Datta and
Hughes, 1983). R6K is considered the archetypical plasmid
of incompatibility group X (Bradley, 1980; Couturier et al.,
1988), but belongs to a subgroup (IncX2) with no other
confirmed members (Jones et al., 1993).
In this study we describe the sequencing and annota-
tion of the 51,602 bp conjugative IncX1 plasmid pOLA52,
which was previously isolated from swine manure (Søren-
sen et al., 2003). The pOLA52 plasmid has been shown to
0147-619X/$ - see front matter Ó2008 Elsevier Inc. All rights reserved.
doi:10.1016/j.plasmid.2008.03.003
* Corresponding author. Fax: +45 35 32 20 40.
E-mail address: hestbjerg@bio.ku.dk (L.H. Hansen).
Plasmid 60 (2008) 59–74
Contents lists available at ScienceDirect
Plasmid
journal homepage: www.elsevier.com/locate/yplas

carry a gene cassette (oqxAB) which encodes a tri-partite
resistance-nodulation-division (RND) efflux-pump that
confers resistance towards the growth promoter olaquin-
dox (Hansen et al., 2004), as well as a wide array of clinical
antimicrobials such as quinoxalines, quinolones and fluo-
roquinolones (Hansen et al., 2007). Furthermore, a recent
study established that another gene cassette present on
the plasmid (mrkABCDF) enhances conjugation and biofilm
formation considerably in several different Enterobacteria-
ceae (Burmølle et al., 2008). In this study we show that
these properties are most likely to have been acquired by
the recruitment of two composite transposons (Tn6010
and Tn6011)ofKlebsiella pneumoniae origin.
The complete nucleotide sequence of the IncX2 plasmid
R6K was recently made available by the Plasmid Sequenc-
ing Group at the Sanger Institute in un-annotated form
(available at http://www.sanger.ac.uk/Projects/Plasmids/).
We therefore also present a preliminary comparison be-
tween the backbone regions of two fully sequenced IncX
plasmids from different subgroups.
2. Materials and methods
2.1. Bacterial strains and growth conditions
Strains and plasmids used in this study are listed in Table 1. All strains
of E. coli were grown in Luria broth (LB) at 37 °C with moderate shaking
except when selecting with Sulfamethizole (CAS No.: 144-82-1, Sigma–
Aldrich) where M9 minimal medium (Sambrook and Russell, 2001)
supplemented with 0.4% casamino acids and 0.2% glucose was used
(M9-CAAG). Growth on plates was done on LB-agar or on M9-CAAG con-
taining 1.8% Difco
TM
Noble agar (BD Denmark a/s, Brøndby, Denmark).
Antibiotic selection with Ampicillin (Amp), Kanamycin (Kan) or Sulfa-
methizole (Sul) was done at the following concentrations: 100 lg Amp
ml
1
;50lg Kan ml
1
; 500 lg Sul ml
1
.
2.2. Incompatibility testing
Escherichia coli GeneHogs
Ò
cells (Invitrogen, Carlsbad, CA) harboring
either plasmid pOLA52 bla::npt (Kan
R
), IncX2 plasmid R6K (Str
R
, Amp
R
)
or IncX1 plasmid R485 (Sul
R
) were obtained by separate transformations
into electro-competent cells. Transformants were selected on LB-agar
plates supplemented with Kan or Amp or on M9-CAAG supplemented
with Sul, respectively. Transconjugant bacteria harboring two plasmids
(pOLA52 bla::npt and R6K, or pOLA52 bla::npt and R485) were created
using a standard filter-mating procedure. A single transconjugant colony
was transferred to LB-broth supplemented only with Kan and propagated
for approximately 50 generations in 5 ml LB-broth by periodic dilutions.
Subsequently 100 colonies were isolated on LB-agar supplemented with
Kan and replica-plated to LB-agar plates supplemented with Amp or on
M9-CAAG agar plates supplemented with Sul, depending on which plas-
mid incompatibility was tested with. As a control E. coli GeneHogs
Ò
cells
harboring only pOLA52 bla::npt, R6K or R485 were propagated for
approximately 50 generations in LB-broth without supplements and
100 isolated colonies were replica-plated to LB-agar plates supplemented
with Kan or Amp or M9-CAAG agar plates supplemented with Sul,
respectively.
2.3. Library construction and DNA sequencing of pOLA52
Purified pOLA52 DNA was mechanically sheared and treated with DNA
modifying enzymes to generate blunt ends. Subsequently, 1.5–2.5 kb frag-
ments were recovered from an agarose gel and ligated into pUC18 vector at
the HincII site, yielding a shotgun library. Shotgun clones were subse-
quently obtained by transforming E. coli DH5awith the ligation mixture.
Plasmid DNA was purified from shotgun clones using BioRobot 8000 (QIA-
GEN) and sequenced with the MegaBACE 1000 DNA Analysis System
(Molecular Dynamics). A total of 770 sequence reads were generated.
The nucleotide sequence of the pOLA52 was assembled using the
CONSED
(Gordon et al., 1998), and
SEQUENCHER
4.2 (Gene Codes Corp., Ann Arbor,
MI) programs, and sequence gaps were filled using custom primers. The se-
quence was determined for both strands, and any remaining sequence
ambiguity was resolved by sequencing at least two clones.
2.4. DNA sequence analysis and annotation
DNA sequences were primarily analyzed and annotated using
ARTEMIS
(version 9) software (Rutherford et al., 2000) and a combination of several
different publicly available DNA or protein sequence analysis servers.
Putative open reading frames in the nucleotide sequence were located
with
GLIMMER
3.02 (Delcher et al., 1999, 2007; Salzberg et al., 1998) and
subsequently entered manually into
ARTEMIS
. Nucleotide sequence and
protein homology was performed with the
BLAST
algorithm (Altschul
et al., 1997) against the GenBank databases. Insertion sequences within
the nucleotide sequence were located by using
IS FINDER
(http://www-is.
biotoul.fr/), which uses
BLASTN
against a large database of known insertion
sequences. Repeat regions were found with
REPUTER
(Kurtz and Schleierm-
acher, 1999) available at the Bielefeld University Bioinformatics Server
(BiBiServ, http://bibiserv.techfak.uni-bielefeld.de). Putative promoter
sequences were located with the Neural Network Promoter Prediction
(
NNPP
) software (Reese, 2001).
General amino acid sequence homology was calculated using the
EM-
BOSS-NEEDLE
alignment algorithm (Needleman and Wunsch, 1970) against
the closest homologue. Putative peptides were also analyzed for the pres-
ence of peptidase I and II cleavage sites and transmembrane helices
(TMH) using the
SIGNALP
3.0,
LIPOP
1.0 and
TMHMM
2.0 servers, respectively
(Emanuelsson et al., 2007; Juncker et al., 2003; Krogh et al., 2001), avail-
able at the Center for Biological Sequence analysis web page (http://
www.cbs.dtu.dk/services/). For phylogenetic studies, protein sequences
were aligned using the
CLUSTALW
algorithm and phylogenetic trees were
drawn using
SPLITSTREE
4.8 (Huson and Bryant, 2006).
2.5. Nucleotide sequence accession number
The annotated nucleotide sequence of plasmid pOLA52 has been
deposited in the GenBank database under Accession No. EU370913.
3. Results and discussion
3.1. Overall sequence structure and analysis
A physical map of pOLA52 is presented in Fig. 1 and an
overview of the annotated genes is presented in Table 2.
The sequence revealed a circular plasmid of 51,602 bp in
length, incidentally, a figure very close to the previous esti-
Table 1
List of strains and plasmids used in this study
Strain/
plasmid
Description/genotype Reference/
source
E. coli
DH5asupE44 DlacU169 (u80 lacZDM15) hsdR17
recA1 endA1 gyrA96 thi-1 relA1
Stratagene
GeneHogsÒF
–
mcrA D(mcrCB-hsdRMS-mrr)u80
lacZDM15 DlacX74 deoR recA1 araD139
D(ara-leu)7697 galU galK rpsL (StrR) endA1
nupG fhuA::IS2
Invitrogen
Plasmids
pOLA52 Amp
R
This study
pOLA52
bla::npt
Kan
R,
; pOLA52 tagged with Entranceposon
(Kan
R
)inbla
Hansen
et al. (2005)
R485 Sul
R
Hayes
(1998)
R6K Amp
R
, Str
R
DSMZ
60 A. Norman et al. /Plasmid 60 (2008) 59–74

mate of 52 kb obtained with restriction fragment analysis
(Sørensen et al., 2003). The average G+C content of the en-
tire sequence was 46.3%, which compares well to the G+C
content of 45.3% in R6K. Annotation of pOLA52 revealed
68 ORFs and 9 putative q-independent terminators (Table
3). Non-coding regions upstream of ORFs were examined
for r
70
-dependent promoters, which revealed 13 putative
sequences of interest (Table 4). The majority of ORFs were
transcribed in the counterclockwise direction. Four hypo-
thetical gene-products did not match any entries in the
GenBank protein databases.
A G+C plot of pOLA52 revealed that two DNA regions of
about 5 kb, containing the mrkABCDF and oqxAB cassettes,
respectively, had significantly higher average G+C content
(56% and 59%). A
BLASTN
search against the NCBI non-redun-
dant nucleotide sequence database revealed above 99%
homology of both segments to the chromosome of K. pneu-
moniae MGH 78578, which has an average G+C content of
57%. The segments were both confined within a 21 kb re-
gion of pOLA52 containing predicted genes for transposas-
es or resolvases, which strongly indicated that the
cassettes were parts of discrete accessory elements. Addi-
tionally, two putative drug resistance genes encoding a
truncated bleomycin resistance protein (blmS) and the
Tn3b-lactamase (bla), respectively, were present in this
region. A small segment spanning the region
10.7–11.3 kb showed 92% nucleotide identity to part of
the plasmid pCoo of E. coli (Froehlich et al., 2005). The
whole 21 kb region therefore seems to be a mosaic con-
taining DNA of multiple origins, consistent with most ‘ge-
netic load’ regions in resistance plasmids.
In a 25 kb segment containing 34 predicted ORFs
(orf20–orf53), 23 putative genes encoded plasmid mainte-
nance functions such as replication (rep), partitioning
(par), increased stability in the form of a toxin/antitoxin
(TA) plasmid addiction system (stb) and conjugational
transfer (tra). A total of 7 ORFs located in the tra,rep and
par loci did not contain conserved domains, but were iden-
tified from their location or homology to previously de-
scribed proteins (see below). Thus, the putative backbone
region of pOLA52 appears to be organized tra–x–stb–rep–
par with xrepresenting a DNA segment consisting of seven
hypothetical genes with undetermined function (orf38–
orf44).
3.2. Nucleotide sequence similarity to R6K and other putative
IncX plasmids
Eighteen of the putative pOLA52 backbone genes, lo-
cated in the tra and rep loci, had significant homology
to previously identified genes in the plasmid R6K, indi-
cating that pOLA52 and R6K possess similar mechanisms
of conjugal transfer and replication. A Blastn comparison
revealed roughly 70% nucleotide sequence homology be-
tween the putative backbone region of pOLA52 and a
15.8 kb segment of the R6K sequence. Unfortunately
pOLA52
51,602
mrk
gem
tra
stb
rep
par
oqx
Plasmid main-
tenance/stability
Casettes of putative
K. pneumoniae origin
IS transposases
Other/unknown
Conjugal transfer
Gene expression
modulation
Fig. 1. Genetic map of the IncX1 plasmid pOLA52. The central region of the map is a G+C plot of the nucleotide sequence (windows size: 100 bp). Boxes
represent ORFs predicted with Glimmer 3.02 and are color coded after their predicted functions (see legend). Specific loci are named as follows: oqx, gene
cassette encoding RND-type efflux-pump; mrk, gene cassette encoding formation of type 3 fimbriae; gem, putative gene expression modulation/stealth
locus; tra conjugal transfer genes; stb, toxin/antitoxin plasmid addiction genes; rep, replication initiation genes; par, plasmid partitioning genes.
A. Norman et al. /Plasmid 60 (2008) 59–74 61

Table 2
Annotation of putative coding sequences in the IncX1 plasmid pOLA52 isolated from E. coli residing in swine manure
Coding
sequence
ppOLA52
coordinates
Strand Protein properties Identity/similarity (%) at the gene-
product level to:
Motifs/Function Protein classification Accession
No.
No. aa Mass
(kDA)
COG Pfam
tnpA
IS26cp2
756–52 234 28,0 100/100; TnpAIS26cp2 from pCTX-
M3
rve; IS26 Transposase 3316 0665 AF550415
orf2 757–918 + 53 5,8 99/99; SCH_017 from pSC138 HTH_7; Resolvase fragment — 2796 AY509004
bla 1101–1961 + 286 31,5 100/100; TEM-1 from Tn3 PenP; TEM type beta-lactamase 2367 0144 V00613
insB 2744–2379 120 14,4 100/100; insB from R100 InsB; IS1 Transposase 1662 3400 J01730
insA 3104–2892 91 7,6 100/100; insA from pJB6 Hypothetical protein AJ223475
mrkF 3791–3156 211 22,6 99/100; KPN_03275 from K.
pneumoniae MGH 78578
FimA; Fimbrial protein 3539 0419 CP000647
mrkD 4800–3805 331 35,2 98/99; KPN_03276 from K.
pneumoniae MGH 78578
Fimbrial protein 3539 0419 CP000647
mrkC 7277–4791 828 90,8 100/100; KPN_03277 from K.
pneumoniae MGH 78578
FimD; Fimbrial usher protein 3188 0577 CP000647
mrkB 8014–7289 241 26,2 100/100; KPN_03278 from K.
pneumoniae MGH 78578
FimC; Pilus assembly protein 3121 0345 CP000647
mrkA 8694–8086 202 20,7 100/100; KPN_03279 from K.
pneumoniae MGH 78578
FimA; Fimbrial protein 3539 0419 CP000647
insA 8947–9159 + 91 7,6 99/99; InsA from E. coli Nissle 1917 Hypothetical protein AJ586888
insB 9170–9673 + 125 19,7 100/100; InsB from S. dysenteriae InsB; IS1 Transposase 1662 3400 AF153317
orf13 10,341–9811 160 19,8 100/100; TnpA (C-end) from K.
pneumoniae
IS903D Transposase fragment — 1609 AF548080
orf14 10,651–10,292 119 13,6 100/100; TnpA (N-end) from K.
pneumoniae
IS903D Transposase fragment — 1609 AF548080
orf15 10,821–11,195 + 154 14,4 90/98; pCoo054 from pCoo EAL/Rtn; Hypothetical protein 2200 0563 CR942285
hns 11,898–11,464 - 144 16,7 87/92; MdbA from E. coli Hns; DNA-binding protein 2916 0816 U47048
hha 12,120–11,914 68 8,2 69/87; YdfA from R721 HHA; Modulator of gene expression — 5321 AP002527
topB 14,270–12,117 717 79,0 89/97; YdgA from R721 Type IA Topoisomerase 0550 1131 AP002527
orf19 14,406–15,329 + 307 35,4 27/60; pPER272_0260 from
pPER272
Hypothetical protein — — CP000469
orf20 15,746–15,444 87 10,9 78/93; YggA from R721 TrBM; Hypothetical signal protein — 7424 AP002527
orf21 16,156–15,743 137 16,0 40/74; YP_pCRY17 from pCRY Hypothetical lipoprotein — 8139 AE017044
taxB 17,988–16,153 611 69,4 81/94; TaxB from R6K TraG/VirD4; T4SS coupling protein 3505 2534 Y10906
pilx11 19,022–17,991 343 39,0 73/92; Pilx11 from R6K VirB11; T4SS VirB11 ATPase 0630 0437 AJ006342
pilx10 20,229–19,024 401 43,2 64/86; Pilx10 from R6K TrbI; T4SS VirB10 component — 3743 AJ006342
pilx9 21,155–20,226 309 35,0 81/93; Pilx9 from R6K CagX; T4SS VirB9 component 3504 3524 AJ006342
pilx8 21,873–21,160 237 27,0 76/93, PilX8 from R6K VirB8; T4SS VirB8 component 3736 4335 AJ006342
pilx7 21,991–21,863 42 4,4 74/98; Pilx7 from R6K Lipoprotein; putative T4SS VirB7
component
— — AJ006342
orf28 22,128–22,015 37 4,2 42/70; RF_1110 from Rickettsia felis Hypothetical protein — — CP000053
pilx6 23,179–22,118 353 37,6 68/89; Pilx6 from R6K TrbL/VirB6; T4SS VirB6 component 3704 4610 AJ006342
eex 23,475–23,191 94 11,0 53/83; Eex from R6K Lipoprotein, Entry exclusion — — AJ006342
pilx5 24,239–23,490 249 28,2 67/88; Pilx5 from R6K Putative T4SS VirB5 component — — AJ006342
62 A. Norman et al. /Plasmid 60 (2008) 59–74

pilx3–4 27,003–24,250 917 105,1 81/93; Pilx3 and Pilx4 from R6K VirB3/CagE/TrbE/VirB4; T4SS VirB3/4
components
3702/3451 3135/5101 AJ006342
pilx2 27,318–27,022 95 11,0 88/100; Pilx2 from R6K Putative T4SS VirB2 component — — AJ006342
pilx1 27,943–27,296 227 24,1 68/85; Pilx1 from R6K LT_GEWL; T4SS VirB1 component — 1464 AJ006342
actX 28,636–28,118 516 19,9 26/47; ActX from R6K NGN; Transcription antiterminator — 2357 AJ006342
taxC 30,148–28,982 388 44,5 78/92; TaxC from R6K VirD2; DNA transfer relaxase — 3432 X95535
taxA 30,696–30,151 181 21,4 70/86; TaxA from R6K Putative DNA transfer auxiliary protein — — S70936
orf38 31,294–31,022 90 10,4 31/73; SNOG_01874 from P.
nodorum SN15
Hypothetical protein — — CH445327
orf39 31,504–31,307 38 7,4 No significant homologues found Hypothetical protein — — —
orf40 31,705–31,526 53 7,1 62/87;YagA from R721 (C-term.) Hypothetical protein — — AP002527
orf41 32,078–31,896 60 7,2 83/95;YagA from R721 (N-term.) Hypothetical protein — — AP002527
orf42 32,386–32,171 71 8,0 58/78 to YajA; pSG1 Hypothetical protein — — AJ868433
orf43 32,621–32,376 81 9,3 No significant homologues found Hypothetical protein — — —
orf44 32,989–32,666 107 12,2 79/89 to YahA; R721 Hypothetical Protein — — AP002527
stbE 33,416–33,135 93 11,0 99/100; StbE from R485 RelE; Plasmid stability putative antitoxin 2026 — AF072126
stbD 33,657–33,406 83 9,2 100/100; StbD from R485 Plasmid stability, putative toxin 2161 2604 AF072126
pir 34,891–35,727 + 278 32,2 40/71; pprotein from R6K Rep_3;Replication Initiation protein 5527 1051 Y00768
bis 35,767–36,213 + 148 17,3 37/75; Bis from R6K Putative accessory replication protein — — V00320
ddp3 36,350–36,703 + 140 13,5 60/81;DDP3 from R6K Hypothetical protein, putative DNA
transfer element
— — X05645
orf50 38,305–37,241 354 38,7 32/60; CII from X. campestris ParA/Soj; Hypothetical protein 1192 1656 AE012545
parG 38,959–38,729 76 8,6 100/100; ParG from TP228 ParG; Plasmid partitioning — 9274 AF204292
parF 39,631–39,011 206 22,1 99/100; ParF from TP228 ParA/Soj; Plasmid partitioning 1192 1656 AF204292
orf53 39,926–40,570 + 214 24,5 75/91; ORF6 from p29930 SR_Res_par/PinR/HTH_7;Partitioning
resolvase
1961 0239 AJ519722
orf54 40,865–40,686 59 6,6 No significant homologues found Hypothetical protein — — —
orf55 41,057–40,932 41 4,7 88/100; SCH_083 from pSC138 Hypothetical protein — — AY509004
orf56 41,225–41,106 39 4,1 No significant homologues found Hypothetical protein — — —
orf57 41,704–41,588 38 4,2 77/97; SCH_083 from pSC138 Hypothetical protein — — AY509004
tnpA 43,193–41,931 435 46,7 100/100; TnpA from pLEW156 Tn3 transposase fragment 4644 1526 DQ390454
orf59 43,524–43,207 105 11,7 100/100; TnpA from pRSB105 Hypothetical protein — — DQ839391
tnpAI
S26cp2
43,297–44,001 + 238 28,0 100/100; TnpAIS26cp2 from IS26 rve; IS26 transposase 3316 — AY509004
orf61 44,156–43,950 69 7,9 86/90; to Tn3 (res. 157–205) from H.
influenzae
Tn3 transposase fragment — — CP000057
blmS 44,297–44,578 + 129 10,8 100/100; Ble from pSK41 Glyoxylase; N-terminal truncated
bleomycin resistance protein
— 0903 AF051917
orf63 45,293–44,901 130 14,7 50/80; CA_C2569 from C.
acetobutylicum
Hypothetical protein 5015 1243 AE001437
tnpA
IS26cp2
46,332–45,628 238 28,0 100/100; TnpAIS26cp2 from pS12 rve; IS26 Transposase 3316 0665 AB180674
orf65 46,333–46,464 + 43 4,8 100/100; TnpA from pRSB105 Hypothetical protein — — DQ839391
oqxA 46,652–47,827 + 391 42,4 100/100; KPN_02969 from K.
pneumoniae MGH 78578
AcrA/HlyD; RND pump, membrane fusion
protein
0845 0529 CP000647
oqxB 47,851–51,003 + 1050 113,4 99/100; KPN_02970 from K.
pneumoniae MGH 78578
AcrB/ACR_tran; RND pump, integral
membrane protein
0841 0873 CP000647
orf68 51,552–51,073 159 17,4 100/100; KPN_02971 from K.
pneumoniae MGH 78578
rirA/Rrf2; Transcriptional regulator 1959 2082 CP000647
A. Norman et al. /Plasmid 60 (2008) 59–74 63

annotation of R6K had not been performed at the time of
writing, so comparison of putative proteins therefore re-
quired analysis of the R6K sequence for ORFs with gene-
product homology to putative pOLA52 proteins. To avoid
conflict with the impending annotation at the Sanger
Institute, we refrained from numbering or naming these
putative R6K genes with one exception. A small discrep-
ancy of four bases between the completed sequence from
the Sanger Institute and an 11 kb R6K DNA segment in
GenBank (Accession No. AJ006342) has led to pilx3
R6K
and pilx4
R6K
being interpreted as a single chimerical gene
in the Sanger sequence, which we have therefore named
pilx3–4
R6K
. Incidentally, the pOLA52 sequence contained a
similar combined gene (pilx3–4
pOLA52
) which makes it
likely that an error is present in the old R6K sequence.
Our analysis of R6K led to the discovery of a total of 13
new putative genes with significant gene-product homol-
ogy to pOLA52 gene-products. This included three genes
in the putative tra region (Fig. 2A), 8 genes in the x–stb–
rep–par region (Fig. 2B) and two genes in the region con-
taining the topB gene (Fig. 2C). R6K did not seem to contain
astb locus and only contained a par locus with weak
homology to pOLA52 (see below). Instead, the stb and par
loci of pOLA52 showed >98% nucleotide homology to the
stbDE locus in R485 from Morganella morganii (Hayes,
1998) and the parFG locus in TP228 of Salmonella enterica
subsp. enterica serovar Newport (Hayes, 2000), respec-
tively. Both have previously been classified as IncX1 plas-
mids in a study which established this subgroup as being
considerably more prevalent than IncX2 in strains isolated
during and after the ‘pre-antibiotic era’ (Jones et al., 1993).
So far the IncX2 subgroup only seems to contain R6K and
possibly a small handful of other plasmids (Prager et al.,
1988). Unfortunately, complete sequencing of R485 and
TP228 had not been performed at the time of writing,
although efforts were reported as being underway (per-
sonal communications, Finbarr Hayes and Christopher M.
Thomas). Two hitherto unannotated plasmid sequences,
however, were located in GenBank which showed a very
high degree of homology to the entire backbone region of
pOLA52. Both plasmids (pOU1114, Accession No.
DQ11387; pOU1115, Accession No. DQ11388) were iso-
lated from strains of S. enterica in Taiwan. Comparison with
pOLA52 also showed that the locus 11.4–14.3 kb, which
contained the hns,hha and topB genes, was highly con-
served in these plasmids. By comparing all three plasmid
sequences we were able to elucidate a conserved IncX1
backbone, which seems to be prevalent in Enterobacteria-
ceae. The region spans bases 11.4–41.9 kb of pOLA52, but
does not include the segments 14.3–15.4 kb and 37.1–
38.6 kb. These two segments did not show significant
homology to any sequences in the non-redundant nucleo-
tide database in GenBank.
3.3. Incompatibility testing
As indicated above, there were considerable nucleotide
sequence data to support that pOLA52 belongs to the IncX1
incompatibility group. To verify this, two transconjugants
harboring a Kan
R
variant of pOLA52 (pOLA52-bla::npt)
Table 3
Putative q-independent transcriptional terminators identified in the pOLA52 DNA sequence
Genetic location Coordinates Sequence 5
0
-3
0
Direction
topB–orf19 14,309–14,354 ACAACCACAAAAAGATCTTGCCTACGAAAGATCTTTTTGTTTATAT M
taxC–actX 28,692–28,652 CACAAGCAACCACGGTTGGCTTGTGTTTTGTCACA
orf38–taxA 31,010–30,984 CCTCCCGTATTTCGGGAGGTGCTTTCT
orf41–orf40 31,739–31,718 GGGGGATATTCCCCCTTTTAGT
orf44–orf43 32,658–32,635 GGGGCATTAAGCCCCTTTTTTAGT
orf56–orf57 41,382–41,426 GAACTGTAAAAAAGCCGACCTCACCAGTCGGTTTTTTTACGTCTG M
blmS–orf63 44,619–44,666 GCTGAATAAAAGATACGAGAGACCTCTCTTGTATCTTTTTTATTTTGA ?
orf63–blmS 44,868–44,818 GACCCCCATAAGTTAGACCAAAAATCTAACTTATGGGAGGTCATTTTTTAT
oqxB–orf68 51,012–51,062 AGATAACAAAAAAACCGCCTTCACAATTTGAAGGCGGTTTTTTTTCGTCAC M
Table 4
Putative r
70
-dependent promoters
Name Position 35 10 Direction Reference
bla
P3
1,031–1,059 TTCAAA GACAAT ?Lartigue et al. (2002)
mrkB
p
8,022–8,048 TTAATA CAATGT This work
mrkA
p
8,906–8,934 TTGGCA TATATT This work
orf15
p
10,777–10,803 GTGACA TAATAT ?This work
orf19
p
14,326–14,355 TTGCCT TATATT ?This work
topB
p
14,367–14,395 TTTATT TAAAAT This work
actX
p
28,742–28,770 TTGAAC TAGTAT This work
taxA
p
30,818–30,823 TTGCAT CACAAT This work
pir
p
34,827–34,856 TTTACA TATGAT ?This work
parG
p
38,990–39,018 TTGAGT TATACT This work
parF
p
39,681–39,708 TTTACT TAAACT This work
oqxA
p
46,481–46,509 TTGCAC TACAAT ?This work
orf68
p
51,585–12 TTGCAA TAAAAA This work
64 A. Norman et al. /Plasmid 60 (2008) 59–74

and either R6K (IncX2) or R485 (IncX1) were propagated
for 50 generations in growth media selective only for
pOLA52-bla::npt. The plasmid loss was established to be
97% ± 1 for R485 and 42% ± 35 for R6K (n= 3). No sponta-
neous loss of resistance was detected in strains harboring
only one plasmid, thus demonstrating the inherent inde-
pendent stability of all three plasmids. Agarose gel analysis
of the plasmid content of six double-resistant colonies
showed a single instance of co-integration between R485
and pOLA52-bla::npt while none had occurred between
R6K and pOLA52-bla::npt (data not shown). Based on these
results and the strong homology to known genes of R485
and TP228 it was established that pOLA52 belongs to the
IncX1 group. The ‘partial incompatibility’ and substantial
standard deviations of the R6K experiment should proba-
bly be attributed to the relatively large sequence diver-
gence, especially between the respective par loci (see
below).
hns hha
topB
orf19
pOLA52
(11.4 - 14.3 kb)
R6K
R721
p29930
ydfA
ydgA
ydiA
orf31
orf30
C
orf20
orf21
taxB
pilx9
pilx8 pilx7
pilx6
eex
pilx5
pilx2
pilx1
actX
pOLA52
(15.4 - 30.8 kb)
R6K
A
taxC
taxA
pilx3-4
pilx11
pilx10
1 kb
orf28
p29930
pCRY
pVT745
orf29
triH
triG
triF
orf22
triD
triC
triA
orf17
orf16
triB
triJ
triI
triE
taxB
pilx9
pilx8
pilx7
pilx6
eex
pilx5
pilx2
pilx1
actX
taxC
taxA
pilx3-4
pilx11
pilx10
YP_pCRY17
virB9
virB8
YP_pCRY11
virB5
virB4
virB1
nusG
virB2
virB11
virB10
virB6
magB14
magB13
magB12
magB09
magB08
magB07
magB06
magB05
magB04
magB02
magB01
magA2
magA1
magB03
magB11
magB10
ssb
AA01
YP_pCRY18
virB1
virB2
virB3
virB4
virB5
virB6
virB7
virB8
virB9
virB10
virB11
A. tumefaciens T-DNA
orf38
orf39
orf40
stbE
stbD
pir
bis
ddp3
orf50
parG
parF
orf53
B
R485 TP228
orf41
orf42
orf43
orf44
R6K
pOLA52
(30.8 - 40.6 kb)
pir
bis
ddp3
parG
parF
stbE
stbD
orf112+
Fig. 2. Genetic map of the putative conserved backbone regions of IncX plasmids pOLA52 and R6K and related regions located on other plasmids. Regions
include: (A) the putative conjugal transfer region (tra), (B) a conserved region of unknown function and a putative maintenance/stability region (x–stb–rep–
par) and (C) the putative gene expression modulation region (gem). Gray ORFs indicate that they were predicted in this study with Glimmer 3.02 while black
ORFs were located previously in other studies. The black and white squares indicate long inverted repeats (LIRs) that contain origins of conjugal transfer
(oriT), while black and white ovals indicate origins of vegetative replication (oriV). The underlined segment in (B) indicates a region not conserved in other
plasmids. Apart from the R6K nucleotide sequence which was downloaded from the Plasmid Sequencing Group at the Sanger Institute homepage (http://
www.sanger.ac.uk/Projects/Plasmids/), sequences were obtained from GenBank. The black X marks the location of a 2 bp discrepancy between the R6K
sequence from the Sanger institute and Accession No. AJ006342 in GenBank.
A. Norman et al. /Plasmid 60 (2008) 59–74 65

3.4. Genes encoding putative conjugation and T4SS
homologues (Mpf elements)
Type IV secretion systems (T4SS) participate in bacterial
conjugation via assembly of supramolecular trans-envelope
protein complexes which mediate cell-to-cell contact and
the transportation of macromolecules through pili or ‘mat-
ing pores’. In the archetypical T-DNA transfer system of phy-
topathogen Agrobacterium tumefaciens, the building blocks
of this complex are encoded by 11 virB genes (for reviews,
see Cascales and Christie, 2003; Christie et al., 2005).
The putative tra region of pOLA52 could be divided into
mating pair formation (Mpf) genes and DNA transfer and
replication (Dtr) genes. For convenience we have adopted
the pilx/tax nomenclature used in the R6K conjugation
apparatus for Mpf and Dtr genes, respectively (Avila
et al., 1996; Nunez et al., 1997 and unpublished observa-
tions, GenBank Accession No. AJ006342). Seven putative
Mpf genes encoded proteins which contained conserved
VirB domains. Several additional genes were arranged
together with these genes in what was predicted to be
a single large transcriptional unit spanning 12.5 kb
(actX
pOLA52
–orf20
pOLA52
), collinear with the arrangement
of many T4SS operons (Fig. 2A).
Analysis of the individual Mpf protein sequences in
pOLA52 for the presence of signal peptidase cleavage sites
and transmembrane-spanning helices (Table 5) also re-
vealed a good correlation with the proposed cellular loca-
tions of individual components in the A. tumefaciens T4SS
(Christie et al., 2005).
The actX
pOLA52
gene, located at the very beginning of the
Mpf operon, encodes a gene-product which is quite diver-
gent from ActX
R6K
, but contains conserved NusG- and
RfaH-family domains present in many antiterminator pro-
teins (Bailey et al., 1996). Weak homology was also de-
tected between ActX
pOLA52
and NusG of pCRY from
Yersinia pestis and ORF16 of p29930 from Yersinia entero-
colitica, also located at the beginning of putative Mpf oper-
ons (see below). Thus, it is likely that these proteins
constitute a family of transcriptional activators controlling
the expression of related Mpf systems.
The putative gene in the pilx5–pilx6 intergenic region
(eex
pOLA52
) encodes a small lipoprotein resembling Eex
R6K
which is consistent with the location of putative entry
exclusion genes in numerous Mpf operons (Galli et al.,
2001; Galli and Chen, 2006; Strauch et al., 2003). Entry
exclusion is thought to be a mechanism for preventing fur-
ther mating pair formation once the plasmid has been
established within a host (Zechner et al., 2000).
The small ORF located in the pilx7
pOLA52
–pilx6
pOLA52
intergenic region (orf28
pOLA52
) did not have homologues
in R6K or any related conjugation systems. It is therefore
possible that this gene was incorrectly identified as a cod-
ing region during annotation. The presence of a putative
transmembrane helix (Table 5), however, could suggest
that ORF28
pOLA52
is a hitherto uncharacterized protein
playing some role in mating pair formation.
The curious fusing of the VirB3 and VirB4 homologues
observed in pOLA52 (Pilx3–4) and R6K has also been re-
ported in the related Mpf systems of plasmids p29930
(TriC) from Y. enterocolitica, pCRY (VirB4) from Y. pestis,
pVT745 (MagB04) from Aggregatibacter actinomycetem-
comitans and the two plasmids pTet and pCC31 (CmgB3/
4) from Campylobacter jejuni and C. coli, respectively,
(Batchelor et al., 2004; Galli et al., 2001; Song et al.,
2004; Strauch et al., 2003). Apart from pCRY and p29930
which contain a Dtr region resembling the mob region of
the mobilizable plasmid CloDF13 (Nunez and de la Cruz,
2001; Strauch et al., 2003), these conjugation systems also
include significant homologues to the TaxB coupling pro-
teins and the TaxC relaxases in pOLA52 and R6K (see
below).
To probe the extent of VirB3/4 fusions in T4SS, a homol-
ogy search in GenBank was performed using queries
against known protein sequences (Blastp) and the trans-
lated database (tBlastn). This revealed a total of 21 signifi-
cant homologues to Pilx3–4
pOLA52
(apart from Pilx3–4
R6K
),
indicating a rather considerable phylogenetic clade where
this phenomenon has occurred (Fig. 3). Interestingly, all
Pilx3–4 homologues were encoded on plasmids or geno-
mic sequences from either Enterobacteriaceae or Campylo-
bacter with the exception of pVT745.
Table 5
Comparison of proteins associated with T4SS in pOLA52 from Eschericia coli and pTi from Agrobacterium tumefaciens analyzed with LipoP 1.0 and TMHMM 2.0
for the presence of signal peptidase I and II cleavage sites and transmembrane helices
pOLA52 pTi
Peptide Class
*
Cleavage site Cleavage pos. Peptide Class Cleavage site Cleavage pos.
Pilx1 SpI ASVHP;DTTHE 20–21 VirB1 SpI SSSLA;TPLSS 22–23
Pilx2 SpI EPAFA;DDVST 29–30 VirB2 SpI GPAAA;QSAGG 47–48
Pilx3–4 TMH (1) — — VirB3 TMH (1) — —
Pilx5 SpI SGAQA;GIPVA 21–22 VirB5 SpI QPAAA;QFVVS 23–24
Eex SpII FSLVG;CEETK 18–19 — — — —
Pilx6 TMH (7) — — VirB6 TMH (6) — —
ORF28 TMH (1) — — — — — —
Pilx7 SpII LCLAG;CQASH 15–16 VirB7 SpII VALSG;CQTND 14–15
Pilx8 TMH (1) — — VirB8 TMH (1)
Pilx9 SpI HVCNA;AVLPS 21–22 VirB9 SpI TGAGA;EDTPM 21–22
Pilx10 TMH (1) — — VirB10 TMH (1)
TaxB TMH (2) — — VirD4 TMH (2)
*
SpI: Signal peptidase I cleavage site (Secreted protein); SpII: Signal peptidase II cleavage site (Lipoprotein); TMH: Transmembrane helix (Transmem-
brane protein), numbers in parentheses following TMH indicate the number of TMHs found.
66 A. Norman et al. /Plasmid 60 (2008) 59–74

3.5. Genes encoding putative DNA transfer proteins (Dtr
elements)
Conjugal DNA transfer in Enterobacteriaceae is initiated
by the formation of a nucleoprotein complex called the
relaxosome at the origin of conjugal transfer (oriT). The
central component of the complex, the relaxase, nicks the
DNA at the cognate oriT which initiates the formation of
the transfer DNA strand. A so-called coupling protein sub-
sequently binds the processed DNA–protein complex and
translocates it to the Mpf pore which ensures transfer to
the recipient cell (Cabezón et al., 1997; Hamilton et al.,
2000).
The predicted Dtr proteins of pOLA52 (TaxA
pOLA52
,
TaxB
pOLA52
, TaxC
pOLA52
and DDP3
pOLA52
) were all strong or
significant homologues of R6K proteins (Table 2), and their
putative function was therefore deduced from previous
studies of these proteins. A rather curious feature of R6K
is that it contains two functional oriTs(oriTaor oriTb).
These are located 5.3 kb apart on separate strands within
two long inverted repeat (LIR) sequences. Both oriTs con-
tain strand nicking (nic) sites with a 5
0
-ATCCTGC-3
0
motif
(Avila et al., 1996). In pOLA52 we discovered two
100 bp LIRs located 5.5 kb apart which contained poten-
tial nic sites virtually identical to the R6K nic sites (Fig. 4).
Overall, the LIRs showed approximately 88% nucleotide
identity between pOLA52 and R6K, and it is therefore likely
that pOLA52 possesses two functional oriTs like R6K.
Remarkably, only two plasmids have been reported to
carry two oriTs up to this point: R6K and the otherwise
unrelated plasmid pAD1 of Enterococcus faecalis (Francia
et al., 2001). The purpose of having two oriTs remains un-
clear, although it entails that either strand of the plasmid
can be processed and transferred into the recipient cell.
In the case with R6K and pOLA52, it might be a necessary
feature for efficient conjugation of plasmids that carry
three origins of vegetative replication (see below).
In R6K, strand nicking is initiated by the TaxC
R6K
relax-
ase, a VirD2 homologue which catalyzes the cleavage of
either of the two nic sites. The putative coupling protein
TaxB
R6K
was both found to share sequence homology as
pOLA52
S. heidelberg SL486
R388 (TrwK)
pIPO2T (TraE)
R721 (TraE)
A. tumefaciens T-DNA (VirB4)
R46 (TraB)
R64 (TraU)
F (TraC)
R751 (TrbE)
RK2 (TrbE) pVT745
pCC31
pTet pCC178
pCU110
pCL46
p29930
pYptb32953
pESA2
pCRY
K. pneumoniae NTUH-K2044
C. coserii ATCC BAA-8
E. coli ECOR31
E. atroseptica SCRI1043
S. schwartzengrund SL480
S. boydii BS512
R6K
pOU1114
pOU1115
S. dublin CT_02021853
0.0010 Campylobacter
Enterobacteriaceae
VirB3/4
VirB4
Fig. 3. Phylogenetic tree based on alignments of VirB4-like components of various type IV secretion systems (T4SS). The alignment was made using
ClustalW and the tree was constructed using SplitsTree 4.8. The stippled line indicates sequences where VirB4 and VirB3 components have fused together
(VirB3/4) and are encoded by a single gene. The two shaded areas indicate that sequences were derived from plasmids or genomic sequences (strain names
in italic) from either the Campylobacter or Enterobacteriaceae families, respectively.
Fig. 4. Alignment of DNA sequences around the nic site of various plas-
mids. The position of the nic sites is indicated with the black arrow. Hi-
ghly conserved nucleotides are shaded black while less conserved bases
are shaded gray.
A. Norman et al. /Plasmid 60 (2008) 59–74 67

well as functionality to proteins of the TraG family (Nunez
et al., 1997). Two auxiliary proteins TaxA
R6K
(also known as
DNA distortion polypeptide 1), and DDP3
R6K
(DNA distor-
tion polypeptide 3), were also shown to be involved in con-
jugative DNA processing in R6K (Avila et al., 1996; Flashner
et al., 1996; Nunez et al., 1997). Based on sequence and
biochemical data available to them at the time, Núñez
et al. deduced that TaxA
R6K
was essential for TaxC
R6K
nick-
ing of supercoiled DNA, while DDP3
R6K
was proposed to be
involved in a sorting mechanism directing relaxosome pro-
teins to the appropriate oriT.
Thus it follows that conjugal DNA processing in pOLA52
and highly similar plasmids like pOU1114 and pOU1115 is
undertaken via a mechanism resembling R6K, which fur-
ther implies that the TaxA and DDP3-like proteins could
be uniquely associated with IncX plasmids.
Two small genes, which follow taxB
pOLA52
, encode a
putative export signal peptide with a TrbM-like motif
(ORF20
pOLA52
) and a putative lipoprotein (ORF21
pOLA52
),
respectively. The genes also resembled the magB14 and
magB13 gene pair in pVT745 (Galli et al., 2001) as well as
genes present in p29930 and pCRY. Furthermore, our anal-
ysis of the R6K sequence led to the discovery of two new
putative genes following taxB
R6K
(Fig. 2A), encoding homo-
logues with 37% and 70% percent similarity to ORF20
pOLA52
and ORF21
pOLA52
, respectively. These genes are therefore
relatively conserved among a number of related conjuga-
tion systems, although their function (if any) remains elu-
sive. It is notable, however, that the TraG-like coupling
proteins do not always keep synteny with these gene pairs
as demonstrated in pCRY and p29930, which could indi-
cate that ORF20 and ORF21 have functions independent
of the coupling protein.
3.6. Putative replication proteins (rep elements)
The extensively studied replication system of R6K has
served as a model of eubacterial multi-origin replication
for many years and is the only one studied among IncX
plasmids. The highly intricate mechanism involves three
origins of vegetative replication (oriV-a,-band -c)(Crosa,
1980; Crosa et al., 1976; Lovett et al., 1975), which has
so far been considered unique among plasmids. In R6K,
replication is regulated by the essential replication initia-
tor protein p
R6K
, which is encoded by the pir
R6K
gene (Inu-
zuka and Helinski, 1978). Furthermore an accessory
protein Bis
R6K
, encoded by the bis
R6K
gene, has been estab-
lished as an essential component for vegetative replication
from oriV-bin R6K (Mukhopadhyay et al., 1986; Shaffer-
man and Helinski, 1983).
The putative 1.3 kb rep locus of pOLA52 (Fig. 2B) con-
tained homologues of both genes (pir
pOLA52
and bis
pOLA52
),
and while the p
pOLA52
and Bis
pOLA52
proteins only showed
40% amino acid identity to p
R6K
and Bis
R6K
, they retained
>70% similarity. Furthermore, like pir
R6K
which encodes
both a 35.0 kDa and a 30.5 kDa protein due to multiple
translational start sites (Wu et al., 1997), the presence of
a putative RBS 87 bases into pir
pOLA52
indicates that it en-
codes both a 32.2 kDa protein and a smaller 28.3 kDa pro-
tein. A significant difference between pOLA52 and R6K,
however, is that the putative p
pOLA52
proteins are 27 amino
acids shorter than the p
R6K
proteins (Fig. 5A). In this con-
text it is interesting to note that the 27 C-terminal amino
acids have previously been deleted from p
R6K
without sig-
nificant change of functionality (Greener et al., 1990).
A closer examination of the amino acid sequences of
Bis
pOLA52
and Bis
R6K
revealed the presence of three pre-
dicted transmembrane helices in both proteins (Fig. 5B).
This would suggest that they are both membrane bound
proteins, although it seems unclear what this entails with
regard to replication.
Similar to other h-replicating iteron-containing plas-
mids (ICPs) (del Solar et al., 1998), the replication initiator
p
R6K
binds to a ‘core region’ of cognate tandem-repeat se-
quences, which in R6K consists of seven repeats (iterons)
of 22 bp in length, located within the oriV-c. The hypothet-
ical oriV-cof pOLA52 (Fig. 6) contained five 22 bp iterons
with an 11 bp gap between the second and third iterons.
Overall, the iterons in pOLA52 resembled the oriV-citerons
of R6K, although only 5 out of 22 bases were absolutely
conserved in both plasmids.
The p
R6K
protein regulates replication initiation in R6K
positively in monomeric form and negatively in dimeric
form by binding to the core region of the oriV-c(Bowers
et al., 2007; Kunnimalaiyaan et al., 2004; Zzaman et al.,
2004). Furthermore, the dimeric form can regulate nega-
tively by binding to inverted repeat (IR) sequences consist-
ing of weak half-iterons. An IR is located in an A+T rich
region upstream of the core region in R6K, and another
in the pir
R6K
operator (Kruger and Filutowicz, 2000; Lev-
chenko and Filutowicz, 1996). Incidentally, IRs resembling
half-iterons were also found in the A+T rich region and the
putative pir
pOLA52
promoter region of pOLA52 (Fig. 6).
In a recent study, six amino acids in p
R6K
were deduced,
from a history of available biochemical data, as being vital
for protein–iteron contact (Kunnimalaiyaan et al., 2007).
Interestingly, four of these amino acids (Tyr74, Gly131,
Gly211 and Arg254) were conserved in p
pOLA52
(Tyr71,
Gly132, Gly207, Arg250), while the remaining two (Ser71
and Arg225) had been replaced with similar amino acids
(Thr68 and Lys221) (Fig. 5A). A logical deduction of this
observation would be that this would lead to a slightly dif-
ferent binding sequence of the pOLA52 iterons which
seems to be supported by the fact that the essential p
R6K
-
binding iteron motif 5
0
-TGAGnG-3
0
(Urh et al., 1998) has
changed into 5
0
-TGGATn-3
0
in pOLA52 (Fig. 6). More data
is needed to substantiate this claim however, especially
since another study (Swan et al., 2006) derived a different
set of amino acids for protein–iteron contact from the crys-
tal structure of a p
R6K
/iteron complex.
As with R6K and most other ICPs (Krüger et al., 2004),
the putative core iterons of pOLA52 were located in imme-
diate proximity to an A+T rich region (Fig. 6), and several
potential binding sites for host encoded replication initia-
tion factor DnaA (DnaA-boxes) and the DNA-bending pro-
tein IHF. Two ‘perfect’ DnaA-boxes (5
0
-TTATCCACA-3
0
)
were located upstream of the A+T rich region, which could
indicate the presence of a replication enhancer sequence in
pOLA52 similar to the 106 bp enhancer described in R6K
(Wu et al., 1994, 1992). The location of DnaA boxes and rel-
atively strong potential IHF binding sites around the core
iterons would also suggest that the proposed model of
68 A. Norman et al. /Plasmid 60 (2008) 59–74

DNA strand melting at the ori-Vcin R6K (Abhyankar et al.,
2004, 2003) applies to the putative pOLA52 oriV-cas well.
Replication in R6K is most often initiated from either
the oriV-aor oriV-bin vivo (Crosa, 1980). This requires
the p
R6K
protein and the oriV-cin cis, and involves a compli-
cated DNA looping mechanism that ultimately seems to
deliver the host encoded replication factor DnaB helicase
to these origins (Abhyankar et al., 2004; Kelley and Bastia,
1992; Lu et al., 1998; Mukherjee et al., 1988). The oriV-a
and oriV-bof R6K contain a single weak iteron and a half
iteron, respectively. Furthermore, the oriV-a, located close
to the oriT-a, contains a conserved binding site for the host
encoded replication factor DnaG primase (Yoshi-hisa et al.,
1993). The pOLA52 region in proximity to the putative
oriT-aalso contains these two features (Fig. 6). Incidentally
the iteron and the DnaG site were separated by the exact
same distance in R6K and pOLA52 (74 bp). A putative weak
half-iteron was also located in the pir
pOLA52
–bis
pOLA52
inter-
genic region, collinear with one of the proposed locations
for the oriVbin R6K which has a weak half-iteron present
at the very 3
0
-end of in pir
R6K
(Crosa et al., 1978; Kelley
and Bastia, 1992). Thus, pOLA52 also seems to contain an
oriV-aand an oriV-b.
Although the overall homology between the backbones
of R6K and pOLA52 was only about 70% we seem to have
uncovered plenty of convergent data to suggest that
pOLA52 replicates via an orthologous mechanism, which
might be considered the ‘IncX1 replication mechanism’.
The finer intricacies of origin selection in pOLA52, how-
ever, remain to be discovered.
A phylogenetic comparison of ICP replication initiator
(Rep) proteins (Fig. 7) revealed that the pOLA52-type rep-
licon seems to be far more prevalent than R6K, in line with
the observations made above with the conjugation system,
and earlier studies of IncX plasmids. Curiously, the ppro-
teins of pOLA52 and R6K seem to occupy a relatively iso-
lated phylogenetic clade, with considerable divergence
between the two. The pOLA52 rep locus has also previously
been shown to be present on several plasmids obtained
from pig manure isolates collected in Scandinavia between
Fig. 5. (A) Alignment of the protein sequences of the replication initiator proteins pof plasmids R6K and pOLA52. Black shading indicates identical residues
while gray shading indicates similar residues. The residues of p
R6K
proposed as iteron contact points in Kunnimalaiyaan et al. (2007) are indicated with
black triangles. The arrow indicates the proposed alternative translational start sites for low-molecular weight (indicated in kDa) versions of pin both
plasmids. (B) Alignment of the Bis proteins of R6K and pOLA52. Three putative transmembrane helices (TMH) predicted with TMHMM 2.0 in both proteins
are indicated with black lines.
A. Norman et al. /Plasmid 60 (2008) 59–74 69

1995 and 1998 (Hansen et al., 2005), which again supports
the notion that IncX1 plasmids are more prevalent than
IncX2 plasmids.
3.7. Genes encoding active partitioning (par) and post-
segregation killing (stb) elements
Active partitioning ensures the appropriate distribution
of plasmids to daughter cells before cell division, and is a
vital factor for ensuring plasmid stability of larger plasmids
(Funnel and Slavcev, 2004). In pOLA52 active partition
seems to be undertaken by a Type Ib par locus (Ebersbach
and Gerdes, 2005), which as noted above, was virtually
identical to the parFG locus of TP228 (Fig. 2B). The par locus
of TP228 has received considerable attention in recent
years (Barilla et al., 2007; Golovanov et al., 2003; Hayes,
2000; Hayes and Barilla, 2006). The two loci contained
about 4% nucleotide mismatches when compared. This,
however, only resulted in a single I204M substitution in
ParF
pOLA52
. The putative par locus in R6K only encoded
weak homologues to these partitioning proteins (29% sim-
ilarity to ParG and 44% similarity to ParF). Homology be-
tween a gene located upstream of the putative par region
in R6K, however, encoded a resolvase-like protein 90% sim-
ilar to ORF53
pOLA52
, which also seems to be present in
TP228, based on a partial ORF-fragment (orf112+
TP228
) with
99% gene-product similarity to ORF53
pOLA52
. ORF50 also
contained partial ParA and Soj motifs which are conserved
in several plasmid partitioning proteins, but the putative
protein itself did not show significant homology to any
known partitioning proteins. Furthermore orf50 was lo-
cated within the pOLA52 segment spanning bases
37.1 kb–38.6 kb which did not appear to be part of the con-
served IncX1 backbone as mentioned above.
Further stability of pOLA52 seems to be ensured by a TA
plasmid addiction system (stb locus), which encodes a tox-
in that degrades slower than the cognate antitoxin and
thus kills plasmid-free daughter cells (Gerdes et al.,
2005). The two putative stb genes were almost identical
to the stbDE locus of R485 which is related to the RelB/RelE
system of E. coli (Hayes, 1998).
3.8. Other putative genes encoding possible maintenance
functions
A DNA segment located 1 kb downstream of the large
putative Mpf operon contained three linked ORFs encod-
ing a putative type IA topoisomerase (topB), a putative
transcriptional regulator (hha) and a putative DNA-bind-
ing protein (hns). The TopB topoisomerase strongly
resembles the YdgA protein of the IncI2 plasmid R721
(which also encodes the Hha paralogue YdfA) but also
100 bp
A+T rich
R6K
βγα G
3.4 kb
1.1 Kb
74 bp
taxA
pir
pOLA52
βα
pir
G
bk 1.1bk 7.3
74 bp
taxA
A
A+T rich
A
γ
bis
bis
Fig. 6. Overview of the three putative origins of replication oriV-a,-bor -cin plasmid pOLA52 compared with plasmid R6K. Large arrows indicate strong
iteron sequences while smaller arrows indicate weaker iterons. Shorter arrows indicate half-iterons. Sequences of iterons are indicated below the arrows.
Gray letters indicate bases different from the conserved core iterons in the oriV-c. Black boxes indicate the locations of binding sites for Escherichia coli DnaA
replication initiator protein, while gray rectangles indicate binding sites for the integration host factor IHF as predicted by Virtual Footprint (http://
www.prodoric.de/vfp/). A indicates ‘perfect’ DnaA boxes (5
0
-TTATCCACA-3
0
), while G indicates a putative binding site for the host encoded DnaG primase.
70 A. Norman et al. /Plasmid 60 (2008) 59–74

resembles the chromosomally encoded Topoisomerase III
of E. coli.
This 1 kb region was also highly conserved in the
pOU1114 and pOU1115 plasmids, and similar DNA seg-
ments were located in p29930 (Strauch et al., 2003) and
R6K, although the latter two did not encode Hha homo-
logues (Fig. 2C). The hha and hns genes encode homologues
to the chromosomally encoded E. coli proteins Hha and H-
NS, respectively. In the IncHI1 plasmid R27 an encoded
Hha/H-NS pair has also been shown to modulate plasmid
transfer in a temperature-dependent manner (Forns
et al., 2005). Hha and H-NS paralogues have also been
shown to form complexes in Enterobacteriaceae that mod-
ulate gene expression globally (Madrid et al., 2007). H-NS
proteins in particular have been studied intensely in recent
years, and have been proposed as pleiotropic repressors of
transcription which, among other things, repress genes ac-
quired by horizontal gene transfer by targeting low G+C re-
gions (xenogenic silencing) (Dorman, 2007; Navarre et al.,
2007). A recent study (Doyle et al., 2007) also proposed
that a hns paralogue located on the IncHI1 plasmid pSf-
R27 was a ‘stealth gene’ that allows smooth introduction
of foreign DNA by countering the effects of titration of
chromosomally encoded H-NS protein on the host. In this
context it is interesting to note that the TopB topoisomer-
ase is also a paralogue of a chromosomally encoded pro-
tein. In the incP1 plasmid RP4, the similar TraE
topoisomerase could be substituted completely by the
chromosomally encoded Topoisomerase III (Li et al.,
1997). This seems to corroborate that the gene cassette
topB-hns acts as a conserved ‘stealth module’ adapted to
Enterobacteriaceae which stabilizes horizontal transfer of
plasmid DNA. We have proposed the name ‘gene expres-
sion modulation’ (gem) to indicate this putative locus in
Fig. 1.
The ‘x’ locus located between the tra and rep regions
(Fig. 2B) had five homologues in R6K encoding proteins
with between 50% and 80% similarity to ORF38-44. Three
of these also showed significant homology to hypothetical
proteins arranged in a similar gene cluster in R721. Fur-
RK2 pMJ101
pRSF1010
Rts1
P1
R6K
pOLA52
S. heidelberg SL486
pOU1114
pOU1115
S. dublin CT02021853
S. kentucky CVM29188
S. boydii B512
F
R46
pYptb32953
pRO1614
pCM1
pFA3
pYC
pSC101
pPS10
0.1
Fig. 7. Phylogenetic tree based on alignments of Rep proteins of various iteron-controlled plasmids or genomic sequences (strain names in italic). Alig-
nments were made with ClustalW and the tree was constructed using SplitsTree 4.8. Protein sequences were obtained from GenBank either directly or by
translating nucleotide sequences of putative genes located with Glimmer 3.02.
A. Norman et al. /Plasmid 60 (2008) 59–74 71

thermore, as indicated above the whole ‘x’ locus was pres-
ent in pOU1114 and pOU1115 and therefore seems to con-
stitute an unknown conserved group of genes, which may
or may not play a role in plasmid maintenance.
3.9. The ’genetic load’ region
Analysis of the putative ‘genetic load’ region revealed
the presence of several insertion sequences (Fig. 8). Three
were identified as IS26, two IS1, one a partial IS903 with
84 bases missing from the center, and finally a 238 bp se-
quence appeared to be a truncated 5’-half of an ISEcp1-like
sequence (87% identity). A 5.1 kb DNA segment containing
the oqxAB casette was flanked by IS26 sequences and
therefore constitutes a composite transposon (Tn6010).
Similarly the 5.6 kb mrkABCDF casette was flanked by IS1
sequences (Tn6011). The mrkABCDF cassette has also been
found very recently on a conjugative plasmid in a uropath-
ogenic strain E. coli (Ong et al., 2008). As mentioned above,
both the oqxAB and mrkABCDF cassettes were almost com-
pletely identical to segments of the K. pneumoniae
MGH78578 genome. The putative regulator gene orf68
was also part of Tn6010 which means that it would stem
from the same K. pneumoniae genome as the oqxAB genes.
The level of involvement of this putative regulator on the
expression of the oqxAB operon, however, remains to be
discovered.
The ‘genetic load’ region also contained a fragmented
Tn3transposon which was interrupted by several DNA seg-
ments, including the Tn6010 transposon. The Tn3TEM-1 b-
lactamase (bla) and its P3 promoter (Lartigue et al., 2002)
were intact, but the transposase and resolvase elements
had been heavily truncated due to the loss of two 1kb
fragments. The Tn3was also interrupted by a small
2.3 kb cassette, flanked by insertion sequence IS26 and a
partial ISEcp1-like sequence. This small cassette contained
a small piece of the Tn3transposase and three ORFs which
included an N-terminal truncated bleomycin resistance
gene (blmS) and a gene encoding a hypothetical protein
(orf63). Since pOLA52 does not confer resistance towards
bleomycin it must be assumed that this truncated protein
does not function, either as a consequence of the missing
N-terminal residues or due to the lack of a promoter-
sequence.
4. Concluding remarks
The sequencing and annotation of pOLA52 followed by
classic incompatibility testing has established a conserved
backbone of IncX1 plasmids with considerable prevalence
in Enterobacteriaceae. It is to the best of our knowledge
the first description of the complete sequence of a plasmid
from the IncX1 incompatibility group. Apart from an
apparent orthologue to the triple-origin replication system
of R6K and a typical T4SS conjugation apparatus, the IncX1
backbone seems to have evolved several stabilizing mech-
anisms including a TA plasmid addiction system, a parti-
tioning system, as well as a putative ‘stealth’ region. In
comparison with the IncX2 plasmid R6K, which did not
seem to contain a TA system it would therefore seem that
the higher prevalence of IncX1 plasmids is due to the pres-
ence of additional plasmid stabilizing loci.
Our analysis of the ‘genetic load’ region of pOLA52 re-
vealed that the MDR and biofilm phenotypes encoded by
the plasmid seem to be the result of the capture of two
chromosomal cassettes from Klebsiella spp. into composite
transposons (Tn6010 and Tn6011).
The presence of these composite transposons has previ-
ously been shown to encode phenotypic traits that in-
crease host cell fitness and attachment in different
environments. This implicitly aids in further increasing
the stability and prevalence of IncX1 plasmids such as
pOLA52.
References
Abhyankar, M.M., Reddy, J.M., Sharma, R., Bullesbach, E., Bastia, D., 2004.
Biochemical investigations of control of replication initiation of
plasmid R6K. Journal of Biological Chemistry 279, 6711–6719.
21 kb
IS26RIS26L
ISEcp1-like
fragment
oqxA oqxB mrkF mrkD mrkC
IS1L
mrkAmrkB
IS1R
IS903 fragments
bla
orf68
IS26L
blmS orf63 orf15
1. bp of pOLA52
Tn3
blapinRtnpR
Tn6010 Tn6011
pCoo*-like
fragment
Fig. 8. Genetic map of the putative ‘genetic load’ region of pOLA52 containing the two composite transposons Tn6010 and Tn6011. Transposon Tn6010 is
flanked by IS26 insertion sequences, while Tn6011 is flanked by IS1sequences. The region also contains a small fragment with 87% nucleotide identity to
ISEcp1 and an IS903 fragment with 80 nucleotides missing from the middle. The transposon Tn3is shown to indicate the degree of fragmentation of Tn3in
the genetic load region of pOLA52 where only the b-lactamase gene (bla) has remained intact.
72 A. Norman et al. /Plasmid 60 (2008) 59–74

Abhyankar, M.M., Zzaman, S., Bastia, D., 2003. Reconstitution of R6K DNA
replication in vitro using 22 purified proteins. Journal of Biological
Chemistry 278, 45476–45484.
Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W.,
Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs. Nucleic Acids Research 25, 3389–
3402.
Avila, P., Nunez, B., de la, C.F., 1996. Plasmid R6K contains two functional
oriTs which can assemble simultaneously in relaxosomes in vivo.
Journal of Molecular Biology 261, 135–143.
Bailey, M.J.A., Hughes, C., Koronakis, V., 1996. Increased distal gene
transcription by the elongation factor RfaH, a specialized homologue
of NusG. Molecular Microbiology 22, 729–737.
Barilla, D., Carmelo, E., Hayes, F., 2007. The tail of the ParG DNA
segregation protein remodels ParF polymers and enhances ATP
hydrolysis via an arginine finger-like motif. Proceedings of the
National Academy of Sciences of the United States of America 104,
1811–1816.
Batchelor, R.A., Pearson, B.M., Friis, L.M., Guerry, P., Wells, J.M., 2004.
Nucleotide sequences and comparison of two large conjugative
plasmids from different Campylobacter species. Microbiology 150,
3507–3517.
Bowers, L.M., Kruger, R., Filutowicz, M., 2007. Mechanism of origin
activation by monomers of R6K-encoded pprotein. Journal of
Molecular Biology 368, 928–938.
Bradley, D.E., 1980. Morphological and serological relationships of
conjugative pili. Plasmid 4, 155–169.
Burmølle, M., Bahl, M.I., Jensen, L.B., Sørensen, S.J., Hansen, L.H., 2008.
Type 3 fimbriae, encoded by the conjugative plasmid pOLA52,
enhance biofilm formation and transfer frequencies in
Enterobacteriaceae strains. Microbiology 154, 187–195.
Cabezón, E., Sastre, J.I., de la Cruz, F., 1997. Genetic evidence of a coupling
role for the TraG protein family in bacterial conjugation. Molecular
and General Genetics MGG 254, 400–406.
Cascales, E., Christie, P.J., 2003. The versatile bacterial Type IV secretion
systems. Nature Reviews Microbiology 1, 137–149.
Christie, P.J., Atmakuri, K., Krishnamoorthy, V., Jakubowski, S., Cascales, E.,
2005. Biogenesis, architecture, and function of bacterial type IV
secretion systems. Annual Review of Microbiology 59, 451–485.
Couturier, M., Bex, F., Bergquist, P.L., Maas, W.K., 1988. Identification and
classification of bacterial plasmids. Microbiology and Molecular
Biology Reviews 52, 375–395.
Crosa, J.H., 1980. Three origins of replication are active in vivo in the R
plasmid RSF1040. Journal of Biological Chemistry 255, 11075–11077.
Crosa, J.H., Luttropp, L.K., Falkow, S., 1976. Mode of replication of the
conjugative R-plasmid RSF1040 in Escherichia coli. Journal of
Bacteriology 126, 454–466.
Crosa, J.H., Luttropp, L.K., Falkow, S., 1978. Molecular cloning of
replication and incompatibility regions from the R-plasmid R6K.
Journal of Molecular Biology 124, 443–468.
D’Costa, V.M., McGrann, K.M., Hughes, D.W., Wright, G.D., 2006. Sampling
the antibiotic resistome. Science 311, 374–377.
Datta, N., Hughes, V.M., 1983. Plasmids of the same Inc groups in
Enterobacteria before and after the medical use of antibiotics. Nature
306, 616–617.
del Solar, G., Giraldo, R., Ruiz-Echevarria, M.J., Espinosa, M., az-Orejas, R.,
1998. Replication and control of circular bacterial plasmids.
Microbiology and Molecular Biology Reviews 62, 434–464.
Delcher, A.L., Harmon, D., Kasif, S., White, O., Salzberg, S.L., 1999.
Improved microbial gene identification with GLIMMER. Nucleic
Acids Research 27, 4636–4641.
Delcher, A.L., Bratke, K.A., Powers, E.C., Salzberg, S.L., 2007. Identifying
bacterial genes and endosymbiont DNA with Glimmer. Bioinformatics
btm009.
Dorman, C.J., 2007. H-NS, the genome sentinel. Nature Reviews
Microbiology 5, 157–161.
Doyle, M., Fookes, M., Ivens, A., Mangan, M.W., Wain, J., Dorman, C.J.,
2007. An H-NS-like stealth protein aids horizontal DNA transmission
in bacteria. Science 315, 251–252.
Ebersbach, G., Gerdes, K., 2005. Plasmid segregation mechanisms. Annual
Review of Genetics 39, 453–479.
Emanuelsson, O., Brunak, S., von Heijne, G., Nielsen, H., 2007. Locating
proteins in the cell using TargetP, SignalP and related tools. Nature
Protocols 2, 953–971.
Flashner, Y., Shlomai, J., Shafferman, A., 1996. Three novel plasmid R6K
proteins act in concert to distort DNA within the alpha and beta
origins of DNA replication. Molecular Microbiology 19, 985–996.
Forns, N., Banos, R.C., Balsalobre, C., Juarez, A., Madrid, C., 2005.
Temperature-dependent conjugative transfer of R27: role of
chromosome- and plasmid-encoded Hha and H-NS proteins. The
Journal of Bacteriology 187, 3950–3959.
Francia, M.V., Haas, W., Wirth, R., Samberger, E., Muscholl-Silberhorn, A.,
Gilmore, M.S., Ike, Y., Weaver, K.E., An, F.Y., Clewell, D.B., 2001.
Completion of the nucleotide sequence of the Enterococcus faecalis
conjugative virulence plasmid pAD1 and identification of a second
transfer origin. Plasmid 46, 117–127.
Froehlich, B., Parkhill, J., Sanders, M., Quail, M.A., Scott, J.R., 2005. The
pCoo plasmid of enterotoxigenic Escherichia coli is a mosaic
cointegrate. The Journal of Bacteriology 187, 6509–6516.
Frost, L.S., Leplae, R., Summers, A.O., Toussaint, A., 2005. Mobile genetic
elements: the agents of open source evolution. Nature Reviews
Microbiology 3, 722–732.
Funnel, B.E., Slavcev, R.A., 2004. Partition systems of bacterial plasmids.
In: Funnel, B.E., Phillips, G.J. (Eds.), Plasmid Biology. ASM Press,
Washington, DC, pp. 81–103.
Galli, D.M., Chen, J., 2006. Entry exclusion activity on conjugative plasmid
pVT745. Plasmid 55, 158–163.
Galli, D.M., Chen, J., Novak, K.F., Leblanc, D.J., 2001. Nucleotide sequence
and analysis of conjugative plasmid pVT745. The Journal of
Bacteriology 183, 1585–1594.
Gerdes, K., Christensen, S.K., Lobner-Olesen, A., 2005. Prokaryotic toxin/
antitoxin stress response loci. Nature Reviews Microbiology 3, 371–
382.
Golovanov, A.P., Barilla, D., Golovanova, M., Hayes, F., Lian, L.Y., 2003.
ParG, a protein required for active partition of bacterial plasmids, has
a dimeric ribbon-helix-helix structure. Molecular Microbiology 50,
1141–1153.
Gordon, D., Abajian, C., Green, P., 1998. Consed: a graphical tool for
sequence-finishing. Genome Research 8, 195–202.
Greener, A., Filutowicz, M.S., McEachern, M.J., Helinski, D.R., 1990. N-
terminal truncated forms of the bifunctional pinitiation protein
express negative activity on plasmid R6K replication. Molecular and
General Genetics MGG 224, 24–32.
Hamilton, C.M., Lee, H., Li, P.L., Cook, D.M., Piper, K.R., von Bodman, S.B.,
Lanka, E., Ream, W., Farrand, S.K., 2000. TraG from RP4 and TraG and
VirD4 from Ti Plasmids Confer Relaxosome Specificity to the Conjugal
Transfer System of pTiC58. The Journal of Bacteriology 182, 1541–
1548.
Hansen, L.H., Johannesen, E., Burmølle, M., Sørensen, A.H., Sørensen, S.J.,
2004. Plasmid-encoded multidrug efflux pump conferring resistance
to olaquindox in Escherichia coli. Antimicrobial Agents and
Chemotherapy 48, 3332–3337.
Hansen, L.H., Jensen, L.B., Sørensen, H.I., Sørensen, S.J., 2007. Substrate
specificity of the OqxAB multidrug resistance pump in Escherichia coli
and selected enteric bacteria. Journal of Antimicrobial Chemotherapy
60, 145–147.
Hansen, L.H., Sørensen, S.J., Jørgensen, H.S., Jensen, L.B., 2005. The
Prevalence of the OqxAB multidrug efflux pump amongst
olaquindox-resistant Escherichia coli in pigs. Microbial Drug
Resistance 11, 378–382.
Harbottle, H., Thakur, S., Zhao, S., White, D.G., 2006. Genetics of
antimicrobial resistance. Animal Biotechnology 17, 111–124.
Hayes, F., 1998. A family of stability determinants in pathogenic bacteria.
The Journal of Bacteriology 180, 6415–6418.
Hayes, F., 2000. The partition system of multidrug resistance plasmid
TP228 includes a novel protein that epitomizes an evolutionarily
distinct subgroup of the ParA superfamily. Molecular Microbiology
37, 528–541.
Hayes, F., Barilla, D., 2006. The bacterial segrosome: a dynamic
nucleoprotein machine for DNA trafficking and segregation. Nature
Reviews Microbiology 4, 133–143.
Huson, D.H., Bryant, D., 2006. Application of phylogenetic networks in
evolutionary studies. Molecular Biology and Evolution 23, 254–267.
Inuzuka, M., Helinski, D.R., 1978. Requirement of a plasmid-encoded
protein for replication in vitro of plasmid R6K. Proceedings of the
National Academy of Sciences of the United States of America 75,
5381–5385.
Jones, C.S., Osborne, D.J., Stanley, J., 1993. Molecular comparison of the
IncX plasmids allows division into IncX1 and IncX2 subgroups.
Journal of General Microbiology 139, 735–741.
Juncker, A.S., Willenbrock, H., von Heijne, G., Brunak, S., Nielsen, H., Krogh,
A., 2003. Prediction of lipoprotein signal peptides in Gram-negative
bacteria. Protein Science 12, 1652–1662.
Kelley, W.L., Bastia, D., 1992. Activation in vivo of the minimal replication
origin beta of plasmid R6K requires a small target sequence essential
for DNA looping. New Biologist 4, 569–580.
Krogh, A., Larsson, B., von Heijne, G., Sonnhammer, E.L.L., 2001. Predicting
transmembrane protein topology with a hidden markov model:
A. Norman et al. /Plasmid 60 (2008) 59–74 73

application to complete genomes. Journal of Molecular Biology 305,
567–580.
Kruger, R., Filutowicz, M., 2000. Dimers of pi protein bind the ARich region
of the R6K gamma origin near the leading-strand synthesis start sites:
regulatory implications. The Journal of Bacteriology 182, 2461–2467.
Krüger, R., Rakowski, S.A., Filutowicz, M., 2004. Participating elements in
the replication of iteron-containing plasmids. In: Funnel, B.E., Phillips,
G.J. (Eds.), Plasmid Biology. ASM Press, Washington, DC, pp. 25–45.
Kunnimalaiyaan, S., Kruger, R., Ross, W., Rakowski, S.A., Filutowicz, M.,
2004. Binding modes of the initiator and inhibitor forms of the
replication protein pto the cori iteron of plasmid R6K. Journal of
Biological Chemistry 279, 41058–41066.
Kunnimalaiyaan, S., Rakowski, S.A., Filutowicz, M., 2007. Structure-based
functional analysis of the replication protein of plasmid R6K: key
amino acids at the p/DNA interface. The Journal of Bacteriology 189,
4953–4956.
Kurtz, S., Schleiermacher, C., 1999. REPuter: fast computation of maximal
repeats in complete genomes. Bioinformatics 15, 426–427.
Lartigue, M.F., Leflon-Guibout, V., Poirel, L., Nordmann, P., Nicolas-
Chanoine, M.H., 2002. Promoters P3, Pa/Pb, P4, and P5 upstream
from bla TEM genes and their relationship to b-Lactam resistance.
Antimicrobial Agents and Chemotherapy 46, 4035–4037.
Levchenko, I., Filutowicz, M., 1996. Initiator protein pi can bind
independently to two domains of the gamma origin core of plasmid
R6K: the direct repeats and the Arich segment. Nucleic Acids Research
24, 1936–1942.
Li, Z., Hiasa, H., Kumar, U., DiGate, R.J., 1997. The traE gene of plasmid RP4
encodes a homologue of Escherichia coli DNA topoisomerase III.
Journal of Biological Chemistry 272, 19582–19587.
Lovett, M.A., Sparks, R.B., Helinski, D.R., 1975. Bidirectional replication of
plasmid R6K DNA in Escherichia coli; correspondence between origin
of replication and position of single-strand break in relaxed complex.
Proceedings of the National Academy of Sciences of the United States
of America 72, 2905–2909.
Lu, Y.B., Datta, H.J., Bastia, D., 1998. Mechanistic studies of initiator-
initiator interaction and replication initiation. EMBO J. 17, 5192–
5200.
Madrid, C., Garcia, J., Pons, M., Juarez, A., 2007. Molecular evolution of the
H-NS protein: interaction with Hha-like proteins is restricted to
enterobacteriaceae. The Journal of Bacteriology 189, 265–268.
Mukherjee, S., Erickson, H., Bastia, D., 1988. Enhancer-origin interaction in
plasmid R6K involves a DNA loop mediated by initiator protein. Cell
52, 375–383.
Mukhopadhyay, P., Filutowicz, M., Helinski, D.R., 1986. Replication from
one of the three origins of the plasmid R6K requires coupled
expression of two plasmid-encoded proteins. Journal of Biological
Chemistry 261, 9534–9539.
Navarre, W.W., McClelland, M., Libby, S.J., Fang, F.C., 2007. Silencing of
xenogeneic DNA by H-NS–facilitation of lateral gene transfer in
bacteria by a defense system that recognizes foreign DNA. Genes and
Development 21, 1456–1471.
Needleman, S.B., Wunsch, C.D., 1970. A general method applicable to the
search for similarities in the amino acid sequence of two proteins.
Journal of Molecular Biology 48, 443–453.
Nunez, B., Avila, P., de la Cruz, F., 1997. Genes involved in conjugative DNA
processing of plasmid R6K. Molecular Microbiology 24, 1157–1168.
Nunez, B., de la Cruz, F., 2001. Two atypical mobilization proteins are
involved in plasmid CloDF13 relaxation. Molecular Microbiology 39,
1088–1099.
Ong, C.L., Ulett, G.C., Mabbett, A.N., Beatson, S.A., Webb, R.I., Monaghan,
W., Nimmo, G.R., Looke, D.F., McEwan, A.G., Schembri, M.A., 2008.
Identification of Type 3 fimbriae in uropathogenic Escherichia coli
reveals a role in biofilm formation. The Journal of Bacteriology 190,
1054–1063.
Paterson, D.L., 2006. Resistance in gram-negative bacteria:
enterobacteriaceae. American Journal of Infection Control 34, S20–S28.
Prager, R., Tietze, E., Tschape, H., 1988. DNA fingerprinting of conjugative
plasmids incompatible with R6K (IncX). Journal of Basic Microbiology
28, 385–388.
Reese, M.G., 2001. Application of a time-delay neural network to
promoter annotation in the Drosophila melanogaster genome.
Computers and Chemistry 26, 51–56.
Rutherford, K., Parkhill, J., Crook, J., Horsnell, T., Rice, P., Rajandream, M.A.,
Barrell, B., 2000. Artemis: sequence visualization and annotation.
Bioinformatics 16, 944–945.
Salzberg, S.L., Delcher, A.L., Kasif, S., White, O., 1998. Microbial gene
identification using interpolated Markov models. Nucleic Acids
Research 26, 544–548.
Sambrook, J., Russell, D.W., 2001. Molecular Cloning a Laboratory Manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
Shafferman, A., Helinski, D.R., 1983. Structural properties of the beta
origin of replication of plasmid R6K. Journal of Biological Chemistry
258, 4083–4090.
Song, Y., Tong, Z., Wang, J., Wang, L., Guo, Z., Han, Y., Zhang, J., Pei, D.,
Zhou, D., Qin, H., Pang, X., Han, Y., Zhai, J., Li, M., Cui, B., Qi, Z., Jin, L.,
Dai, R., Chen, F., Li, S., Ye, C., Du, Z., Lin, W., Wang, J., Yu, J., Yang, H.,
Wang, J., Huang, P., Yang, R., 2004. Complete genome sequence of
Yersinia pestis strain 91001, an isolate avirulent to humans. DNA
Research 11, 179–197.
Sørensen, A.H., Hansen, L.H., Johannesen, E., Sørensen, S.J., 2003.
Conjugative plasmid conferring resistance to olaquindox.
Antimicrobial Agents and Chemotherapy 47, 798–799.
Strauch, E., Goelz, G., Knabner, D., Konietzny, A., Lanka, E., Appel, B., 2003.
A cryptic plasmid of Yersinia enterocolitica encodes a conjugative
transfer system related to the regions of CloDF13 Mob and IncX Pil.
Microbiology 149, 2829–2845.
Swan, M.K., Bastia, D., Davies, C., 2006. Crystal structure of pinitiator
protein-iteron complex of plasmid R6K: implications for initiation of
plasmid DNA replication. Proceedings of the National Academy of
Sciences of the United States of America 103, 18481–18486.
Thomas, C.M., Nielsen, K.M., 2005. Mechanisms of, and barriers to,
horizontal gene transfer between bacteria. Nature Reviews
Microbiology 3, 711–721.
Urh, M., Wu, J., Wu, J., Forest, K., Inman, R.B., Filutowicz, M., 1998.
Assemblies of replication initiator protein on symmetric and
asymmetric DNA sequences depend on multiple protein
oligomerization surfaces. Journal of Molecular Biology 283, 619–
631.
Wu, F., Levchenko, I., Filutowicz, M., 1994. Binding of DnaA protein to a
replication enhancer counteracts the inhibition of plasmid R6K
gamma origin replication mediated by elevated levels of R6K pi
protein. The Journal of Bacteriology 176, 6795–6801.
Wu, F., Goldberg, I., Filutowicz, M., 1992. Roles of a 106-bp origin
enhancer and Escherichia coli DnaA protein in replication of plasmid
R6K. Nucleic Acids Research 20, 811–817.
Wu, J., Sektas, M., Chen, D., Filutowicz, M., 1997. Two forms of replication
initiator protein: positive and negative controls. Proceedings of the
National Academy of Sciences of the United States of America 94,
13967–13972.
Yoshi-hisa, K., Ken-ichi, A., Hisao, M., 1993. Roles of the G site and UX174-
type primosome assembly site in priming of leading-strand synthesis:
initiation by a mobile primosome and replication-fork arrest by RepA
protein bound to oriR. Gene 126, 9–16.
Zechner, E.L., de la Cruz, F., Eisenbrandt, R., Grahn, G., Lanka, E., Muth, G.,
Pansegrau, W., Thomas, C.M., Wilkins, B.M., Zatyka, M., 2000.
Conjugative-DNA processes. In: Thomas, C.M. (Ed.), The Horizontal
Gene Pool. Harwood Academic Publishers, Amsterdam, Netherlands,
pp. 87–174.
Zzaman, S., Reddy, J.M., Bastia, D., 2004. The DnaK-DnaJ-GrpE chaperone
system activates inert wild type pinitiator protein of R6K into a form
active in replication initiation. Journal of Biological Chemistry 279,
50886–50894.
74 A. Norman et al. /Plasmid 60 (2008) 59–74