Identification of a C/G polymorphism in the promoter region of the BRCA1 gene and its use as a marker for rapid detection of promoter deletions

Abstract

Reduced expression of BRCA1 has been implicated in sporadic breast cancer, although the mechanisms underlying this phenomenon remain unclear. To determine whether regulatory mutations could account for the reduced expression, we screened the promoter region by sequencing in 20 patients with sporadic disease. No mutations were detected; however, a new polymorphism consisting of a C-to-G base change within the beta-promoter was identified, with the frequency of the G allele being 0.34. Close to complete linkage disequilibrium was found between this marker and the Pro871 Leu polymorphism, situated in exon 11, which has previously been shown not to be associated with breast or ovarian cancer. This indicates that the C/G polymorphism is also unlikely to play a role in either disease. However, the strength of linkage disequilibrium between these markers permitted their use for rapid screening for genomic deletions within BRCA1. A series of 214 cases with familial breast cancer were analysed using this approach; 88/214 were heterozygous for the promoter polymorphism, thereby excluding a deletion in this region. Among the remaining patients, one hemizygous case reflecting a promoter deletion was successfully identified. Therefore, this study indicates that deletions within the beta-promoter region of BRCA1 are an uncommon event in familial breast cancer. Furthermore, it suggests that mutations within the BRCA1 promoter are unlikely to account for the reported decreased expression of BRCA1 in sporadic disease.

Full text

The breast cancer susceptibility gene BRCA1was isolated in 1994
(Miki et al, 1994). Since then, more than 300 distinct disruptive
germline mutations within the coding region of the gene have been
identified in familial breast and ovarian cancer (Couch et al,
1996). However, no somatic BRCA1mutations have been found in
sporadic breast cancer and they have been found only rarely in
sporadic ovarian cancer (Futreal et al, 1994; Hosking et al, 1995;
Merajver et al, 1995). Nevertheless, the high degree of loss of
heterozygosity at the BRCA1locus and reduced BRCA1expres-
sion in sporadic breast tumours suggest that BRCA1may also play
a role in tumorigenesis in sporadic disease (Thompson et al, 1995).
The mechanisms accounting for reduced levels of BRCA1mRNA
in this context have not been clearly established. This effect may
be mediated through decreased transcription because of mutations
within the promoter region or epigenetic mechanisms. We have
previously examined the promoter region of the human BRCA1
gene in detail, defined potential transcription factor binding sites
and have demonstrated its complex regulation (Xu et al, 1995;
Brown et al, 1996; Xu et al, 1997). The BRCA1gene has two
promoters (αand β), controlling the expression of two distinct
transcripts αand β; the α-promoter is shared with the adjacent
NBR2gene and is bidirectional. In the present study, we screened a
series of sporadic breast tumours to determine whether reductions
in BRCA1mRNA levels can be attributed to mutations within the
promoter region, and in the process also screened for new poly-
morphisms that could be associated with an increased risk of the
disease.
MATERIALS AND METHODS
DNA samples
Blood and tumour DNA were extracted by standard methods.
Details of the individuals studied using material derived from
various centres in the UK are as follows:
(i) Sporadic breast cancer patients
Twenty paired tumour and blood DNA samples from patients with
infiltrating adenocarcinoma were obtained from ICRF (Imperial
Cancer Research Fund), Clinical Oncology Unit (Guy’s Hospital).
The average age of patients at diagnosis was 42.6 years (34–68);
18 patients were premenopausal and two were post-menopausal.
(ii) Caucasian controls
Forty-eight randomly selected (96 chromosomes) healthy, anony-
mous Caucasian individuals from the UK (25 women, 23 men;
courtesy of Dr E. Maestrini, Oxford, UK) were analysed to deter-
mine the frequency of the G/C 1802 polymorphism in the general
population.
(iii) East Anglian series
One hundred and forty-six East Anglian individuals with sporadic
breast cancer or normal controls were analysed using material
derived from CRC Human Cancer Genetics Research Group,
Identification of a C/G polymorphism in the promoter
region of the
BRCA1
gene and its use as a marker for
rapid detection of promoter deletions
A Catteau
1
, C-F Xu
1
, MA Brown
1
, S Hodgson
1
, J Greenman
1
, CG Mathew
1
, AM Dunning
2
and E Solomon
1
1
Division of Medical and Molecular Genetics, UMDS, 8th Floor, Guy’s Tower, Guy’s Hospital, London SE1 9RT, UK;
2
CRC Human Cancer Genetics Research
Group, Box 238, Addenbrooke’s Hospital, Hills Road, Cambridge CB2 2QQ, UK
SummaryReduced expression of
BRCA1
has been implicated in sporadic breast cancer, although the mechanisms underlying this
phenomenon remain unclear. To determine whether regulatory mutations could account for the reduced expression, we screened the
promoter region by sequencing in 20 patients with sporadic disease. No mutations were detected; however, a new polymorphism consisting
of a C-to-G base change within the β-promoter was identified, with the frequency of the G allele being 0.34. Close to complete linkage
disequilibrium was found between this marker and the Pro871Leu polymorphism, situated in exon 11, which has previously been shown not
to be associated with breast or ovarian cancer. This indicates that the C/G polymorphism is also unlikely to play a role in either disease.
However, the strength of linkage disequilibrium between these markers permitted their use for rapid screening for genomic deletions within
BRCA1
. A series of 214 cases with familial breast cancer were analysed using this approach; 88/214 were heterozygous for the promoter
polymorphism, thereby excluding a deletion in this region. Among the remaining patients, one hemizygous case reflecting a promoter deletion
was successfully identified. Therefore, this study indicates that deletions within the β-promoter region of
BRCA1
are an uncommon event in
familial breast cancer. Furthermore, it suggests that mutations within the
BRCA1
promoter are unlikely to account for the reported decreased
expression of
BRCA1
in sporadic disease.
Keywords:breast cancer;
BRCA1
promoter; C/G polymorphism; linkage disequilibrium; deletion marker
759
British Journal of Cancer
(1999) 79(5/6), 759–763
©1999 Cancer Research Campaign
Article no. bjoc.1998.0122
Received 20 May 1998
Revised 23 July 1998
Accepted 29 July 1998
Correspondence to:
A Catteau

Addenbrooke’s Hospital, Cambridge, UK. These subjects had
previously been included in a large case–control study. Details
concerning the recruitment and characteristics of these individuals
have been provided elsewhere (Dunning et al, 1997).
(iv) Familial cases
Four categories of patients (n = 214) with a family history were
screened for deletions in the promoter of BRCA1 using genomic
DNA extracted from peripheral blood lymphocytes. A family
history was taken by a clinical geneticist or genetics nurse, and the
diagnosis was confirmed in all probands and in affected relatives
from whom information was available. The categories are defined
as follows:
(1) patients with a family history of both breast and ovarian
cancers (n = 59);
(2) breast cancer patients with two affected first-degree relatives
with at least one of the individuals diagnosed below the age of
45 years (n = 50);
(3) breast cancer patients with one first-degree relative affected
and at least one diagnosis before the age of 45 years (n = 70);
(4) breast cancer patients with one second-degree relative affected
and at least one diagnosis below the age of 45 years (n = 35).
Screening for mutations in the promoter region of the
BRCA1
gene by sequencing
Twenty sporadic breast cancer cases were screened for mutations
by direct DNA sequencing. The promoter region of BRCA1 was
amplified by PCR using the tumour DNA as template. Two pairs
of primer were used. The sequences of the primers were
(forward/reverse, 5′–3′): TGGTATTGGATGTTCCTCTC/TTC-
CAGTTCCTATCACGAGG and GCTCGCTGAGACTTCCTG/
CCACAAGGTCCCATCCTCTC. Amplified products were puri-
fied with a Microspin
TM
S-400 column (Pharmacia Biotech, UK).
The purified templates were sequenced in both directions with the
PCR primers described above and the following additional primers
(5′–3′): TCCAGGAAGTCTCAGCGAGCT and TAGGAACTG-
GAATATGCCTTG. A dye terminator cycle sequencing kit
(Applied Biosystem) was used and templates analysed on an ABI
377 DNA sequencer.
Genotyping the C/G 1802 and Pro871Leu
polymorphisms
The amplification refractory mutation system (ARMS) technique
(Newton et al, 1989) was used to estimate the frequency of
the C/G polymorphism in Caucasian population controls. The
sequence of the reverse primer was (5′–3′) CACAAGGTCC-
CATCCTCTC, while the sequence of the forward primer was
(5′–3′) TGACAGATGGGTATTCTTTAAC and TGACAGAT-
GGGTATTCTTTAAG for detecting the G and C alleles respec-
tively. The amplification was for 30 cycles of denaturation at 94°C
for 15 s, annealing at 55°C for 30 s and extension at 72°C for
1 min. An initial denaturation step of 5 min at 94°C and a final
extension at 72°C for 5 min were used.
The linkage disequilibrium between the C/G 1802 and
Pro871Leu polymorphisms was determined by analysis of a series
of 146 East Anglian individuals previously genotyped for other
polymorphisms including the Pro871Leu polymorphism using
allele-specific oligonucleotide (ASO) hybridization (Dunning et
al, 1997). The C/G polymorphism at nucleotide 1802 was detected
by the ARMS technique as described above.
To screen for BRCA1 promoter deletions in the familial breast
cancer cases, ARMS was also used to determine the C/G 1802
genotype. All homozygotes (CC or GG) were analysed by direct
DNA sequencing for the Pro871Leu polymorphism, which
consists of a C to T change in exon 11 of BRCA1 at nucleotide
35813 (accession no. L78833). The primers used were
(forward/reverse, 5′–3′): GGGACTAATTCATGGTTGTTCC and
TTTCTTTAAGGACCCAGAGTGG.
Statistical analysis
The Hardy–Weinberg equilibrium in the populations studied was
tested using a standard χ
2
test. Association between genotypes at
the polymorphic loci was also estimated by χ
2
analysis. The
strength of association was estimated by the correlation coefficient
∆ (Chakravarti et al, 1984).
RESULTS
Screening for mutations in the
BRCA1
promoter in
sporadic breast cancer and characterization of a novel
polymorphism
Tumour DNA derived from 20 sporadic breast cancer patients was
screened for mutations in the BRCA1 promoter region. A 1197-bp
fragment (position 1068–2264, accession no. U37574) encom-
passing both the α- and β-promoters (Xu et al, 1997) was analysed
in detail by direct sequencing.
A C-to-G base change at nucleotide 1802, located ten bases
downstream from an Sp1 site in the β-promoter, was detected.
This C-to-G change was present in four subjects and was also
detected in each of their peripheral blood DNA samples,
suggesting that it represented a common variant rather than a
disease-causing mutation. To confirm the presence of this poly-
morphism in the general population and to estimate its frequency,
we genotyped 48 unrelated individuals (96 chromosomes) using
the ARMS technique. The primers were carefully designed in
order to prevent coamplification of the BRCA1 pseudogene. The
frequency of the C allele (published allele: Smith et al, 1996; Xu et
al, 1997) was found to be 0.66 and the genotype distribution was in
Hardy–Weinberg equilibrium (χ
2
= 0.75; P > 0.3). Apart from this
polymorphism, no other base changes were identified.
If the C/G polymorphism itself affects, or is in linkage disequi-
librium with, other genetic changes that cause variation of expres-
sion of BRCA1, it could ultimately be associated with breast
cancer. In a recent case–control study, Dunning et al (1997) found
that four common BRCA1 polymorphisms are in strong linkage
760
A Catteau et al
British Journal of Cancer (1999) 79(5/6), 759–763
© Cancer Research Campaign 1999
Table 1 Linkage disequilibrium with allelic association between C/G 1802
and Pro871Leu in 146 individuals
PP PL LL
CC 57 1
CG 2 73
GG 13
Total 146
∆, 0.98; χ
2
, 279.

disequilibrium and that none of the haplotypes is associated with a
substantially increased risk of breast or ovarian cancer. Thus, we
decided to investigate the allelic association between the newly
identified C/G polymorphism and the Pro871Leu polymorphism
analysed by Dunning et al (1997). One hundred and forty-six
unrelated individuals from the original study (Dunning et al, 1997)
were genotyped for the C/G polymorphism. Of the 292 alleles
typed, three recombinant alleles were observed (1.03%, 95% CI
0.89–1.00), i.e. in 99% of alleles Pro-871 was associated with C
and Leu-871 with G. Almost complete linkage disequilibrium was
observed between the two polymorphic sites (∆ = 0.98; χ
2
= 279)
(Table 1). No association was found between the Pro871Leu poly-
morphism and breast or ovarian cancer (Dunning et al, 1997);
similarly, no significant risk of breast cancer could be attributed to
the C/G 1802 polymorphism. The estimated relative risk to the G
carriers is 1.06 (95% CI 0.87–1.30).
Rapid screening for promoter deletions of
BRCA1
in
familial breast cancer
As the recombination fraction is low between the C/G and
Pro871Leu polymorphisms, they can therefore be used in combi-
nation as a marker for the detection of promoter deletions.
According to this hypothesis, in individuals heterozygous for the
Pro871Leu polymorphism, detection of apparent homozygosity at
the C/G polymorphic site may be indicative of a deletion within
the BRCA1 promoter region, thus creating hemizygosity at this
site. Screening of genomic DNA extracted from blood from a
series of familial (n = 214) breast cancer cases was performed. The
ARMS technique was used to characterize the C/G promoter
polymorphism. The Pro871Leu polymorphism was analysed by
sequencing in all cases found not to be heterozygous for the
promoter marker. Some patients (88/214) were found to be
heterozygous for the C/G polymorphism, thereby excluding a
deletion in this region. Among the remaining cases, one individual
was found to be homozygous for the C allele but heterozygous for
the Pro871Leu polymorphism (see Figure 1), consistent with a
deletion of the G allele in the BRCA1 promoter. Southern analysis
performed in this patient confirmed the presence of a deletion
within the promoter region encompassing the C/G polymorphic
site (Brown et al, manuscript in preparation).
DISCUSSION
It is estimated that 45% of the breast cancer families are accounted
for by defects in the BRCA1 gene; however, in contrast to other
tumour-suppressor genes, no somatic mutations have been identi-
fied within the coding region. Nevertheless, recent studies have
shown that BRCA1 transcripts are reduced in sporadic breast
tumours, suggesting that BRCA1 may be involved in both forms of
the disease. The mechanism underlying the reduction in BRCA1
levels is presently undetermined. However, by screening the
promoter region in a series of 20 cases of sporadic breast cancer,
the present study suggests that this is unlikely to be accounted for
by mutations in either the α- or β-promoter of BRCA1. This would
suggest that epigenetic mechanisms such as hypermethylation,
deregulation of transcriptional activators and/or repressors binding
the BRCA1 locus or post-transcriptional processes could be
involved. Indeed, there is evidence suggesting aberrant methyla-
tion within the regulatory region of BRCA1 in sporadic breast
tumors (Dobrovic and Simpfendorfer, 1997; Mancini et al, 1998;
Catteau et al, in press).
Epidemiological data have suggested that the majority of breast
cancer cases in the population might be accounted for by common
variants that confer a modest risk of developing the disease rather
than being due to highly penetrant genes (Ford et al, 1995).
Examples of candidate variants leading to an increased risk of
breast cancer are the HRAS1 minisatellite locus (Krontiris et al,
1993), a polymorphism within the NAT-2 gene (Ambrosone et al,
1995) and a polymorphism in the 5′ untranslated region of CYP17
that creates an Sp1 site (Feigelson et al, 1997). In the process of
examining the promoter region of BRCA1, we have detected a new
polymorphism within the β-promoter consisting of a C-to-G base
Use of a
BRCA1
polymorphism as a deletion marker
761
British Journal of Cancer (1999) 79(5/6), 759–763
© Cancer Research Campaign 1999
A
CG CGCGCG
Patient 1
Control CC
Control GG
Control CG
462 bp
B
GAAA ACNGA GCAAA
Figure 1 Double genotyping of the C/G 1802 and Pro871Leu
polymorphisms. Overall, 214 DNA samples extracted from blood obtained
from familial breast cancer cases were analysed; 88 were found to be
heterozygous for the C/G polymorphism (27, 18, 26 and 17 from categories
1, 2, 3 and 4 respectively – see Materials and methods for definitions),
thereby excluding a deletion at this site. In 125 cases, homozygosity for both
markers was observed: 24 cases were GG/LeuLeu (category 1,
n
= 6; 2,
n
=
2; 3,
n
= 9; 4,
n
= 7); 101 cases were CC/ProPro (category 1,
n
= 26; 2,
n
=
30; 3,
n
= 34; 4,
n
= 11). In the remaining case (patient 1), hemizygosity for
the C/G marker and heterozygosity for the Pro871Leu polymorphism was
observed as shown above, reflecting an underlying deletion in the
BRCA1
promoter. The C/G polymorphism was analysed by the ARMS technique (A)
and the Pro871Leu polymorphism by automated sequencing (B)

change at nucleotide 1802. We addressed whether it could repre-
sent a new biomarker for breast cancer risk. The base pair change
occurs ten nucleotides downstream from an Sp1 site, one of the
two transcription factor binding sites within the promoter region of
BRCA1 that are conserved between humans and mice. If the C-to-
G base change affected the folding of the DNA and, in conse-
quence, possibly the binding of transcription factors at the Sp1
site, a differential expression of BRCA1 between both alleles could
result, which could in turn lead to an interindividual risk of breast
cancer. However, our preliminary data using functional in vitro
assays suggest that the C/G polymorphism does not affect BRCA1
expression. Furthermore, we demonstrated that there is close to
complete allelic association between this polymorphism and the
Pro871Leu polymorphism, which has itself been shown not to be
associated with either breast or ovarian cancer in this population.
Taken together, these results indicate that the C-to-G polymor-
phism is unlikely to make a significant contribution to either of
these cancers.
Most of the BRCA1 mutations detected in familial breast and
ovarian cancers are small deletions, insertions or point mutations
(Couch et al, 1996). However, recent results have highlighted the
importance of large genomic deletions in BRCA1 as a further
mechanism leading to inactivation of the gene (Petrij-Bosch et al,
1997; Puget et al, 1997; Swensen et al, 1997). We and others have
identified individuals with inferred putative regulatory mutations
in BRCA1 in familial cases with good evidence for linkage to
BRCA1 (Xu and Solomon, 1996), i.e. cases in which no mutations
can be found by complete sequencing of the coding region yet
only one allele is expressed. In such cases, if no mutation is
detected in the promoter region, it is conceivable that the BRCA1
gene is inactivated by a large genomic deletion which could be
missed by PCR-based screening methods. As the BRCA1 promoter
region is complicated (Xu et al, 1995; Brown et al, 1996),
containing two promoters and a pseudocopy, Southern analysis
can be hindered by lack of informative probes and, moreover, by a
paucity of DNA material. We have demonstrated that the
combined genotyping of the C/G and the Pro871Leu polymor-
phisms is a powerful tool to screen for deletions in the BRCA1
gene. Of 89 informative individuals with familial breast cancer,
one case with a deletion involving the promoter region was
successfully identified using this technique. While the use of this
set of markers could miss deletions involving more distant sites,
we suggest that the approach described here could be applied to
other genomic regions of interest with the identification of further
informative polymorphic markers.
In summary, we have identified a novel polymorphism in the
promoter of BRCA1; while this does not predispose to breast cancer,
we have found that it provides a valuable tool for rapid screening for
germline mutations and suggest that it could also be used to deter-
mine loss of heterozygosity in sporadic cancer. We have demon-
strated that deletion within the promoter region of BRCA1 is an
uncommon event in familial breast cancer. Furthermore, this study
also suggests that mutations within the promoter are unlikely to
account for the reduction in BRCA1 levels that have been reported to
be a frequent occurrence in sporadic disease.
ACKNOWLEDGEMENTS
AC was supported by the ICRF (Imperial Cancer Research Fund)
and Generation Trust, C-F X and MB by the UK MRC (Medical
Research Council, Grant G6900577) and AMD by the CRC
(Cancer Research Campaign). We are grateful to William Harris
for technical assistance in obtaining tumour DNA samples, to Jill
Greenman for DNA samples from the familial cases, to Dr E.
Maestrini for DNA samples from Caucasian controls and to Dr
David Grimwade for critical reading of the manuscript.
REFERENCES
Ambrosone C, Freudenheim J, Marshall J, Graham S, Vena J, Brasure J, Michalek
A, Laughlin R, Nemoto T and Shields P (1995) The association of polymorphic
N-acetyltransferase (NAT 2) with breast cancer risk. Ann New York Acad Sci
768: 250–252
Brown MA, Xu CF, Nicolai H, Griffiths B, Chambers JA, Black D and Solomon E
(1996) The 5′ end of the BRCA1 gene lies within a duplicated region of human-
chromosome 17q21. Oncogene 12: 2507–2513
Catteau A, Harris WH, Xu CF and Solomon E (1999) Methylation of the BRCA1
promoter region in sporadic breast and ovarian cancer: correlation with disease
characteristics. Oncogene
Chakravarti A, Buetow KH, Antonarakis SE, Waber PG, Boehm CD and Kazazian
HH (1984) Nonuniform recombination within the human β-globin gene cluster.
Am J Hum Genet 36: 1239–1258
Couch FJ, Weber BL, Borresen AL, Brody L, Casey G, Devilee P, Fitzgerald M,
Friend S, Gayther S, Goldgar D, Murphy P, Szabo C, Weber B, Wiseman R,
Anderson T, Durocher F, Ganguly A, King MC, Lenoir G, Narod S, Olopade
O, Plummer S, Ponder B, Serova O, Simard J, Stratton M and Warren B (1996)
Mutations and polymorphisms in the familial early-onset breast-cancer
(BRCA1) gene. Hum Mutat 8: 8–18
Dobrovic A and Simpfendorfer D (1997) Methylation of the BRCA1 gene in
sporadic breast cancer. Cancer Res 57: 3347–3350
Dunning AM, Chiano M, Smith NR, Dearden J, Gore M, Oakes S, Wilson C,
Stratton M, Peto J, Easton D, Clayton D and Ponder BAJ (1997) Common
BRCA1 variants and susceptibility to breast and ovarian-cancer in the general
population. Hum Mol Genet 6: 285–289
Feigelson HS, Coetzee GA, Kolonel LN, Ross RK and Henderson BE (1997) A
polymorphism in the CYP17 Gene increases the risk of breast cancer. Cancer
Res 57: 1063–1065
Ford D, Easton DF and Peto J (1995) Estimates of the gene-frequency of BRCA1
and its contribution to breast and ovarian-cancer incidence. Am J Hum Genet
57: 1457–1462
Futreal PA, Liu Q, Shattuck-Eidens D, Cochran C, Harshman K, Tavigian S, Bennett
LM, Haugen-Strano A, Swensen J, Miki Y, Eddington K, McClure M, Frye C,
Weaver-Feldhaus J, Ding W, Gholami Z, Soderkvist P, Terry L, Jhanwar S,
Berchuck A, Iglehart JD, Marks J, Ballinger DG, Barrett JC, Skolnick MH,
Kamb A and Wiseman R (1994) BRCA1 mutations in primary breast and
ovarian carcinomas. Science 266: 120–122
Hosking L, Trowsdale J, Nicolai H, Solomon E, Foulkes W, Stamp G, Signer E and
Jeffreys A (1995) A somatic BRCA1 mutation in an ovarian tumor. Nature
Genet 9: 343–344
Krontiris TG, Devlin DB, Karp DD, Robert NJ and Risch N (1993) An association
between the risk of cancer and mutations in HRAS1 minisatellite locus. New
Engl J Med 329: 517–523
Mancini DN, Rodenhiser DI, Ainsworth PJ, O’Malley FP, Singh SM, Xing W and
Archer TK (1998) CpG methylation within the 5′ regulatory region of the
BRCA1 gene is tumor specific and includes a putative CREB binding site.
Oncogene 16: 1161–1169
Merajver SD, Pham TM, Caduff RF, Chen M, Poy EL, Cooney KA, Weber BL,
Collins FS, Johnston C and Frank TS (1995) Somatic mutations in the Brca1
gene in sporadic ovarian-tumors. Nature Genet 9: 439–443
Miki Y, Swensen J, Shattuck-Eidens D, Futreal PA, Harshman K, Tavtigian S, Liu Q,
Cochran C, Bennet LM, Ding W, Bell R, Rosenthal J, Hussey C, Tran T,
McClure M, Frye C, Hattier T, Phelps R, Haugen-Strano A, Katcher H,
Yakumo K, Gholami Z, Shaffer D, Sone S, Bayer S, Wray C, Bogden R,
Dayananth P, Ward J, Tonin P, Narod S, Bristow PK, Norris FH, Helvering L,
Morrison P, Rosteck P, Lai M, Barrett JC, Lewis C, Neuhausen S, Cannon-
Albright L, Goldgar D, Wiseman R, Kamb A and Skolnick MH (1994) A
strong candidate for the breast and ovarian cancer susceptibility gene BRCA1.
Science 266: 66–71
Newton CR, Graham A, Heptinstall LE, Powell SJ, Summers C, Kalsheker N, Smith
JC and Markham AF (1989) Analysis of any point mutation in DNA. The
amplification refractory mutation system (ARMS). Nucleic Acios Res 17:
1503–1516
762
A Catteau et al
British Journal of Cancer (1999) 79(5/6), 759–763
© Cancer Research Campaign 1999

Petrij-Bosch A, Peelen T, Van Vliet M, Van Eijk R, Olmer R, Drusedau M,
Hogervorst FBL, Hageman S, Arts PJW, Ligtenberg MJL, Meijers-Heijboer H,
Klijn JGM, Vasen HFA, Cornelisse CJ, Van’t Veer LJ, Bakker E, Van Ommen
G-JB and Devilee P (1997) BRCA1 genomic deletions are major founder
mutations in Dutch breast cancer patients. Nature Genet 17: 341–345
Puget N, Torchard D, Serovasinilnikova OM, Lynch HT, Feunteun J, Lenoir GM and
Mazoyer S (1997) A 1-kb alu-mediated germ-line deletion removing BRCA1
exon-17. Cancer Res 57: 828–831
Smith TM, Lee MK, Szabo CI, Jerome N, McEuen M, Taylor M, Hood L and King
MC (1996) Complete genomic sequence and analysis of 117 kb of human DNA
containing the gene BRCA1. Genome Res 6: 1029–1049
Swensen J, Hohhman M, Skolnick MH and Neuhausen SL (1997) Identification of a
14 kb deletion involving the promoter region of BRCA1 in a breast cancer
family. Hum Mol Genet 6: 1513–1517
Thompson ME, Jensen RA, Obermiller PS, Page DL and Holt JT (1995) Decreased
expression of BRCA1 accelerates growth and is often present during sporadic
breast-cancer progression. Nature Genet 9: 444–450
Xu C-F, Brown MA, Chambers JA, Griffiths B, Nicolai H and Solomon E (1995)
Distinct transcription start sites generate two forms of BRCA1 mRNA. Hum
Mol Genet 4: 2259–2264
Xu C-F and Solomon E (1996) Mutations of the BRCA1 gene in human cancer.
Semin Cancer Biol 7: 33–40
Xu C-F, Chambers JA and Solomon E (1997) Complex regulation of the BRCA1
gene. J Biol Chem 272: 20994–20997
Use of a
BRCA1
polymorphism as a deletion marker
763
British Journal of Cancer (1999) 79(5/6), 759–763
© Cancer Research Campaign 1999