Content uploaded by Shi-Hong Zhang
Author content
All content in this area was uploaded by Shi-Hong Zhang
Content may be subject to copyright.
Available via license: CC BY 4.0
Content may be subject to copyright.
A Transient Upregulation of Glutamine Synthetase in the
Dentate Gyrus Is Involved in Epileptogenesis Induced by
Amygdala Kindling in the Rat
Hong-Liu Sun
1,3.
, Shi-Hong Zhang
1.
, Kai Zhong
1
, Zheng-Hao Xu
1
, Bo Feng
1
, Jie Yu
1
, Qi Fang
1
,
Shuang Wang
2
, Deng-Chang Wu
1
, Jian-Min Zhang
2
, Zhong Chen
1,2
*
1Department of Pharmacology, Key Laboratory of Medical Neurobiology of Ministry of Health of China, Zhejiang Province Key Laboratory of Neurobiology, College of
Pharmaceutical Sciences, School of Medicine, Zhejiang University, Hangzhou, Zhejiang, China, 2Epilepsy Center, Second Affiliated Hospital, School of Medicine, Zhejiang
University, Hangzhou, Zhejiang, China, 3Department of Pharmacology, Binzhou Medical University, Yantai, China
Abstract
Reduction of glutamine synthetase (GS) function is closely related to established epilepsy, but little is known regarding its
role in epileptogenesis. The present study aimed to elucidate the functional changes of GS in the brain and its involvement
in epileptogenesis using the amygdala kindling model of epilepsy induced by daily electrical stimulation of basolateral
amygdala in rats. Both expression and activity of GS in the ipsilateral dentate gyrus (DG) were upregulated when kindled
seizures progressed to stage 4. A single dose of L-methionine sulfoximine (MSO, in 2 ml), a selective GS inhibitor, was
administered into the ipsilateral DG on the third day following the first stage 3 seizure (just before GS was upregulated). It
was found that low doses of MSO (5 or 10 mg) significantly and dose-dependently reduced the severity of and susceptibility
to evoked seizures, whereas MSO at a high dose (20 mg) aggravated kindled seizures. In animals that seizure acquisition had
been successfully suppressed with 10 mg MSO, GS upregulation reoccurred when seizures re-progressed to stage 4 and re-
administration of 10 mg MSO consistently reduced the seizures. GLN at a dose of 1.5 mg abolished the alleviative effect of
10 mg MSO and deleterious effect of 20 mg MSO on kindled seizures. Moreover, appropriate artificial microRNA interference
(1 and 1.5610
6
TU/2 ml) of GS expression in the ipsilateral DG also inhibited seizure progression. In addition, a transient
increase of GS expression and activity in the cortex was also observed during epileptogenesis evoked by pentylenetetrazole
kindling. These results strongly suggest that a transient and region-specific upregulation of GS function occurs when
epilepsy develops into a certain stage and eventually promotes the process of epileptogenesis. Inhibition of GS to an
adequate degree and at an appropriate timing may be a potential therapeutic approach to interrupting epileptogenesis.
Citation: Sun H-L, Zhang S-H, Zhong K, Xu Z-H, Feng B, et al. (2013) A Transient Upregulation of Glutamine Synthetase in the Dentate Gyrus Is Involved in
Epileptogenesis Induced by Amygdala Kindling in the Rat. PLoS ONE 8(6): e66885. doi:10.1371/journal.pone.0066885
Editor: Thierry Ame
´de
´e, Centre national de la recherche scientifique, University of Bordeaux, France
Received February 3, 2013; Accepted May 13, 2013; Published June 18, 2013
Copyright: ß2013 Sun et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted
use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This project was supported by grants from the National Natural Science Foundation of China (81030061, 81273506, 81221003, 81173042, 81202516,
81273492). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: chenzhong@zju.edu.cn
.These authors contributed equally to this work.
Introduction
Up to one third of epilepsy patients continue to experience
seizures or unacceptable medication-related side effects. Among
patients with temporal lobe epilepsy, more than half develop drug-
resistant seizures [1]. Moreover, most of the available drugs only
inhibit ictogenesis (seizure occurrence), but not epileptogenesis (the
process of developing epilepsy). Intensive studies on the process of
epileptogenesis are of great importance to the development of
therapeutic approaches.
Excessive levels of cerebral glutamate are considered a crucial
factor for epilepsy [2,3]. Glutamate or glutamate analogues
administered to the hippocampus can elicit seizures, whereas
glutamate antagonists block them [4,5]. Moreover, hyperexcit-
ability of dentate granule cells from humans with mesial temporal
lobe epilepsy (MTLE) is found to be glutamate-dependent [3].
Normally, most of the extracellular glutamate is taken up by high-
affinity excitatory amino-acid transporters on adjacent astrocytes
[6,7] where glutamate is rapidly converted to glutamine (GLN)
under the catalysis of glutamine synthetase (GS). GLN is then
transferred back to neurons and converted to glutamate before
repackaging into synaptic vesicles for release [8]. In this cycle,
which is named glutamate-glutamine cycling [9], GS controls the
rate and holds a key position in glutamate homeostasis. GS
deficiency may result in glutamate accumulation in astrocytes and
extracellular space, which may result in neuronal hyperexcitability
[10–12].
Eid et al. [13] reported that both the expression and enzyme
activity of GS are around 40% lower in MTLE hippocampi than
in non-MTLE hippocampi. Similarly, in the chronic phase of
epileptic condition after pilocarpine-induced status epilepticus, the
expression of GS is down-regulated in newly generated astrocytes
[14]. GS activity also shows a significant and region-specific
reduction after pentylenetetrazole (PTZ)-induced repetitive epi-
leptic seizures [15]. So, it has been proposed that the reduction in
GS expression or enzyme activity might be the main reason for
PLOS ONE | www.plosone.org 1 June 2013 | Volume 8 | Issue 6 | e66885
increased extracellular glutamate concentrations in epileptic
animals and patients [16]. On the other hand, Hammer et al.
[17] have recently reported that GS expression in hippocampal
formation increases in the latent phase, while approaches control
levels in the chronic phase in the kainate model of epilepsy.
However, it remains unknown regarding the significance of such
an increase in GS expression. It is likely that function of GS may
change dynamically in epileptogenesis and play different roles
from that in established epilepsy.
Therefore, in the present study we first investigated the dynamic
changes of GS during seizure acquisition using the rat amygdala
kindling model induced by daily electrical stimulation of
basolateral amygdala. We then manipulated the levels of GS in
the DG area using pharmacological and artificial microRNA
interference techniques in an attempt to elucidate its roles in
epileptogenesis induced by amygdala kindling. It is very interesting
to find that a transient upregulation of GS function occurs when
epilepsy develops into a specific stage and eventually promotes the
process of epileptogenesis.
Materials and Methods
Ethics Statement
All experiments were in accordance with the ethical guidelines
approved by the Zhejiang University Animal Experimentation
Committee (Zju2009-02-05-002) and were in complete compli-
ance with the National Institutes of Health Guide for the Care and
Use of Laboratory Animals (NIH Publications No. 80-23, revised
1996). All surgery was performed under chloral hydrate anesthesia
(400 mg/kg, i.p.), and all efforts were made to minimize suffering.
Animals
Animals used in this study were male Sprague-Dawley rats
(280–300 g, Grade II, Certificate No. SCXK2003-0001; provided
by the Experimental Animal Center, Zhejiang Academy of
Medical Science, Hangzhou, China), maintained in individual
cages with a 12-h light-dark cycle (lights on from 8:00 to 20:00).
Water and food were given ad libitum. Experiments were carried
out between 10:00 and 17:00.
Electrodes Implantation and Amygdala Kindling
Under anesthesia, rats were mounted in a stereotaxic apparatus
(Stoelting, USA). Electrodes were implanted into the right
basolateral amygdala (AP: –2.4 mm, L: –4.8 mm, V: –8.8 mm).
The electrodes were made of twisted stainless steel Teflon-coated
wires (diameter 0.2 mm; A.M. Systems, USA) insulated except for
0.5 mm at the tip. The tip separation was 0.7 – 0.8 mm. An
electrode fixed to the frontal bone served as a reference. The
electrodes were connected to a miniature receptacle. A stainless
steel guide cannula (Reward, China) was implanted into the right
DG (AP: –5.04 mm, L: –3 mm, V: –3.5 mm). In some animals,
another recording electrode binding on the cannula was implanted
together into the same place as the cannula to monitor the EEG in
this area. The receptacle and cannula were embedded in the skull
with dental cement. Animals were allowed to recover from surgery
for 10 days [18–21].
Kindling stimulation of the amygdala consisted of monophasic
square-wave pulses (60 Hz; 1 ms pulse duration; 1 sec train
duration) delivered by a constant current stimulator (Nihon
Kohden, Japan). Electroencephalograms (EEGs) of the amygdala
were recorded with a digital amplifier (NuAmps, Neuroscan
System, USA). Afterdischarge threshold (ADT) was determined
as previously reported [22–25]. In brief, the stimulus intensity
was initiated at 50 mA and increased in increments of 20 mAuntil
at least 5 sec of afterdischarge (AD) was observed in the EEG,
and this current intensity was defined as the ADT. All animals
were subjected to kindling stimulation with the same current
intensity as their own ADT once daily until they were fully
kindled, i.e., the animal exhibited three consecutive stage 5
seizures.
PTZ Kindled Seizures
Rats received an intraperitoneal injection of saline or PTZ
(40 mg/kg, Sigma) every other day as we previously described
[26]. Then the animals were placed in a plexiglas arena
(50 cm630 cm630 cm) and their behaviors were observed for
90 min.
Classification of Seizure Severity
For western blottingblott ng and in PTZ kindling animals?
Seizure severity during kindling was classified according to the
modification of Racine [27]: (1) facial movement; (2) head
nodding; (3) unilateral forelimb clonus; (4) bilateral forelimb
clonus (BFC) and rearing; and (5) BFC and rearing and falling.
Stages 1 to 3 were considered as focal seizures, while stages 4 and 5
were generalized seizures. AD duration and generalized seizure
duration, which was defined as the duration of BFC, were also
recorded.
Drug Intervention
Drugs, all in 2 ml, were infused into the right DG in 10 min with
a disposable dental needle (30 g, Nipro Medical Industries Ltd,
Japan) of which the tip was 0.2 mm below the guide cannula. The
needle was left in place for 5 min before slowly retracted. After the
kindling stimulation, L-methionine sulfoximine (MSO, 5, 10 or
20 mg, Sigma) or saline was injected in a single dose on the day
when the animal showed the first stage 2 seizure or on the third
day following the first stage 3 seizure. GLN (1.5 mg, Sigma) or
saline was given 20 min after MSO treatment and was re-
administered once daily for next 2 consecutive days. Behavioral
seizures and EEG in the amygdala were recorded by video-EEG
monitoring for 24 h after MSO administration.
Lentiviral vectors containing pcDNA
TM
6.2-GW/EmGFPmiR
targeting GS were constructed and purified by Invitrogen
(Shanghai, China) using the following sequences of oligonucleo-
tides: 59-tgctgATCAATGGCCTCCTCAATG CAGTTTTGG-
CCACTGACTGA CTGCATTGAAGGCCATTGAT-39and59-
cctgATCAATGGCCTTCAATGCAGTCAGTCAGTGGCCA-
AAACTGCATTGAGGAGGCCATTGATC -39. Negative vec-
tors were produced using the following sequences of oligonucle-
otides: 59- tgctgAA ATGTACTGCGCGTGGAGACGTTTTG
GCCACTGA CTGACGTCTCCACGCAGTACATTT-39and
59- cctgAAATGTACT GCGTGGAGACGTCAGTCAGTGG-
CCA AAACGTCTCCACGCGCAGTACATTT c-39.Onthe
third day following the first stage 3 seizure, increasing doses of
interference vectors (0.5, 1, 1.5, 2.5610
6
TU diluted to 2 mlin
saline), negative vectors (control) or saline, were injected into the
right DG in the same way as MSO.
ADT was determined just before the injection and again on the
third day after drug injection. At the end of the experiments,
placements of cannulas and electrodes were histologically verified.
Only animals with electrodes and cannulas correctly implanted in
both the basolateral amygdala and the DG were included in the
statistical analysis.
Glutamine Synthetase in Epileptogenesis
PLOS ONE | www.plosone.org 2 June 2013 | Volume 8 | Issue 6 | e66885
Immunohistochemistry
On the second day of each seizure stage, rats were deeply
anesthetized with chloral hydrate and perfused intracardially with
phosphate buffered saline followed by 4% paraformaldehyde
(pH 7.4). The brains were removed and post-fixed in the same
fixative for 4 h at 4uC, then cryoprotected by infiltration with 30%
sucrose overnight. Coronal slices throughout the entire hippo-
campus were cut at 12 mm on a cryostat (CM3050s, Leica,
Germany) and adhered onto gelatin-coated slides. For double
immunofluorescent staining for glial fibrillary acidic protein
(GFAP) and GS, the sections were first incubated with 3% bovine
serum albumin in PBS for 30 min at room temperature, then were
incubated in mixture of rabbit anti-GFAP IgG (Chemicon, USA,
diluted 1:200) and mouse anti-GS IgG (Chemicon, USA, diluted
1:200) in PBS containing 0.3% Triton X-100 overnight at room
temperature. After washing three times for 10 min with PBS,
sections were incubated sequentially in a mixture of FITC-
(Chemicon, USA, diluted 1:200) and Cy3- (Beyotime, China,
diluted 1:200) conjugated secondary antisera for 1 h at room
temperature. Then, after washing three times for 10 min with
PBS, the sections were covered with glass coverslips and observed
under a fluorescence microscope (Olympus, Japan). Images were
captured under identical exposure conditions to guarantee the
clarity and comparability among images. The fluorescence
intensity of different brain regions is also comparable since the
influence of capture conditions on brightness was restricted to the
whole image. Fluorescence intensity was quantified using ImageJ
1.37 software (National Institutes of Health).
Western Blot Analysis and Enzyme Activity Assay
On the second day of each stage in amygdala kindling and PTZ
kindling, animals were decapitated and the brains were removed
without delay, then microdissected into DG, CA3, CA1 and cortex
[28]. Tissues were frozen in liquid nitrogen for further western blot
analysis and enzyme activity assay.
For western blotting, frozen microdissected subregions were
sonicated on ice in homogenisation buffer (1% SDS, 10 mM
sodium phosphate buffer, pH 7.4, 150 mM NaCl, 1 mM
phenylmethylsulphonyl fluoride, 10 mM ethylenediamine tetra-
acetic acid). Protein concentrations were determined with a
bicinchoninic acid (BCA) protein assay kit and measured on a
microplate reader at 570 nm (Biotek, USA). Protein homoge-
nates were mixed with sample loading buffer (62.5 mM Tris-
HCl, 10% glycerol, 2% SDS, 5% 2- mercaptoethanol, 0.025%
bromophenol blue). Protein samples were separated by 12%
SDS-polyacrylamide gels and then electrotransferred onto a
nitrocellulose membrane. After blocking with 5% fat-free milk,
the membranes were incubated with mouse monoclonal
antibody against GS (1:800, Chemicon) or glyceraldehyde-3-
phosphate dehydrogenase (GAPDH, 1:5,000, Kangchen) at 4uC
overnight. After repeated washing, the membranes were reacted
with IRDye 700 anti-mouse molecular probe (Odyssey; LI-
COR) for 2 h. Images were acquired with the Odyssey infrared
imaging system and analyzed by the software program as
specified in the Odyssey software manual. Results were
expressed as GS/GAPDH ratio, and then normalized to the
values measured in control groups.
GS activity was measured by a GS activity assay kit ( Jiancheng,
Nanjing, China; Category No. A047) according to the c-glutamyl
transferase reaction as described previously [15]. Briefly, after
determining the protein concentration as described above, 10 ml
tissue homogenates or standard solution (20 mmol/mL) or distilled
water (control) were incubated with 152 ml reaction mixture at
37uC for 15 min. Reaction was terminated by adding 40 mlofa
stop-solution. Insoluble material was removed by centrifugation at
3,500 g for 10 min at 4uC. After measuring the absorbance (optic
density, OD), 100 ml supernatant was removed to the microplate
and the OD value representing the amount of reaction product, c-
glutamyl hydroxamate was obtained. The factual OD of each well
for further calculation was the difference between the raw OD and
the respective blank OD. Enzymatic activity expressed as units per
milligram of sample protein (U/mg) was calculated based on the
following formula: GS activity (U/mg) = [(OD of the test sample
– OD of the control)/(OD of the standard solution – OD of the
control)] 6concentration in standard solution (20 mmol/ml) 64/
protein content (mg/ml) [29].
Statistical Analysis
Values are expressed as mean 6SEM. Statistical analysis was
carried out by SPSS 13.0 for Windows. Analysis of group
progression of seizure stage, duration of AD, and generalized
seizures during kindling was performed by two-way analysis of
variance (ANOVA) for repeated measures. Comparison of the
cumulative numbers of stimulationsneededineachseizurestage
and to reach stage 5 during kindling was done with the
nonparametric Mann-Whitney U test. One-way ANOVA was
used for comparison of other indices. For all analyses, the tests
were two-sided and a P,0.05 was considered significant.
Results
Transient Upregulation of GS in the Ipsilateral DG area
during Amygdala Kindling
Immunohistochemical studies showed that GS was co-localized
with GFAP, a specific marker of astrocytes, throughout all
subfields in the brain. The intensity of GS immunoreactivity did
not change noticeably during the stages of focal seizures (stages 1
to 3; Fig. 1A–F and Q). However, in seizure stage 4, GS expression
evidently increased in the ipsilateral DG area (P,0.001; Fig. 1G–I
and Q) without detectable astroglial proliferation as determined by
counting GFAP-positive cells (data not shown). GS expression in
the DG area declined to the control level when the animal was
fully kindled (Fig. 1J–L and Q). Western blotting experiments
confirmed that the amount of GS in the ipsilateral DG area was
about 70% higher than that of control animals (P,0.01; Fig. 2A
and C). No significant change of GS expression was found in
hippocampal CA3 and CA1 subregions (Fig. 1M–P, S and T; Fig.
2B and C) and the cortex (data not shown) at each seizure stage. In
addition, GS activity was 37% higher (P,0.05) in the ipsilateral
DG homogenates from rats in seizure stage 4 (75.5665.67 U/mg)
than in those from controls (58.8863.33 U/mg) (Fig. 2D). No
significant difference in GS activity was found in the contralateral
DG or other subregions, or at other seizure stages (Fig. 2E, F and
G).
To study whether the increase of GS in the DG at stage 4 is
specific for the amygdala kindling model of epilepsy, we assessed
the GS expression and activity in the brain of rats subjected to
PTZ-kindling model of epilepsy. A marked increase in GS
immunoreactivity and activity in the cortex was also detected at
seizure stage 4 (P,0.001; Fig. 3). No significant differences in GS
immunoreactivity and activity were found in other stages or in
other brain regions.
Inhibition of GS in the Ipsilateral DG by MSO Reduced
Evoked Seizures
To determine the role of GS upregulation in kindling
acquisition, MSO (5, 10, and 20 mg) were infused into the
ipsilateral DG on the third day following the first stage 3 seizure
Glutamine Synthetase in Epileptogenesis
PLOS ONE | www.plosone.org 3 June 2013 | Volume 8 | Issue 6 | e66885
Figure 1. GS overexpression in the ipsilateral DG area in the rat amygdala kindling model. Immunoreactivity of GFAP (red) and GS
(green) in the ipsilateral DG (A–L, bar = 50 mm) and the CA3 region (M–P, bar = 20 mm) during seizure acquisition induced by amygdala kindling
(control group, A–C; stages 1–2, not shown; stage 3, D–F; stage 4, G–I; fully kindled, J–L; n = 6/stage). The mean intensity of GS immunoreactivity in
the ipsilateral DG region was significantly increased in stage 4 compared with controls (Q), while no change was observed in GFAP expression (R). GS
expression did not change in CA1 (S) and CA3 (T) regions. Data are shown as mean 6SEM. ***P,0.001 compared with controls.
doi:10.1371/journal.pone.0066885.g001
Glutamine Synthetase in Epileptogenesis
PLOS ONE | www.plosone.org 4 June 2013 | Volume 8 | Issue 6 | e66885
(just before the seizures progressed to stage 4) in order to inhibit
the function of GS enzyme. MSO 5 mg and 10 mg did not evoke
epileptiform discharges in EEG nor visible behavioral seizures,
whereas MSO 20 mg induced epileptiform EEG in all treated rats
and three out of nine presented spontaneous seizures. The
progression of behavioral seizure stages in animals receiving
MSO 5 mg and 10 mg was slower than that in the control group
receiving saline (P,0.05 and P,0.001; Fig. 4A). When animals in
Figure 2. Upregulation of GS function in the ipsilateral DG in the rat amygdala kindling model. Measurements of GS expression in the
ipsilateral DG (A) and CA3 (B) by western blotting and enzyme activity in bilateral DG (D and E), ipsilateral CA3(F) and CA1(G) in the progression of
amygdala kindling (control group, n = 6/stage; stages 1–4 and fully kindled, n = 5–7/stage). Data are shown as mean 6SEM. * P,0.05 and **P,0.01
compared with controls.
doi:10.1371/journal.pone.0066885.g002
Glutamine Synthetase in Epileptogenesis
PLOS ONE | www.plosone.org 5 June 2013 | Volume 8 | Issue 6 | e66885
the control group were all fully kindled, those treated with MSO
5mg and 10 mg were still in stages 4.060.6 and 2.360.7,
respectively (Fig. 4A). Meanwhile, MSO 5 mg and 10 mg shortened
AD durations during kindling (P,0.05 and 0.001, respectively;
Fig. 4B) and the later dose also reduced the duration of generalized
seizures (P,0.05; Fig. 4C)
Further analysis revealed that 5 mg and 10 mg MSO signifi-
cantly increased the number of stimulations needed to reach stage
5 and prolonged the time that animals stayed in stages 0–3
(P,0.01 and 0.001, Fig. 4D and E). Moreover, these treatments
not only prevented the decline of ADT along with seizure
progression observed in the control group, but even significantly
elevated ADT (P,0.01 and 0.001, respectively; Fig. 4F). An
inhibition of seizure severity with MSO 10 mg was also observed
when comparing the average AD duration and generalized seizure
duration of three consecutive stage 5 seizures when the animal was
fully kindled (P,0.05 and 0.01, respectively; Fig. 4G and H). In
contrast, MSO at a high dose (20 mg) remarkably accelerated
kindling progression and aggravated evoked seizures either during
kindling or when the animal was fully kindled (P,0.001, 0.01 and
0.05, respectively; Fig. 4C–H). Representative EEGs recorded pre-
and post-kindling stimulation from the right amygdala on the third
day after drug administration and EEGs at seizure stage 5 are
shown in Fig. 4I and J. Interestingly, the increase in immuno-
staining intensity of GS in the ipsilateral DG reoccurred when the
kindling acquisition re-progressed to seizure stage 4 (P,0.01; Fig.
5A). Re-administration of MSO 10 mg on the third day after
seizures re-progressed to stage 3 consistently inhibited the
progression of kindled seizures (Fig. 5B).
To verify whether the effects of MSO on kindled seizures were
due to GS inhibition, GLN, the product of GS, was administered
following MSO treatment. We found that GLN not only reversed
the deleterious effect of MSO 20 mg, but also abolished the
ameliorative effect of MSO 10 mg(P,0.001; Fig. 6).
However, if administered on the first day after seizures
progressed to stage 2, MSO dose-dependently accelerated seizure
progression (P,0.01; Fig. 7A), as well as prolonged AD and
generalized seizure duration (P,0.01 and 0.05 respectively; Fig.
7B and C). The number of stimulations required to reach stage 5
and the cumulative stimulations in stages 0–3 were also
significantly reduced (P,0.05 and 0.01 respectively; Fig. 7D
and E). Moreover, MSO 10 mg aggravated the decline of ADT
along with seizure acquisition (Fig. 7F). Representative EEGs
recorded pre- and post-kindling stimulation from the right
amygdala on the third day after drug administration are shown
in Fig. 7G.
microRNA Interference of GS in the Ipsilateral DG
Reduced Evoked Seizures
To further verify the role of GS upregulation in the ipsilateral
DG area during kindling, effects of artificial microRNA interfer-
ence lentiviral vectors were evaluated. Negative vectors (control
group) did not affect GS expression and kindled seizures compared
with saline. However, artificial microRNA interference vectors
titer-dependently reduced GS immunoreactivity around the
injected point (Fig. 8). The progression of behavioral seizures in
animals receiving 1 and 1.5610
6
TU/2 ml was markedly slower
than that in the control group (P,0.05 and P,0.001; Fig. 9A).
The AD duration and generalized seizure duration were also
significantly shorted (P,0.05, P,0.001 and P,0.001; respective-
ly; Fig. 9B and C). Moreover, the number of stimulations needed
to reach stage 5 and cumulative stimulations in stage 0–3 were
significantly higher (P,0.05, P,0.001 and P,0.01, P,0.001,
respectively; Fig. 9D and E). ADT in these two groups also
increased (Fig. 9F). In contrast, in the group treated with 2.5610
6
genome copies, the generalized seizure duration was significantly
prolonged (P,0.05; Fig. 9C), and the number of stimulations
needed to reach stage 5 was significantly less than those in other
Figure 3. Upregulation of GS function in the cortex in the rat PTZ-kindling model. GS immunoreactivity (A–E, bar = 20 mm) and activity (F)
in the cortex during PTZ kindling. GS upregulation was detected in seizure stage 4 (C, E) compared with the saline group (A). No change was found in
other stages (B, D, E) and in other subregions (DG, CA3+CA1; F; n = 5/group). Data are shown as mean 6SEM. *P,0.05 and ***P,0.001 compared
with the saline group.
doi:10.1371/journal.pone.0066885.g003
Glutamine Synthetase in Epileptogenesis
PLOS ONE | www.plosone.org 6 June 2013 | Volume 8 | Issue 6 | e66885
groups (P,0.001 and 0.05, respectively; Fig. 9D). No effect was
found with the dose of 0.5 610
6
TU/2 ml (Fig. 9).
Discussion
In the present study, we provided the first evidence that a
transient upregulation of GS function occurred in the ipsilateral
Figure 4. Interruption of GS upregulation by MSO and kindled seizures. MSO (5, 10, 20 mg) was injected into the ipsilateral DG on the third
day following the first stage 3 seizure. (A) behavioral stage progression of seizures, (B) AD duration, (C) generalized seizure duration, (D) numbersof
stimulations required to reach full kindled from MSO administration, (E) numbers of stimulations required to retain in stage 0–3 and stage 4 in
kindling acquisition, (F) difference of ADT between just before drug injection and on the third day after injection, (G) averaged AD duration and (H)
averaged generalized seizure duration of three consecutive stage 5 seizures (n = 9/group). I and J show electrographic examples of afterdischarge
recorded from the ipsilateral amygdala in four groups on the third day after drug injection and after the rats were fully kindled. ES indicates electrical
kindling stimulation. Data are shown as mean 6SEM. *P,0.05, **P,0.01, *** P,0.001 compared with the saline group;
#
P,0.05,
##
P,0.01,
###
P,0.001 compared with each other.
doi:10.1371/journal.pone.0066885.g004
Glutamine Synthetase in Epileptogenesis
PLOS ONE | www.plosone.org 7 June 2013 | Volume 8 | Issue 6 | e66885
DG area in a specific stage during the development of electrical
amygdala kindling. Interrupting GS function with MSO or
microRNA interference significantly inhibited kindling acquisition.
These results indicate that GS is very likely an important
contributor to epileptogenesis.
It has been shown that continuous inhibition of GS activity by
MSO, a specific and irreversible inhibitor of GS, induces
recurrent seizures and neuropathologicalfeaturesinratsthat
are similar to MTLE in humans [11,13,16], and haploinsuffi-
ciency of GS increases susceptibility to experimental febrile
seizures [12]. We also found in the present study that MSO
acutely infused into the DG area of naı
¨ve rats resulted in
seizures that were reversed by glutamine (GLN) replenishment
(data not shown) and that MSO dose-dependently accelerated
kindling progression if administered on the day when the animal
showed the first stage 2 seizure (GS is at normal level at that
time). These results support previous findings that both acute
and chronic impairment of GS function lead to the occurrence
of seizures. On the other hand, the present study revealed that
both expression and activity of GS transiently increased
specifically in the ipsilateral DG area in the early stage of
generalized kindled seizures, and upregulation of GS expression
and activity in the cortex was also detected in stage 4 seizures
induced by PTZ kindling. Hammer et al. [17] reported that GS
expression in the hippocampus is upregulated in the latent
phase, but reduced to control levels in the chronic phase after
kainate-induced status epilepticus, although the significance of
this increase remains unknown. All these data inspire us to
speculate that it is likely that the function of GS changes
dynamically and compartmentally along with the process of
epileptogenesis. We also noticed that the increase in GS activity
was not comparable with that in expression (37% vs 70%).
Previous studies have demonstrated that under epileptic
conditions, GS is nitrated, which leads to decrease in activity
Figure 5. Reoccurrence of GS upregulation. The increase in GS immunoreactivity in the ipsilateral DG reoccurred when kindled seizures in
animals treated with 10 mg MSO re-progressed to stage 4 (A, n = 6/stage) and re-administration of MSO 10 mg injected into the ipsilateral DG on the
third day after seizures re-progressed to stage 3 consistently inhibited seizure progression (B, n = 9/group). Data are shown as mean 6S.E.M. **
P,0.01 compared with the saline group.
doi:10.1371/journal.pone.0066885.g005
Figure 6. Reversion of MSO effects by GLN. MSO (10 mg and 20 mg) was injected into the ipsilateral DG on the third day following the first stage
3 seizure. GLN (1.5 mg) was given 20 min after MSO treatment and was re-administered once daily for next 2 consecutive days. (A) behavioral stage
progression of kindled seizures, (B) AD duration. Data are shown as mean 6SEM. *** P,0.001 compared with the control group.
doi:10.1371/journal.pone.0066885.g006
Glutamine Synthetase in Epileptogenesis
PLOS ONE | www.plosone.org 8 June 2013 | Volume 8 | Issue 6 | e66885
without changes in content [15,30,31]. Therefore, nitration of
GS may explain at least in part the less increase in activity than
in expression.
To assess the role of increased GS function in epileptogenesis,
we infused MSO or artificial microRNA into the ipsilateral DG on
the third day following the first stage 3 seizure (just before the
upregulation of GS in stage 4) to inhibit GS function. Consistent
with previous reports, a high dose of MSO (20 mg) or artificial
microRNA (2.5610
6
TU) that inhibited GS activity excessively
not only accelerated kindling acquisition, but also increased the
susceptibility to and the severity of evoked seizures, providing
further supportive evidence that excessive suppression of GS is
stimulative for epilepsy development. Interestingly, however,
lower doses of MSO or artificial microRNA that inhibited GS to
slight to moderate extent reduced kindling seizures. Since GLN
replenishment reversed the deleterious and ameliorative effects
provided by high and low doses of MSO, respectively, we
concluded that such effects were associated with GS inhibition.
Moreover, when the seizure stage in animals previously treated
with 10 mg MSO re-progressed to stage 4, the up-regulation of
GS expression in the ipsilateral DG reoccurred and the
inhibitory effect of 10 mg MSO on seizure acquisition was
replicated. These data strongly suggest that an upregulation of
GS function may be an indispensable process and serve as a
stimulative factor for the development of amygdala kindling. The
seemingly discrepant facts of GS deficiency in patients with
temporal lobe epilepsy and GS upregulation in certain stage of
amygdala kindling may not indicate that the kindling model is
not representative for the situation in human temporal lobe
epilepsy, but may suggest that a proper functional level of GS is
crucial for the maintenance of normal neuronal activity. GS
dysfunction manifested as either upregulation or impairment
that occurs in different stages or types of epilepsy are associated
with epileptogenesis.
Since GS is responsible for glutamate catabolism, the levels of its
function may be largely dependent on glutamate levels in
extracellular spaces and in astrocytes. Considering that the
extracellular level of glutamate increases along with the develop-
Figure 7. MSO accelerated kindled seizures. MSO (5, 10, and 20 mgin2ml) was injected into the ipsilateral DG on the first day after kindled
seizures progressed to stage 2. (A) behavioral stage progression of seizures, (B) AD duration, (C) generalized seizure duration, (D) numbers of
stimulations required to reach stage 5 from MSO administration, (E) numbers of stimulations required to retain in stage 0–3 and stage 4 in kindling
acquisition, (F) difference of ADT between just before drug administration and on the third day after administration (saline group, n = 6; MSO groups,
n = 9/group). G shows the electrographic examples of afterdischarge recorded from the ipsilateral amygdala in four groups on the third day after
drug administration. ES represents electrical kindling stimulation. Data are shown as mean 6S.E.M. *P,0.05, ** P,0.01 and *** P,0.001 compared
with the saline group. ### P,0.001, as compared with each other.
doi:10.1371/journal.pone.0066885.g007
Glutamine Synthetase in Epileptogenesis
PLOS ONE | www.plosone.org 9 June 2013 | Volume 8 | Issue 6 | e66885
ment of kindled seizures [32], it seems reasonable to speculate that
slight increase of extracellular glutamate in partial seizures (stage
1–3) is not sufficient to evoke GS upregulation in astrocytes. When
seizures were generalized (stage 4) and the extracellular glutamate
levels increase dramatically, GS function is responsively upregu-
lated in order to maintain glutamate homeostasis. As a result, the
rate of glutamate-glutamine conversion is finally accelerated.
However, this acceleration may in turn promote the synthesis and
availability of glutamate and hence contribute to seizure develop-
ment. Actually, it has been demonstrated that an adequate GLN
supply is crucial for epileptiform activity [33–35]. Since c-
aminobutyric acid (GABA), the main inhibitory neurotransmitter
in the central nervous system, is synthesized from glutamate, it is
possible that the acceleration of glutamate synthesis may be
accompanied with the increase in GABA levels. However, kindling
process produces an increased turnover of glutamate relative to
GABA [36] and neuronal hyperactivity is more depend on
glutamate-glutamine cycling [34,35]. Indeed, we measured the
concentration of glutamate and GABA in the ipsilateral DG by
HPLC when kindled seizures progressed to stage 4 and found a
marked increase in the ratio of glutamate and GABA (Fig. S1).
Therefore, the promotive effect of GS upregulation on kindling
acquisition may be explained at least in part by these mechanisms.
This is the first study reporting the role of GS upregulation in
epileptogenesis. Our results suggest that modifying GS function or
interfering the glutamate-glutamine cycle appropriately to main-
tain the stabilization of extracellular glutamate concentration may
be a potential therapeutic intervention for epileptogenesis.
Moreover, our findings also raise the issue that for patients with
high risk of developing epilepsy, GLN intake probably should be
monitored with caution.
Interestingly, the GS upregulation occurred only in the
ipsilateral DG area in the amygdala-kindling model, and only
in the cortex in the PTZ-kindling model. Such an epilepsy type-
related and region-specific GS upregulation indicates that
different brain areas are differentially involved epileptogenesis
induce by different types of insult. Our findings point that the
DG area is crucial for development of epilepsy induced by
amygdala kindling. Although according to available data, there
are no monosynaptic interconnections between the amygdaloid
complex and the DG, the former has rich projections to other
temporal structures that are closely interconnected with the latter
[37]. For example, the amygdala sends fibers to the entorhinal
cortex from which fibers are sent to the DG via the perforant
path, a known pathway that is closely involved in the
propagation and evolution of epileptiform activity induced by
kindling [38]. Along with the progression of kindling with
repeated stimulation, the same stimulus comes to trigger longer
and more widely propagating events that progressively recruit a
larger network, including the DG [38]. Moreover, the DG area
is a regulated gate for the propagation of epileptiform activity,
and granule cells here are more sensitive to excitatory input
[38,39]. An excessive activation of DG neurons under epileptic
condition serves to initiate and sustain seizure activity in the
hippocampal-parahippocampal loop and converts the DG to a
‘‘promoter’’ or ‘‘amplifier’’ of epileptiform discharges [40,41].
Therefore, it is possible that repeated kindling stimulation of the
amygdala gradually induces hyperactivity in dentate neurons.
And subsequently, elevated extracellular glutamate stimulates
glutamate-glutamine cycling and hence promotes epileptogen-
esis. Further studies are needed to elucidate the exact mecha-
nisms underlying the upregulation of GS function in the DG
area during kindling epileptogenesis.
In summary, in the present study, we found a transient but
pronounced upregulation of GS in the ipsilateral DG area during
seizure acquisition in the amygdala kindling model of epilepsy.
Figure 8. microRNA interference and GS expression. Artificial
microRNA interference vectors (0.5, 1.5, and 2.5610
6
TU/2 ml) was
injected into the ipsilateral DG on the third day following the first stage
3 seizure on immunoreactivity. (A–R) GFAP (red) and GS (green) (bar =
50 mm) detected on the third day after injection (control (negative
vector) group, A–C; saline group, D–F; 0.5610
6
TU/2 ml group, G–I;
1610
6
TU/2 ml group, J–L; 1.5610
6
genome copies group, M–O;
2.5610
6
TU/2 ml group, P–R; n = 6/group). The quantitative analysis
revealed a titer-dependent inhibition of GS immunoreactivity in the
ipsilateral DG region (S), while no change in GFAP expression was
observed (T). Data are shown as mean 6SEM. *** P,0.001 compared
with the control group.
doi:10.1371/journal.pone.0066885.g008
Glutamine Synthetase in Epileptogenesis
PLOS ONE | www.plosone.org 10 June 2013 | Volume 8 | Issue 6 | e66885
This increase appears to promote the kindling progression and the
appearance of generalized seizures. Inhibition of GS to an
adequate degree and at the appropriate timing may be a potential
therapeutic approach to interrupting epileptogenesis.
Supporting Information
Figure S1 Glutamate and GABA measurement. Gluta-
mate (A) and GABA (B) content (mg/ml) was measured 24 hrs after
the first stage 3 or 4 seizure in the right DG (RDG) and other
regions in the right hippocampal formation (RHF). (C) shows the
ratio between Glutamate and GABA. Data are shown as mean 6
SEM. * P,0.05, #P= 0.05, compared with the control group.
(TIF)
Author Contributions
Conceived and designed the experiments: HLS SHZ ZC. Performed the
experiments: HLS KZ ZHX BF JY QF SW DCW. Analyzed the data:
HLS KZ SHZ. Contributed reagents/materials/analysis tools: JMZ.
Wrote the paper: HLS SHZ ZC.
Figure 9. Interruption of GS upregulation by microRNA interference and kindled seizures. rtificial microRNA interference vectors (0.5,
1.5, and 2.5 610
6
TU/2 ml) was injected into the ipsilateral DG on the third day following the first stage 3 seizure. (A) behavioral stage progression of
seizures, (B) AD duration, (C) generalized seizure duration, (D) numbers of stimulations required to reach full kindled from administration, (E) numbers
of stimulations required to retain in stage 0–3 and stage 4 in kindling acquisition, (F) difference of ADT between that just before injection and on the
third day after injection (n = 6–10/group). (G) shows electrographic examples of afterdischarge recorded from the ipsilateral amygdala in six groups
on the third day after injection. ES indicates electrical kindling stimulation. Data are shown as mean 6SEM. *P,0.05, **P,0.01, *** P,0.001
compared with the control group;
#
P,0.05,
###
P,0.001 compared with each other.
doi:10.1371/journal.pone.0066885.g009
Glutamine Synthetase in Epileptogenesis
PLOS ONE | www.plosone.org 11 June 2013 | Volume 8 | Issue 6 | e66885
A
References
1. Leppik IE (1992) Intractable epilepsy in adults. Epilepsy Res Suppl 5: 7–11.
2. During MJ, Spencer DD (1993) Extracellular hippocampal glutamate and
spontaneous seizure in the conscious human brain. Lancet 341: 1607–1610.
3. Williamson A (1994) Electrophysiology of epileptic human neocortic al and
hippocampal neurons maintained in vitro. Clin Neurosci 2: 47–52.
4. Olney JW, Collins RC, Sloviter RS (1986). Excitotoxic mechanisms of epileptic
brain damage. In: Delgado-Escueta AV, Ward AA Jr, Woodbury DM, Porter
RJ, editors. Advances in Neurology: Raven Press. pp. 857–877.
5. Olney JW (1978) Neurotoxicity of excitatory amino acids. In: McGeer EG,
Olney JW, McGeer PL, editors. Kainic Acid as A Tool in Neurobiology: Raven
Press. pp. 37–70.
6. Chaudhry FA, Reimer RJ, Edwards RH (2002) The glutamine commute: take
the N line and transfer to the A. J Cell Biol 157: 349–355.
7. Hamberger AC, Chiang GH, Nyle´n ES, Scheff SW, Cotman CW (1979)
Glutamate as a CNS transmitter: I. Evaluation of glucose and glutamine as
precursors for the synthesis of preferentially released glutamate. Brain Res 168:
513–530.
8. Broman J, Hassel B, Rinvik E, Ottersen OP (2000) Biochemistry and anatomy of
transmitter glutamate. In: Ottersen OP, Storm-Mathisen J, editors. Glutamate:
Elsevier Science. pp. 1–44.
9. van den Berg CJ, Garfinkel D (1971) A stimulation study of brain compartments:
metabolism of glutamate and related substances in mouse brain. J Biochem 123:
211–218.
10. de Lanerolle NC, Lee TS, Spencer DD (2010) Astrocytes and epilepsy.
Neurotherapeutics 7: 424–438.
11. Perez EL, Lauritzen F, Wang Y, Lee TS, Kang D, et al. (2012) Evidence for
astrocytes as a potential source of the glutamate excess in temporal lobe epilepsy.
Neurobiol Dis. 47: 331–337.
12. van Gassen KL, van der Hel WS, Hakvoort TB, Lamers WH, de Graan PN
(2009) Haploinsufficiency of glutamine synthetase increases susceptibility to
experimental febrile seizures. Genes Brain Behav 8: 290–295.
13. Eid T, Thomas MJ, Spencer DD, Runde´n-Pran E, Lai JC, et al. (2004) Loss of
glutamine synthe tase in the human e pileptogenic hippocampus: poss ible
mechanism for raised extracellular glutamate in mesial temporal lobe epilepsy.
Lancet 363: 28–37.
14. Kang TC, Kim DS, Kwak SE, Kim JE, Won MH, et al. (2006) Epileptogenic
roles of astroglial death and regeneration in the dentate gyrus of experimental
temporal lobe epilepsy. Glia 54: 258–271.
15. Bidmon HJ, Go¨rg B, Palomero-Gallagher N, Schleicher A, Ha¨ ussinger D, et al.
(2008) Glutamine synthetase becomes nitrated and its activity is reduced during
repetitive seizure activity in the pentylentetrazole model of epilepsy. Epilepsia
49: 1733–1748.
16. Eid T, Ghosh A, Wang Y, Beckstro¨m H, Zaveri HP, et al. (2008) Recurrent
seizures and brain pathology after inhibition of glutamine synthetase in the
hippocampus in rats. Brain 131: 2061–2070.
17. Hammer J, Alvestad S, Osen KK, Skare Ø, Sonnewald U, et al. (2008)
Expression of glutamine synthetase and glutamate dehydrogenase in the latent
phase and chronic phase in the kainate model of temporal lobe epilepsy. Glia 56:
856–868.
18. Yang LX, Jin CL, Zhuge ZB, Wang S, Wei EQ, et al. (2006) Unilateral low-
frequency stimulation of central piriform cortex delays seizure development
induced by amygdaloid kindling. Neuroscience 138: 1089–1096.
19. Wang S, Wu DC , Ding MP, Li Q, Zhuge ZB, et al. (2008) Low frequency
stimulation of cerebellar fastigial nucleus inhibits amygdaloid kindling
acquisition in Sprague-Dawley rats. Neurobiol Dis 29: 52–58.
20. Xu ZH, Wu DC, Fang Q, Zhong K, Wang S, et al. (2010) Therapeutic time
window of low-frequency stimulation at entorhinal cortex for amygdaloid-
kindling seizures in rats. Epilepsia 51: 1861–1864.
21. Zhong K, Wu DC, Jin MM, Xu ZH, Wang Y, et al. (2012) Wide therapeutic
time-window of low-frequency stimulation at the subiculum for temporal lobe
epilepsy treatment in rats. Neurobiol Dis 48: 20–26.
22. Wu DC, Xu ZH, Wang S, Fang Q, Hu DQ, et al. (2008) Time-dependent effect
of low-frequency stimulation on amygdaloid- kindling seizures in rats. Neurobiol
Dis 31: 74–79.
23. Wu DC, Zhu-Ge ZB, Yu CY, Fang Q, Wang S, et al. (2008) Low-frequency
stimulation of the tuberomammillary nucleus facilitates electrical amygdaloid-
kindling acquisition in Sprague-Dawley rats. Neurobiol Dis 32: 151–156.
24. Zhang SH, Sun HL, Fang Q, Zhong K, Wu DC, et al. (2009) Low-frequency
stimulation of the hippocampal CA3 subfield is anti-epileptogenic and anti-
ictogenic in rat amygdaloid kindling model of epilepsy. Neurosci Lett 455: 51–
55.
25. Akbarpour B, Sayyah M, Babapour V, Mahdian R, Beheshti S, et al. (201 2)
Expression of connexin 30 and connexin 32 in hippocampus of rat during
epileptogenesis in a kindling model of epilepsy. Neurosci Bull 28: 729–736.
26. Zhang LS, Chen Z, Huang YW, Hu WW, Wei EQ, et al. (2003) Effects of
endogenous histamine on seizure development of pentylenetetrazole-induced
kindling in rats. Pharmacology 69: 27–32.
27. Racine RJ (1972) Modification of seizure activity by electrical stimulation: II
Motor seizure. Electroencephalogr Clin Neurophysiol 32: 281–294.
28. Amaral DG, Witter MP (1995) Hippocampal formation. In: Paxinos G, editor.
The Rat Nervous System: Academic Press. pp. 443–493.
29. Hu WW, Fang Q, Xu ZH, Yan HJ, He P, et al. (2012) Chronic H1-
antihistamine treatment increases seizure susceptibility after withdrawal by
impairing glutamine synthetase. CNS Neurosci Ther 18: 683–990.
30. Itoh K, Watanabe M (2009) Paradoxical facilitation of pentylenetetrazole-
induced convulsion susceptibility in mice lacking neuronal nitric oxide synthase.
Neuroscience 159: 735–743.
31. Go¨rg B, Qvartskhava N, Voss P, Grune T, Ha¨ussinger D, et al. (2007)
Reversible inhibition of mammalian glutamine synthetase by tyrosine nitration.
FEBS Lett 581: 84–90.
32. Ueda Y, Tsuru N (1995) Simultaneous monitoring of the seizure-related changes
in extracellular glutamate and gamma-aminobutyric acid concentration in
bilateral hippocampi following development of amygdaloid kindling. Epilepsy
Res 20:213–219.
33. Bryant AS, Li B, Beenhakker MP, Huguenard JR (2009) Maintenance of
thalamic epileptiform activity depends on the astrocytic glutamate-glutamine
cycle. J Neurophysiol 102: 2880–2888.
34. Tani H, Bandrowski AE, Parada I, Wynn M, Huguenard JR, et al. (2007)
Modulation of epileptiform activity by glutamine and system A transport in a
model of post-traumatic epilepsy. Neurobiol Dis 25: 230–238.
35. Bacci A, Sancini G, Verderio C, Armano S, Pravettoni E, et al. (2002) Block of
glutamate-glutamine cycle between astrocytes and neurons inhibits epileptiform
activity in hippocampus. J Neurophysiol 88: 2302–2310.
36. Lothman EW, Bennett JP, Perlin JB (1987) Alterations in neurotransmitter
amino acids in hippocampal kindled seizures. Epilepsy Res 1: 313–320.
37. Pitka¨ nen A, Pikkarainen M, Nurminen N, Ylinen A (2000) Reciprocal
connections between the amygdala and the hippocampal formation, perirhinal
cortex, and postrhinal cortex in rat. A review. Ann N Y Acad Sci 911: 369–391.
38. Hsu D (2007) The dentate gyrus as a filter or gate: a look back and a look ahead.
Prog Brain Res 163: 601–613.
39. Heinemann U, Beck H, Dreier JP, Ficker E, Stabel J, et al. (1992) The dentate
gyrus as a regulated gate for the propagation of epileptiform activity. Epilepsy
Res Suppl 7: 273–280.
40. Lothman EW, Stringer JL, Bertram EH (1992) The dentate gyrus as a control
point for seizures in the hippocampus and beyond. Epilepsy Res Suppl 7: 301–
313.
41. Stringer JL, Lothman EW (1992) Bilateral maximal dentate activation is critical
for the appearance of an afterdischarge in the dentate gyrus. Neuroscience 46:
309–314.
Glutamine Synthetase in Epileptogenesis
PLOS ONE | www.plosone.org 12 June 2013 | Volume 8 | Issue 6 | e66885
