Content uploaded by Sneha Ratnapriya
Author content
All content in this area was uploaded by Sneha Ratnapriya on Apr 29, 2022
Content may be subject to copyright.
Immunotherapeutic potential of Leishmania (Leishmania)donovani Th1
stimulatory proteins against experimental visceral leishmaniasis
Keerti
a
, Narendra K. Yadav
a
, Sumit Joshi
b
, Sneha Ratnapriya
a
, Amogh A. Sahasrabuddhe
a
,
Anuradha Dube
b,
⇑
a
Division of Molecular & Structural Biology, CSIR – Central Drug Research Institute, Lucknow 226031, India
b
Division of Parasitology, CSIR – Central Drug Research Institute, Lucknow 226031, India
article info
Article history:
Received 14 October 2017
Received in revised form 22 January 2018
Accepted 12 March 2018
Available online 21 March 2018
Keywords:
Visceral leishmaniasis
Th1 stimulatory proteins
Vaccination
Immunotherapeutic
Hamsters
abstract
An effective therapeutic vaccination strategy is required for controlling visceral leishmaniasis (VL), a fatal
systemic disease, through boosting the immunosuppressed state in Leishmania-infected individuals, as
the majority of them living in the endemic regions exhibit either subclinical or asymptomatic infection
which further often develops into a full-blown disease. Previously in our laboratory, several Th1
stimulatory recombinant proteins were successfully cloned, purified and assessed for their prophylactic
efficacy against Leishmania challenge. Due to their immunostimulatory property, these proteins are
needed to be evaluated for their immunotherapeutic potential in Leishmania-infected hamsters. Four pro-
teins namely, aldolase, enolase, p45 and triose phosphate isomerase were taken up to immunize animals
at different doses (50, 25 and 12.5
l
g/animal). Immunization with lower doses of aldolase and enolase,
i.e., 25 and 12.5
l
g showed a significant decline (!60%) in parasitic load along with an enhanced cellular
immune response. These findings indicate that vaccination with above -stated Th1 stimulatory proteins is
an effective immunotherapeutic approach against experimental VL. However, their efficacies may further
be improved in combination with known therapeutic regimens or immunomodulators.
!2018 Elsevier Ltd. All rights reserved.
1. Introduction
Visceral leishmaniasis (VL), described as a phlebotomine-borne
systemic infectious disease, caused by an obligate protozoan para-
site of Leishmania (Leishmania) donovani complex [1]. World Health
Organization (WHO) has reported that from the annual 50,000 to
90,000 VL cases, nearly 90% are from the underprivileged commu-
nities belonging to the regions of Indian sub-continent
(Bangladesh, Nepal, and India), Africa (Ethiopia, Sudan, and South
Sudan), and South America (Brazil) [1]. The available chemothera-
peutics for VL are quite effective, however; several concerns such
as toxicity, deleterious side effects [2], the emergence of drug resis-
tance cases [3] and variation in clinical responses due to geograph-
ical distribution [4] enforce the need for the search of alternative
treatment(s).
For the past several years, much consideration has been given to
the vaccine development program against VL wherein many of the
potential protein antigens of L. (L.) donovani have been used pro-
phylactically with varied success [5,6]. However, a commercial
human VL vaccine still remains elusive [7]. It is observed that the
population manifesting L. (L.) donovani infection with clinical
symptoms represent only a small proportion while the majority
of the individuals remain asymptomatic and act as potent threats
for the spread of this deadly disease [8,9]. Furthermore, post
kala-azar dermal leishmaniasis (PKDL), as well as Leishmania
HIV-co-infected individuals, lead to more number of treatment
failures resulting in relapse cases [10–13]. Therefore, there is a
need for a therapeutic vaccine which can curb the persistence of
disease, though it seems to be much more challenging because
active VL leads to severe immunosuppression which needs to be
boosted up. The approach of therapeutic vaccination has been suc-
cessfully reported against canine VL [14] as well as several other
chronic diseases such as Chagas disease, tuberculosis, human
papillomavirus, HIV infection and cancer [15–18].
In case of active VL, there is a prominence of Th2 type immune
response while generation of an effective Th1 type immune
response is associated with the cure of the disease [19]. Thus, those
antigens, which are capable of skewing immune response towards
Th1 type, may be envisaged as potential therapeutic vaccine
https://doi.org/10.1016/j.vaccine.2018.03.027
0264-410X/!2018 Elsevier Ltd. All rights reserved.
⇑
Corresponding author at: Division of Parasitology, CSIR-Central Drug Research
Institute, Sector 10, Janakipuram Extension, Sitapur Road, Lucknow 226 031, Uttar
Pradesh, India.
E-mail address: a_dube@cdri.res.in (A. Dube).
Vaccine 36 (2018) 2293–2299
Contents lists available at ScienceDirect
Vaccine
journal homepage: www.elsevier.com/locate/vaccine
candidates. Several recombinant proteins of L. (L.) donovani pro-
mastigote were shown to induce a Th1-biased cellular immune
response against peripheral blood mononuclear cells (PBMCs)/-
lymphocytes of treated VL patients as well as of hamsters [20].
Few of these proteins, such as Fructose-bisphosphate Aldolase
(Aldolase), 2-phospho-D-glycerate hydrolase (Enolase), triose
phosphate isomerase (TPI) and p45 showed significant prophylac-
tic efficacy in hamsters against L. (L.) donovani challenges [21–23].
Of these, aldolase, enolase and TPI, the vital glycolytic enzymes,
have been considered to be potential vaccine targets in leishmani-
asis or other infectious diseases [24–26], whereas p45, a member
of methionine aminopeptidase family, has been shown to induce
a proliferative response against Leishmania parasite in specific
T-cell lines from VL endemic Brazilian donor [27]. In this commu-
nication, we have evaluated the immunotherapeutic potential of
these proteins in Leishmania-infected hamsters.
2. Methodology
2.1. Animals and parasite
In this study, Syrian golden hamsters (Mesocricetus auratus, 7–8
weeks old) were used as a suitable experimental host. They were
maintained by Laboratory animal facility (LAF) of CSIR-CDRI under
the regulation of the institutional animal ethics committee (IAEC,
Approval No. 150/09/Para/IAEC dated 23.10.09) following the
guidelines of the committee for the purpose of control and super-
vision of experiments on animals (CPCSEA). L. (L.) donovani strain
(MHOM/IN/80/Dd8) was procured as promastigotes from
American type culture collection (ATCC, Manassas, VA, USA) and
maintained in vitro conditions following the protocol of Garg
et al. [28]. Parasite virulence was maintained by serial passaging
of amastigotes in hamsters [29].
2.2. Preparation of soluble L. (L.) donovani antigen (SLD) and
purification of recombinant proteins
SLD was prepared from metacyclic promastigotes following the
method of Gupta et al. [30], and aliquots were kept at "80 "C until
further use. All the four Th1 stimulatory proteins of L. (L.) donovani
–aldolase, enolase, p45, and TPI, were cloned and purified by affin-
ity chromatography using a Ni-NTA superflow agarose matrix
beads (Qiagen, Germany) as described previously [21–23]. The pur-
ity of the proteins was assessed by SDS-PAGE, and the endotoxin
level was tested using a Limulus amoebocyte lysate test (Pierce
LAL Chromogenic Endotoxin Quantitation kit, Thermo Fisher,
USA) following the manufacturer’s instructions. These proteins
were then passed through the amicon (Centrifugal filter devices,
Millipore, USA) followed by 2–3 washings in phosphate buffered
saline (PBS) to get rid of the residual salts of elution buffer and con-
centrated to a smaller volume. Finally, the proteins were quantified
using Bradford assay [31] and stored at "80 "C until further use.
2.3. Assessment of cytotoxicity of recombinant proteins
Cytotoxic effect of each purified recombinant protein was
assessed in vitro in peritoneal macrophages harvested from naïve
hamsters stimulated with 2% starch solution for 48 h [32]. Cells
were plated at 2 #10
5
cells per well in 100 ml of complete RPMI
in 96-well cell culture plates (Nunc, Denmark) and treated with
different concentrations (100, 10, 1
l
g/ml) of rLdEno, rLdAld,
rLdp45 and rLdTPI, each in triplicates. The viability of cells was
assessed using MTT dye 3-(4, 5-dimethylthiazol-2-yl)-2, 5-
diphenyltetrazolium bromide (Calbiochem) after incubating at
37 "C in a CO
2
incubator for 72 h and absorbance was measured
at 570 nm in a SPECTRAmax PLUS 384 microplate reader (Molecu-
lar Devices, USA) [33]. Percentage viability of macrophages was
calculated in comparison to untreated ones using following
equation:
Cell viabilityð%Þ¼ Absorbance of treated cells
Absorbance of untreated cells #100
2.4. Estimation of nitric oxide in Leishmania-infected macrophages
Peritoneal macrophages, isolated from naive hamsters were
seeded as 1 #10
6
cells/ml/well in complete RPMI-1640 in 12-
well culture plates, infected with L. (L.) donovani stationary phase
promastigotes at a ratio of 1:10 for 12 h. After the incubation,
non-internalised promastigotes were removed by washing 2–3
times with incomplete RPMI-1640 at 37 "C. The infected macro-
phages were then treated for 48 h with all the four recombinant
proteins at the concentrations of 1 and 10 mg/ml, and untreated
cells were kept as control one. Nitric oxide (NO) generation was
measured in Leishmania-infected macrophages, using flow cytom-
etry (Calibur, Becton-Dickinson, USA) with fluorescent probe
DAF-2-DA (Sigma-Aldrich, USA) that allows the determination of
intracellular NO. After the treatment, the adherent cells were
scraped, washed and resuspended in PBS, stained with DAF-2DA
(2
l
M) for 30 min at 37 "C and fluorescence were acquired in Cal-
ibur using CellQuest software. Lipopolysaccharide (LPS; 10 mg/ml,
Sigma-Aldrich, USA) treated cells served as the positive control.
The data were expressed as MFI (median fluorescence intensity).
2.5. Expression of Th1 cytokine and nitric oxide synthase (NOS2) in
Leishmania-infected macrophages
The mRNA expression of Interferon-
c
(IFN-
c
), Tumor Necrosis
Factor-
a
(TNF-
a
) and NOS2 cytokines was measured through
real-time RT-PCR. Briefly, RNA from infected peritoneal macro-
phages (1 #10
6
cells/well/ml in 12-well plate) treated with or
without proteins (at 48 h post stimulation) was extracted using
RNeasy mini isolation kit (Qiagen, Germany). RNA samples were
quantified in nanodrop (Thermo Fischer Scientific, USA) and cDNA
were synthesized using High-Capacity cDNA Reverse Transcription
Kit (Applied Biosystem, USA). Real-Time RT-PCR of these cDNA
samples was performed in iQ5 Multicolor real-time PCR detection
system (Bio-Rad) using following reaction conditions: initial
denaturation at 95 "C for 2 min followed by 40 cycles, each consist-
ing of denaturation at 95 "C for 20 s, annealing at 60 "C for 20 s and
extension at 72 "C for 16 s per cycle employing various sets of pri-
mers designed with the help of beacon designer software as listed
in Table 1. For all the gene expression studies, RPL18 was used as a
reference gene [34], and mRNA expression of different cytokines
was estimated using the 2
"
DD
Ct
method [35].
2.6. Infection and immunization
A batch of 70 hamsters was divided into 14 groups comprising
five hamsters per group. Animals of all the groups except group 14
were infected intracardially with 5 #10
5
amastigotes purified
through percoll density gradient method [36]. Fifteen days post
infection (p.i.), animals belonging to groups 1–12 were adminis-
tered thrice with three doses – 12.5, 25 and 50 mg of each of the
four recombinant proteins, i.e. rLdEno, rLdAld, rLdp45 and rLdTPI
intradermally at two weeks interval. Animals of groups 13 and
14 were kept as infected and uninfected control. After 15 days of
the last dose, i.e. on day 60 p.i., the animals of all the groups were
subjected to the assessment of delayed-type hypersensitivity
(DTH) response. Twenty-four hours later they were necropsied,
2294 Keerti et al. / Vaccine 36 (2018) 2293–2299
and their splenic tissue samples were collected for the assessment
of parasite burden and immunological analysis.
2.7. Measurement of DTH response
For the measurement of DTH response, both vaccinated, and
unvaccinated infected hamsters were injected intradermally with
50
l
g of SLD antigen in 0.05 ml sterile PBS in the left hind footpad
while 0.05 ml of sterile PBS only in the right hind footpad which
served as a control. After 24 h of injection, the footpad thickness
was measured with a digital Vernier Caliper. The response was
evaluated in terms of percentage increase in footpad thickness by
measuring the difference in footpad swelling between the two
footpads (with and without SLD) in each animal [30].
2.8. Assessment of parasite burden
The splenic impression smears of infected control and protein-
treated hamsters were prepared after measuring the weight of the
spleen following necropsy. Air dried smears were fixed in metha-
nol and stained with 10% Giemsa stain (Sigma-Aldrich, USA).
Amastigotes were counted per 1000 macrophage cell nuclei, and
the results were expressed in Leishman Donovan Units (LDU) cal-
culated using following formula [37,38]:
LDU ¼amastigote number per 1000 host cell nuclei
#organ weight ðin gramsÞ
2.9. RNA extraction and real-time quantitative PCR (RT-qPCR)
Total cellular RNA was isolated from the splenic tissue samples
of the hamster from all the experimental groups using the Trizol
method as per the manufacturer’s protocol (Invitrogen, USA).
RNA samples were quantified and processed for cDNA synthesis
as described above. Real-time RT-PCR was carried out in cDNA
samples for the analysis of Th1 and Th2 cytokines expression as
described earlier.
2.10. Statistical analysis
Statistical analysis was performed using GraphPad Prism 6.01
(GraphPad Software, San Diego, CA, USA). Data were analyzed by
ordinary one-way analysis of variance and Dunnett’s multiple
comparison tests. Two sets of experiments performed for the vac-
cination studies and the results were expressed as mean ± SEM
with a p-value of < 0.05 was considered significant.
3. Results
3.1. Cytotoxicity of recombinant proteins
The percentage viability of peritoneal macrophages after incu-
bation with the recombinant proteins was determined by MTT
assay. The results revealed that the cells treated with lower con-
centrations (1 and 10
l
g/ml) of either recombinant proteins or
drug, exhibited equal or higher viability in comparison to the
untreated ones. However, when stimulated with a higher concen-
tration of 100
l
g/ml of the proteins, rLdEno, and rLdAld were
found to be entirely safe, but there was a significant decline in
the percentage viability of cells treated with rLdp45 and rLdTPI.
Similarly, the treatment with a standard anti-leishmanial drug –
miltefosine at the same concentration showed substantial toxicity
(p'0.0001) in comparison to untreated cells (Fig. 1).
3.2. Treatment with recombinant proteins trigger NO generation with
increased expression of Th1 type cytokines and NOS2 in Leishmania-
infected macrophages
There was a perceptible increase in NO production in peritoneal
macrophages stimulated with 10
l
g/ml of rLdEno and rLdAld after
48 h of infection as compared to their respective infected unstim-
ulated cells and the cells stimulated with other proteins, i.e. rLdp45
and rLdTPI (Fig. 2a). LPS treated cells served as a positive control
(data not shown). These observations were further supported by
Table 1
Sequences of forward and reverse primers of hamster cytokines used for real-time quantitative PCR (RT-qPCR).
S. no. Genes Direction Primer sequence Product length
1 RPL 18 Forward 5
0
AACTCCACCTTCAATCAG 3
0
96
Reverse 5
0
GATGATCCGAAAGATGAAG 3
0
2 NOS2 Forward 5
0
TGCCTTGCATCCTCATTGG 3
0
77
Reverse 5
0
GTCGCTGTTGCCAGAAACTG 3
0
3 TNF-
a
Forward 5
0
GGAGTGGCTGAGCCATCGT 3
0
131
Reverse 5
0
AGCTGGTTGTCTTTGAGAGACATG 3
0
4 IFN-
c
Forward 5
0
GCTTAGATGTCGTGAATGG 3
0
200
Reverse 5
0
GCTGCTGTTGAAGAAGTTAG 3
0
5 IL-12 Forward 5
0
AATTACTCTGGACGGTTCAC 3
0
81
Reverse 5
0
GCTACTGCTGCTCTTGAC 3
0
6 TGF-bForward 5
0
ACGGAGAAGAACTGCTGTG 3
0
178
Reverse 5
0
GGTTGTGTTGGTTGTAGAGG 3
0
7 IL-4 Forward 5
0
CCACGGAGAAAGACCTCATCTG 3
0
75
Reverse 5
0
GGGTCACCTCATGTTGGAAATAAA 3
0
8 IL-10 Forward 5
0
GTTGCCAAACCTTATCAGAAATGA 3
0
102
Reverse 5
0
TTCTGGCCCGTGGTTCTCT 3
0
Fig. 1. The percent viability of peritoneal macrophages treated with different
concentrations of recombinant proteins – rLdEno, rLdAld, rLdp45, and rLdTPI as well
as antileishmanial drug – miltefosine (positive control) assayed using MTT.
Significance value (*p'0.05, ** p'0.01, *** p'0.001 and **** p'0.0001) of
treated cells was calculated in respect to untreated ones. Data represents as mean ±
SEM of three independent experiments.
Keerti et al. / Vaccine 36 (2018) 2293–2299 2295
significantly higher mRNA expression of IFN-
c
and TNF-
a
along
with NOS2 in rLdEno and rLdAld treated cells as compared to
untreated infected cells (Fig. 2b, c, and d).
3.3. Hamsters immunized with recombinant proteins exhibited
enhanced DTH response
The hamsters immunized with 12.5
l
g of rLdAld and rLdTPI as
well as 25
l
g of rLdAld, rLdEno and rLdTPI exhibited a significant
increase in footpad swelling after 24 h of SLD injection as com-
pared to infected control (Fig. 3). There was no such response
observed in rLdp45 treated hamsters. The DTH response was found
to be optimum in the group treated with 12.5
l
g of the rLdAld.
However, groups treated with a higher dose of recombinant pro-
teins, i.e. 50
l
g, showed no significant response.
3.4. Immunotherapeutic efficacy of recombinant proteins
The immunotherapeutic efficacy of the recombinant proteins in
L. (L.) donovani-infected hamsters assessed on day 60 p.i. revealed a
significant decrease in parasitic load of rLdAld and rLdEno immu-
nized groups specifically at lower doses, i.e. at 12.5 and 25
l
g
(!60%; p'0.01) per animal as compared to non-immunized ham-
sters (Fig. 4). However, there was no apparent reduction in parasite
load in hamsters treated with higher doses of these proteins. Fur-
ther, in rLdp45 treated animals, though, there was inhibition of
parasite multiplication to the tune of 55% only at 25 mg/animal
(p< 0.05), there was no effect at other doses. The treatment with
rLdTPI did not show any effect in L. (L.) donovani-infected hamsters
at any dose level.
3.5. Treatment with recombinant proteins skewed Th1 type of immune
response in Leishmania-infected hamsters
Among the Th1 cytokines, there was a significant upregulation
of mRNA expression of IL-12 in hamsters treated with 12.5 mg of
rLdAld (p'0.0001) in comparison to other vaccinated groups as
well as infected control. The expression of the other cytokine,
TNF-
a
, though, found to be elevated in rLdAld and rLdEno treated
groups at doses of 12.5 and 25 mg, was not of much significance.
Fig. 2. (a) Generation of Nitric oxide (NO) in Leishmania-infected peritoneal macrophages stimulated with recombinant proteins as compared to their respective unstimulated
cells. Data represent the median fluorescence intensity (MFI) of three independent experiments and (b, c, and d) showed mRNA expression profile of NOS2 and Th1 cytokines
(relative fold change) in Leishmania-infected peritoneal macrophages treated with recombinant proteins as compared to untreated cells. Significance value (*p'0.05, ** p'
0.01, *** p'0.001 and **** p'0.0001) of treated cells was calculated in respect to untreated ones. Data represents as mean ± SE, of three independent experiments.
Fig. 3. DTH response shown as percent increase in footpad thickness to SLD antigen
on day 60 p.i. Significance values indicated the difference between the vaccinated
groups and infected group (*p'0.05, ** p'0.01, *** p'0.001 and **** p'0.0001).
Data represents as mean ± SEM of two independent experiments with similar
results.
2296 Keerti et al. / Vaccine 36 (2018) 2293–2299
Moreover, there was a noteworthy increase in the expression of
IFN-
c
in rLdAldo (25 mg, p< 0.0001) and rLdEno (12.5 and 25 mg,
p< 0.01) treated a group of hamsters, there was only a slight
increase in other treated groups. Besides, the expression of TGF-
b, a signature of Th2 cytokines was also found to be significantly
downregulated in rLdAld (12.5 mg; p'0.05) treated group and
was marginal (not significant) in rLdEno (25 mg), and rLdTPI (25
mg) treated groups. There was, however, no apparent difference
in the expression of IL-4 cytokine in all the treated groups as com-
pared to infected control. On the contrary, level of IL-10 was found
to be significantly augmented in rLdp45 and rLdTPI (p'0.0001)
immunized hamsters at a dose of 12.5 mg/animal but there was
no noticeable change in other treated groups (Fig. 5).
4. Discussion
This study assessed the immunotherapeutic efficacy of Th1
stimulatory proteins of L. (L.) donovani which were previously
reported to possess remarkable prophylactic potential against
experimental VL [21–23]. Prior to any animal experimentation
(vaccination study), the possible cytotoxicity of an immunogen
needs to be evaluated [39]. The purified recombinant proteins,
when assessed for their cytotoxicity on peritoneal macrophages,
were found to be safer for immunization. Their potential to gener-
ate an immunostimulatory response in Leishmania-infected host
cells (macrophages) was further evaluated by NO production. It
is well documented that for controlling Leishmania infection,
induction of NOS2 is essential which subsequently oxidizes L-
arginine into NO and such enzyme activity in macrophages is usu-
ally induced by the Th1 cytokines, i.e. IFN-
c
, TNF-
a
, etc. [40]. The
recombinant proteins showed a considerable increase in intracel-
lular NO production with enhanced mRNA expression of NOS2
along with IFN-
c
and TNF-
a
which indicate their ability to induce
a Th1 type immune response. These findings led us to evaluate
their immunotherapeutic efficacy in chronic L. (L.) donovani infec-
tion in hamsters.
For dosage optimization, the therapeutic immunization was ini-
tiated with three doses of each recombinant protein, i.e. 50, 25 and
12.5 mg per animal. Out of these, four proteins, rLdAld exerted opti-
mum reduction in parasite burden in hamsters at a dose of 12.5 mg/
animal followed by rLdEno at 25 mg/animal in comparison to other
recombinant protein treated groups. Other immunological param-
eters such as DTH and mRNA cytokine responses also showed sim-
ilar trends. DTH, a signature for cell-based immunity has
frequently been used as a correlate of protection in leishmaniasis
[41]. Strong DTH response observed specifically in rLdAld and
rLdEno vaccinated groups (at the doses mentioned above) signifies
towards the Th1 driven cellular response [42,43]. Additionally, the
changes in mRNA expression profile of Th1 (IL-12, IFN-
c
, and TNF-
a
) and Th2 cytokines (IL-10, IL-4 and TGF-b) was assessed in
recombinant proteins treated groups. Amongst the Th1 cytokines,
IFN-
c
plays a crucial role in the control of Leishmania infection
by inducing innate and cellular responses which might help in kill-
ing parasite by activating macrophages whereas TNF-
a
, generates
cytotoxic effect against pathogens by actively inducing the produc-
tion of reactive nitrogen intermediates either alone or with IFN-
c
[44,45]. A higher mRNA expression of these cytokines in rLdEno
and rLdAld vaccinated groups suggests their involvement in stim-
ulating the macrophages which might help in reducing the parasite
number. However, the expression of IL-12, known to be involved in
microbicidal activity against intracellular pathogens [46], was
found to be significantly higher in a lower dose of rLdAld treated
group only. On the other hand, the mRNA level of TGF-b, which
Fig. 5. Splenic mRNA cytokine (Th1/Th2) expression profile regarding relative fold change of infected and recombinant protein vaccinated groups normalized with the values
of naïve hamsters. Significance values indicate the difference between the vaccinated groups and infected group (*p'0.05, ** p'0.01, *** p'0.001 and **** p'0.0001). Data
represents as mean ± SEM, of two independent experiments.
Fig. 4. Parasite burden expressed in LDU (No. of parasites in 1000 macrophage cell
nuclei x weight of spleen in gm) evaluated on day 60 p.i. Significance values
indicate the difference between the vaccinated groups and infected group (*p'
0.05, ** p'0.01, *** p'0.001 and **** p'0.0001). Data represents as mean ± SEM,
of two independent experiments.
Keerti et al. / Vaccine 36 (2018) 2293–2299 2297
plays a major role in parasite persistence during VL infection [47],
was found to be decreased moderately in rLdEno and significantly
in rldAld treated groups indicating the skewing of Th2 type
response towards the Th1 type. However, there was no remarkable
difference in the mRNA expression of IL-4 and IL-10 cytokines
between the groups treated with above-mentioned recombinant
proteins and that of infected controls. In rLdp45 and rLdTPI treated
groups at a 12.5 mg dose, where no parasite reduction was noticed,
the mRNA expressions of IL-10 cytokine was significantly higher
while that of IFN-
c
and TNF-
a
was lower in comparison to other
treated and control groups. These findings are substantiated by
the fact that during the active disease state, VL patients showed
high levels of the IL-10 cytokine which further hinders the activity
of pro-inflammatory cytokines such as IFN-
c
and TNF-
a
that are
involved in antiparasitic activities [48].
In a nutshell, two recombinant proteins – rLdEno and rLdAld of
L. (L.) donovani exerted considerable immunotherapeutic efficacy
by activating the immune status of the infected host to overcome
the immunosuppression caused by Leishmania infection and hence
could serve as potential therapeutic vaccine candidates. Efforts are
needed to further augment their immunotherapeutic efficacies in
combination with suboptimal doses of known anti-leishmanial or
immunomodulators for effective treatment of VL endemic popula-
tion. This may facilitate the process of VL elimination through the
development of therapeutic Leishmania vaccine.
Acknowledgments
We express our sincere gratitude to the Director, CSIR-CDRI for
providing necessary facilities for conducting this work. This paper
bears the CSIR-CDRI communication No 9655.
Conflict of interest
The authors declare that they have no conflict of interest.
Funding
This work was supported by the Department of Biotechnology
(DBT) [BT/PR7299/MED/29/678/2012]. CSIR – India and ICMR –
India provide financial assistance regarding fellowships to K., N.K.
Y., S.J., and S.R.
References
[1] WHO. Leishmaniasis. http://wwwwhoint/mediacentre/factsheets/fs375/en/;
2017.
[2] Moore EM, Lockwood DN. Treatment of visceral leishmaniasis. J Glob Infect Dis
2010;2:151–8.
[3] Freitas-Junior LH, Chatelain E, Kim HA, Siqueira-Neto JL. Visceral leishmaniasis
treatment: what do we have, what do we need and how to deliver it? Int J
Parasitol Drugs Drug Resist 2012;2:11–9.
[4] Croft SL, Olliaro P. Leishmaniasis chemotherapy–challenges and opportunities.
Clin Microbiol Infect 2011;17:1478–83.
[5] Kumar R, Engwerda C. Vaccines to prevent leishmaniasis. Clin Trans Immunol
2014;3:e13.
[6] Joshi S, Rawat K, Yadav NK, Kumar V, Siddiqi MI, Dube A. Visceral
leishmaniasis: advancements in vaccine development via classical and
molecular approaches. Front Immunol 2014;5:380.
[7] Gillespie PM, Beaumier CM, Strych U, Hayward T, Hotez PJ, Bottazzi ME. Status
of vaccine research and development of vaccines for leishmaniasis. Vaccine
2016.
[8] Sharma MC, Gupta AK, Das VN, Verma N, Kumar N, Saran R, et al. Leishmania
donovani in blood smears of asymptomatic persons. Acta Tropica
2000;76:195–6.
[9] Picado A, Dash AP, Bhattacharya S, Boelaert M. Vector control interventions for
visceral leishmaniasis elimination initiative in South Asia, 2005–2010. Indian J
Med Res 2012;136:22–31.
[10] McQuarrie S, Kasper K, Moffatt DC, Marko D, Keynan Y. Relapse of visceral
leishmaniasis in an HIV-infected patient successfully treated with a
combination of miltefosine and amphotericin B. Can J Infect Dis Med
Microbiol 2015;26:325–9.
[11] Ramesh V, Singh R, Avishek K, Verma A, Deep DK, Verma S, et al. Decline in
clinical efficacy of oral miltefosine in treatment of post Kala-azar Dermal
Leishmaniasis (PKDL) in India. PLoS Negl Trop Dis 2015;9.
[12] Bhandari V, Kulshrestha A, Deep DK, Stark O, Prajapati VK, Ramesh V, et al.
Drug susceptibility in leishmania isolates following miltefosine treatment in
cases of visceral leishmaniasis and post kala-azar dermal leishmaniasis. PLoS
Negl Trop Dis 2012;6.
[13] van Griensven J, Carrillo E, Lopez-Velez R, Lynen L, Moreno J. Leishmaniasis in
immunosuppressed individuals. Clin Microbiol Infect: Off Publ Eur Soc Clin
Microbiol Infect Dis 2014;20:286–99.
[14] Roatt BM, Aguiar-Soares RDO, Reis LES, Cardoso JMO, Mathias FAS, de Brito
RCF, et al. A vaccine therapy for canine visceral leishmaniasis promoted
significant improvement of clinical and immune status with reduction in
parasite burden. Front Immunol 2017;8.
[15] Morrow MP, Yan J, Sardesai NY. Human papillomavirus therapeutic vaccines:
targeting viral antigens as immunotherapy for precancerous disease and
cancer. Expert Rev Vaccines 2013;12:271–83.
[16] Melero I, Gaudernack G, Gerritsen W, Huber C, Parmiani G, Scholl S, et al.
Therapeutic vaccines for cancer: an overview of clinical trials. Nat Rev Clin
Oncol 2014;11:509–24.
[17] Cardona PJ. The progress of therapeutic vaccination with regard to
tuberculosis. Front Microbiol 2016;7:1536.
[18] Barry MA, Wang Q, Jones KM, Heffernan MJ, Buhaya MH, Beaumier CM, et al. A
therapeutic nanoparticle vaccine against Trypanosoma cruzi in a BALB/c mouse
model of Chagas disease. Hum Vaccin Immunother 2016;12:976–87.
[19] Kubar J, Fragaki K. Recombinant DNA-derived leishmania proteins: from the
laboratory to the field. Lancet Infect Dis 2005;5:107–14.
[20] Joshi S, Yadav NK, Rawat K, Tripathi CD, Jaiswal AK, Khare P, et al. Comparative
analysis of cellular immune responses in treated leishmania patients and
hamsters against recombinant Th1 stimulatory proteins of Leishmania
donovani. Front Microbiol 2016;7:312.
[21] Gupta R, Kumar V, Kushawaha PK, Tripathi CP, Joshi S, Sahasrabuddhe AA, et al.
Characterization of glycolytic enzymes–rAldolase and rEnolase of Leishmania
donovani, identified as Th1 stimulatory proteins, for their immunogenicity and
immunoprophylactic efficacies against experimental visceral leishmaniasis.
PLoS One 2014;9:e86073.
[22] Gupta R, Kushawaha PK, Tripathi CD, Sundar S, Dube A. A novel recombinant
Leishmania donovani p45, a partial coding region of methionine
aminopeptidase, generates protective immunity by inducing a Th1
stimulatory response against experimental visceral leishmaniasis. Int J
Parasitol 2012;42:429–35.
[23] Kushawaha PK, Gupta R, Tripathi CD, Khare P, Jaiswal AK, Sundar S, et al.
Leishmania donovani triose phosphate isomerase: a potential vaccine target
against visceral leishmaniasis. PLoS One 2012;7:e45766.
[24] Nandan D, Tran T, Trinh E, Silverman JM, Lopez M. Identification of leishmania
fructose-1,6-bisphosphate aldolase as a novel activator of host macrophage
Src homology 2 domain containing protein tyrosine phosphatase SHP-1.
Biochem Biophys Res Commun 2007;364:601–7.
[25] Avilan L, Gualdron-Lopez M, Quinones W, Gonzalez-Gonzalez L, Hannaert V,
Michels PA, et al. Enolase: a key player in the metabolism and a probable
virulence factor of trypanosomatid parasites-perspectives for its use as a
therapeutic target. Enzyme Res 2011;2011:932549.
[26] Zhu Y, Si J, Harn DA, Yu C, Liang Y, Ren J, et al. The protective immunity of a
DNA vaccine encoding Schistosoma japonicum Chinese strain triose-phosphate
isomerase in infected BALB/C mice. Southeast Asian J Trop Med Publ Health
2004;35:518–22.
[27] Probst P, Stromberg E, Ghalib HW, Mozel M, Badaro R, Reed SG, et al.
Identification and characterization of T cell-stimulating antigens from
Leishmania by CD4 T cell expression cloning. J Immunol 2001;166:498–505.
[28] Garg R, Srivastava JK, Pal A, Naik S, Dube A. Isolation of integral membrane
proteins of Leishmania promastigotes and evaluation of their prophylactic
potential in hamsters against experimental visceral leishmaniasis. Vaccine.
2005;23:1189–96.
[29] Dube A, Singh N, Sundar S, Singh N. Refractoriness to the treatment of sodium
stibogluconate in Indian kala-azar field isolates persist in in vitro and in vivo
experimental models. Parasitol Res 2005;96:216–23.
[30] Gupta SK, Sisodia BS, Sinha S, Hajela K, Naik S, Shasany AK, et al. Proteomic
approach for identification and characterization of novel immunostimulatory
proteins from soluble antigens of Leishmania donovani promastigotes.
Proteomics 2007;7:816–23.
[31] Bradford MM. A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding. Anal
Biochem 1976;72:248–54.
[32] Mitra S, Ghosh L, Chakrabarty P, Biswas M, Bhattacharyya FK, Ghosh DK. Effect
of bioamines on uptake of promastigotes of Leishmania donovani by hamster
peritoneal macrophages. J Med Microbiol 1992;36:283–7.
[33] Morgan DM. Tetrazolium (MTT) assay for cellular viability and activity.
Methods Mol Biol 1998;79:179–83.
[34] Zivcec M, Safronetz D, Haddock E, Feldmann H, Ebihara H. Validation of assays
to monitor immune responses in the Syrian golden hamster (Mesocricetus
auratus). J Immunol Methods 2011;368:24–35.
[35] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-
time quantitative PCR and the 2("Delta Delta C(T)) method. Methods (San
Diego, Calif) 2001;25:402–408.
[36] Jaffe CL, Rachamim N. Amastigote stage-specific monoclonal antibodies
against Leishmania major. Infect Immun 1989;57:3770–7.
2298 Keerti et al. / Vaccine 36 (2018) 2293–2299
[37] Mullen AB, Baillie AJ, Carter KC. Visceral leishmaniasis in the BALB/c mouse: a
comparison of the efficacy of a nonionic surfactant formulation of sodium
stibogluconate with those of three proprietary formulations of amphotericin B.
Antimicrob Agents Chemother. 1998;42:2722–5.
[38] Carter KC, Baillie AJ, Alexander J, Dolan TF. The therapeutic effect of sodium
stibogluconate in BALB/c mice infected with Leishmania donovani is organ-
dependent. J Pharmacy Pharmacol 1988;40:370–3.
[39] Rasouli M, Karimi MH, Kalani M, Ebrahimnezhad S, Namayandeh M, Moravej
A. Immunostimulatory effects of Leishmania infantum HSP70 recombinant
protein on dendritic cells in vitro and in vivo. Immunotherapy 2014;6:577–85.
[40] Rath M, Müller I, Kropf P, Closs EI, Munder M. Metabolism via arginase or nitric
oxide synthase: two competing arginine pathways in macrophages. Front
Immunol 2014:5.
[41] Kamhawi S, Belkaid Y, Modi G, Rowton E, Sacks D. Protection against
cutaneous leishmaniasis resulting from bites of uninfected sand flies.
Science (New York, NY) 2000;290:1351–4.
[42] Gifawesen C, Farrell JP. Comparison of T-cell responses in self-limiting versus
progressive visceral Leishmania donovani infections in golden hamsters. Infect
Immun 1989;57:3091–6.
[43] Islamuddin M, Chouhan G, Want MY, Ozbak HA, Hemeg HA, Afrin F.
Immunotherapeutic potential of eugenol emulsion in experimental visceral
leishmaniasis. PLoS Negl Trop Dis 2016;10:e0005011.
[44] Liew FY, Li Y, Millott S. Tumor necrosis factor-alpha synergizes with IFN-
gamma in mediating killing of Leishmania major through the induction of
nitric oxide. J Immunol 1990;145:4306–10.
[45] Lopes MF, Costa-da-Silva AC, DosReis GA. Innate Immunity to leishmania
infection: within phagocytes. Mediat Inflamm 2014:2014.
[46] Sacks D, Noben-Trauth N. The immunology of susceptibility and resistance to
Leishmania major in mice. Nat Rev Immunol 2002;2:845–58.
[47] Rodrigues V, Cordeiro-da-Silva A, Laforge M, Silvestre R, Estaquier J. Regulation
of immunity during visceral Leishmania infection. Parasit Vectors 2016;9:118.
[48] Gautam S, Kumar R, Maurya R, Nylen S, Ansari N, Rai M, et al. IL-10
neutralization promotes parasite clearance in splenic aspirate cells from
patients with visceral leishmaniasis. J Infect Dis 2011;204:1134–7.
Keerti et al. / Vaccine 36 (2018) 2293–2299 2299
