Fetal Sex Related Dysregulation in Testosterone Production and Their Receptor Expression in the Human Placenta with Preeclampsia

Abstract

To determine the effects of fetal sex on aromatase and androgen receptor (AR) expression in the placenta of normal and preeclamptic pregnancies.
Placentae from preeclamptic (five female and six male fetuses) and healthy pregnancies (seven female and seven male fetuses) were examined by immunofluorescence, western blotting and quantitative reverse transcriptase PCR.
Placental AR levels were significantly higher (P<0.05) in placentae of both male and female fetuses compared with their respective sexes in normal pregnancies. The placental aromatase levels varied depending on fetal sex. If the fetus was female, aromatase levels were substantially higher (P<0.05) in preeclamptic than in normal placentae. If the fetus was male, the aromatase levels were significantly lower (P<0.05) in preeclamptic than in normal placentae. Placental aromatase levels were significantly higher (P<0.05) in male- than in female-bearing normal placentae.
Dysregulation in androgen production and signaling in preeclamptic placentae may contribute to placental abnormalities, increasing the frequency of maternal-fetal complications associated with preeclampsia.

Full text

Fetal Sex Related Dysregulation in Testosterone Production and
Their Receptor Expression in the Human Placenta with
Preeclampsia
Kunju Sathishkumar, PhD1,*, Meena Balakrishnan, MS1, Vijayakumar Chinnathambi, PhD1,
Madhu Chauhan, Phd1, Gary D.V. Hankins, MD1, and Chandrasekhar Yallampalli, PhD1
1Department of Obstetrics and Gynecology, University of Texas Medical Branch Galveston,
Texas, USA
Abstract
Objective—To determine the effects of fetal sex on aromatase and androgen receptor (AR)
expression in the placenta of normal and preeclamptic pregnancies.
Study Design—Placenta from preeclamptic (5-female and 6-male fetus) and healthy
pregnancies (7-female and 7-male fetus) were examined by immunofluorescence, Western blotting
and quantitative-RT-PCR.
Results—Placental AR levels were significantly higher (
P
<0.05) in placentae of both male and
female fetus compared to their respective sexes in normal pregnancies. The placental aromatase
levels varied depending on fetal sex. If the fetus was female, aromatase levels were substantially
higher (
P
<0.05) in preeclamptic than normal placentae. If the fetus was male, the aromatase levels
were significantly lower (
P
<0.05) in preeclamptic than normal placentae. Placental aromatase
levels were significantly higher (
P
<0.05) in male-than in female-bearing normal placentae.
Conclusion—Dysregulation in androgen production and signaling in preeclamptic placentae
may contribute to placental abnormalities increasing the frequency of maternal-fetal complications
associated with preeclampsia.
Keywords
Preeclampsia; Placenta; Androgen receptor; Aromatase; Fetal sex
Introduction
The placenta is a unique and complex endocrine organ that plays a crucial role during fetal
development by allowing rapid exchange of nutrients and wastes between the closely
apposed maternal and fetal circulatory systems.1 In addition to the production of a wide
variety of hormones and other regulatory factors, the placenta is also an endocrine target
tissue, expressing a broad spectrum of hormone receptors and growth factor receptors.2
Thus, a complex interplay of hormones and other regulatory factors produced by the
placenta, mother and fetus affect placental development and functions through endocrine,
paracrine and autocrine mechanisms.
*Corresponding author and reprint requests: Assistant Professor Obstetrics & Gynecology University of Texas Medical Branch
301 University Blvd. Galveston, TX 77555-1062 Phone: (409) 772-7592 Fax: (409) 772-2261 kusathish@utmb.edu.
Conflict of Interest The authors declare no conflict of interest.
NIH Public Access
Author Manuscript
J Perinatol
. Author manuscript; available in PMC 2013 July 16.
Published in final edited form as:
J Perinatol
. 2012 May ; 32(5): 328–335. doi:10.1038/jp.2011.101.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Preeclampsia is a common pregnancy-specific syndrome that is characterized by
hypertension and proteinuria. It is a disorder that affects at least 5% of all pregnancies
worldwide.3,4 Preeclampsia is associated with numerous complications including seizures,
coma, low birth weight and occasionally death of the mother and/or fetus. Additionally,
preeclampsia poses an increased risk for development of cardiovascular dysfunctions later in
life for both child and mother.5-8 The cause of preeclampsia is unknown, however it is
generally accepted that preeclampsia results from the presence of a placenta9 because the
only effective treatment for preeclampsia is the delivery of the placenta. As such, aberrant
development and functions of the placenta are implicated as important factors that contribute
to preeclampsia associated complications. Indeed, abnormalities in the placenta of women
with preeclampsia have been well described; these include poor placental growth, decreased
nutrient transport, improper invasion and inadequate angiogenesis and vasculogenesis.10-13
Numerous studies also demonstrate that preeclampsia alters maternal and fetal endocrine
profiles including increases in the levels of testosterone and a decrease in estrogen
concentrations compared to normal pregnancies.14-25 However, the proportion of increase in
testosterone levels in preeclamptic women varies depending of the sex of fetus. Male-
bearing preeclamptic women had significantly higher testosterone levels than female-
bearing preeclamptic women.21 Whether the placenta directly contributes to some of the
fetal sex related abnormal hormonal profiles in preeclampsia or whether preeclampsia
affects placental endocrine signaling pathways in relation to fetal sex, remains to be
elucidated.
In this study, we evaluated whether there were any fetal sex related differences in the
expression of androgen receptor (AR) and aromatase in the placenta between healthy and
preeclamptic pregnancies. Our data suggest that fetal sex related differences in placental
aromatase exists with increased levels in female and decreased levels in male preeclamptic
pregnancies. The AR levels were significantly elevated in placentae with both male and
female preeclamptic pregnancies. Dysregulation in androgen production, together with
overexpression of their receptors in the placenta, may be associated with abnormalities of
placental growth and transport, trophoblast invasion and placental angiogenesis in
preeclampsia.
Materials and methods
Placental samples
Eleven placentae from pregnancies with preeclampsia (5 with female and 6 with male fetus)
and 14 from normal pregnancies (7 with male and 7 with female fetus) were collected at
term (37-41 weeks of gestation). The patients were diagnosed with preeclampsia based on
new-onset hypertension after 20 weeks’ gestation such that systolic blood pressures of ≥140
mm Hg, diastolic blood pressures of ≥90 mm Hg, or both were seen on 2 occasions ≥6 hours
apart, with significant proteinuria (≥300 mg/24 h). None of the patients had previous history
of any known endocrinopathy. Excluders include smokers and alcoholics and women with
chronic maternal disease (essential hypertension, connective tissue diseases,
hyperthyroidism, hypothyroidism, chronic glomerulonephritis, renal failure, and diabetes
mellitus) or gestational diabetes. The mean gestational age in the normal pregnancies were
similar to those of the preeclampsia group (Table 1). All samples were obtained from the
Department of Obstetrics and Gynecology, University of Texas Medical Branch from
January 2009 through June 2011. The study was approved by the Institutional Review Board
of the University’s Human Studies Committee; informed written consent was obtained from
all subjects. All patients were delivered at term. The placental tissues were collected at
delivery and immediately transferred on ice to the laboratory for preparations of protein
lysate, RNA isolation and tissue fixation.
Sathishkumar et al. Page 2
J Perinatol
. Author manuscript; available in PMC 2013 July 16.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Immunofluorescence
Immunofluorescence was performed on OCT-embedded frozen sections after fixing with
ice-cold acetone for 10 min at room temperature. The sections then were incubated with 3%
Donkey serum in PBS-Tween (0.01%) for 1h at room temp in a humidified chamber to
block nonspecific antibody binding. The first primary antibody, rat anti-AR antibody
(Affinity Bioreagents, Golden, CO) or rabbit polyclonal anti-aromatase (Thermo scientific,
Rockford, IL) was applied at 1:50 dilution overnight, followed by donkey anti-rat or anti-
rabbit IgG Alexa Fluor 488 (Molecular Probes, Eugene, OR). Rat or rabbit IgG (ready to
use) (Dako, Glostrup, Denmark) was used as a negative control. Slides were then
counterstained with Hoechst 33342 (Molecular Probes). Anti-fade mounting medium (Dako)
was applied and slides were viewed and captured with a constant exposure time and aperture
using a single threshold value under a Nikon Eclipse E800 epifluorescence microscope
using a Nikon Digital camera Dxm1200. Subsequently, images were analyzed using
Metamorph software and the numerical output of average 488nm pixel intensity (green
fluorescence) per nuclei (blue fluorescence; Hoechst 33342) was calculated.
Western blotting
This procedure was performed with an enhanced chemiluminescence (ECL) detection
system. Briefly, placental villi were homogenized in ice-cold 50 mM Tris–HCl, pH 7.4
buffer containing a complete protease inhibitor cocktail (Roche Applied Science,
Indianapolis, IN). The protein concentration was measured by Bradford method (Bio-Rad,
Hercules, CA). Protein aliquots of 20 μg were electrophoresed in sodium dodecyl sulfate-
polyacrylamide gels and transferred to Immobilon-P membranes (Millipore, Bedford, MA).
The membranes were blocked with 5% (w/v) nonfat dry milk followed by incubation
overnight with antibodies against 1:1000 diluted antibodies against AR (Affinity
Bioreagents) and aromatase (Themo Scientific). Peroxidase-conjugated anti-rat or anti-rabbit
IgG was used as the secondary antibody (Southern Biotech, Birmingham, AL). All the
members were re-blotted with 1:1000 diluted polyclonal antibody against β-actin (Santa
Cruz Biotechnology, Santa Cruz, CA) to serve as a loading control. Specific protein bands
were detected with ECL Western blotting detection reagents (Affinity Bioreagents). One
normal female placental sample was used on each gel to normalize density readings between
gels. The specific bands were scanned and band intensity was quantified using the Alpha
ease image analysis program. Results were expressed as ratios of the intensity of specific
band to that of β-actin.
Quantitative RT-PCR
Total placental RNA was isolated with RNeasy kit (Qiagen, Valencia, CA) according to the
procedure recommended by the manufacturer. RNA extraction was followed by DNase 1
(Qiagen) treatment to remove DNA contamination. The quality and quantity of the RNA
were assessed at 260/280 A, and all samples showed absorbency ratios ranging from 1.8 to
2.0. Total RNA of 1 μg were reverse transcribed into cDNA using avian myeloblastosis
virus reverse transcriptase (Promega Corp., Madison, WI) and random oligonucleotide
hexamers (Invitrogen, Carlsbad, CA). For the detection of AR and ARO genes, quantitative
real-time RT-PCR (q-RT-PCR) was done with CFX96 system (Bio-Rad, Hercules, CA)
using published primers for human AR and aromatase. The primer sequences for
AR
are 5′-
CCTGGCTTCCGCAACTTACAC-3′ (forward) and 5′-
GGACTTGTGCATGCGGTACTCA -3′ (reverse). The primer sequences for
ARO
are 5′-
GTGGACGTGTTGACCCTTCT -3′ (forward) and 5′-CACGATAGCACTTTCGTCCA -3′
(reverse). A comparative cycle of threshold fluorescence (
C
T) method was used with
GAPDH as an internal control (5′-GGTC TCCT CTGA CTTC AACA-3′ (forward) and 5′-
AGCC AAAT TCGT TGTC ATAC-3′(reverse)). The
C
T value for GAPDH was subtracted
from the
C
T value for the gene of interest to give a Δ
C
T for each sample. The Δ
C
T of the
Sathishkumar et al. Page 3
J Perinatol
. Author manuscript; available in PMC 2013 July 16.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

calibrator (in this case the mean Δ
C
T of the placenate from normal pregnant) was then
subtracted from each sample to give a ΔΔ
C
T value. This was then inserted into 2−ΔΔ
C
T to
give a final expression relative to the calibrator.
Statistical analysis
Results are expressed as mean values ± SE. Comparisons between the data were performed
using Graphpad prism Software (San Diego, CA). Criteria for statistical significance were
set at
P
< 0.05 after two-way ANOVA followed by Bonferroni
post hoc
testing for multiple
comparisons. Unpaired student
t
test (2-tailed) was used for comparisons of biological
parameters between normal and preeclamptic pregnancies.
Results
Patient characteristics
In this pilot study, placenta of pregnant women bearing female (n=7) and male fetus (n=7)
served as controls for the preeclamptic placentae with female (n=5) and male fetus (n=6).
There were no significant differences in mean maternal age, mean gestational age, and body
mass index between the groups. The clinical and biological parameters of this aged-matched
population group and sociodemographic details are shown in Table 1. The preeclamptic
patients with both male and female fetus had a significantly higher systolic (
P
< .05) and
diastolic (
P
< .05) blood pressure than the respective sex in normal pregnant women.
Immunofluorescence
Immunostaining of AR was barely detectable in the placentae of normal pregnancies (Fig.
1A and 1B, top panel). In contrast, the AR was readily detectable in the placentae of
preeclamptic pregnancies and was significantly greater in the placentae with both female (
P
=.002) and male (
P
=.019) fetus compared to their respective sexes in normal pregnancies
(Fig. 1A and 1B, bottom panel and Fig 1E, top panel). The AR staining intensity did not
significantly vary between fetal sex when compared within the normal and preeclamptic
placentae (Fig. 1E, top panel). Immunostaining of AR in preeclamptic placentae was mainly
found in the syncytiotrophoblasts (Fig. 1A and 1B, bottom panel).
The immunostaining intensity of aromatase in preeclamptic placentae varied depending on
fetal sex. If the fetus was a female, the staining intensity for aromatase was substantially
higher (
P
=.04) in preeclamptic placentae than normal placentae (Fig. 1C and Fig. 1E, lower
panel). On the other hand, if the fetus was a male, the staining intensity for aromatase was
significantly lower (
P
=.01) in preeclamptic placentae than normal placentae (Fig. 1D and
Fig. 1E, lower panel). Within the placentae of normal pregnancies, aromatase staining
intensity was significantly higher (
P
=.03) in placentae with male than female fetus (Fig. 1E,
bottom panel). On the other hand, the aromatase staining intensity was significantly lower (
P
= .01) in male than preeclamptic placentae (Fig. 1E). Aromatase protein was exclusively
localized in the syncytiotrophoblast in the control and preeclamptic placentae (Fig. 1C and
D). No detectable staining was observed when primary antibody to AR or aromatase was
omitted (procedure control; data not shown).
Western blot
To further verify the changes in AR in the preeclamptic placentae, Western blotting analyses
were performed. Consistent with the immunohistochemical observations, the levels of AR
protein (110 kDa) are significantly elevated (
P
=.001) in the placentae of preeclamptic
women compared to normal pregnant women and fetal sex had no effect (Fig. 2A). Within
the normal and preeclamptic pregnancies there were no significant differences between
sexes on levels of AR protein (Fig. 2A).
Sathishkumar et al. Page 4
J Perinatol
. Author manuscript; available in PMC 2013 July 16.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

The levels of aromatase protein (55 kDa) were markedly increased in preeclamptic placentae
with female fetus (
P
=.004) while it is significantly decreased in placentae with male fetus
(
P
=.01) compared to the respective sexes in normal placentae (Fig. 2B). The normal
placentae with male fetus have significantly higher (
P
= 0.04) levels of aromatase protein
than normal placentae with female fetus. Conversely, in preeclamptic placentae with male
fetus have significantly lower (
P
= 0.001) levels of aromatase protein than female
preeclamptic placentae (Fig. 2B).
Quantitative RT-PCR
To examine whether preeclampsia also altered the expression of AR and aromatase (also
known as CYP19) genes, quantitative RT-PCR analyses were carried out. The results
showed that the levels of AR mRNA were significantly elevated in placentae with male (
P
=.03) and female (
P
=.001) fetuses in preeclamptic women compared to their respective
sexes in placentae from normal women (Fig. 3A). The increase in levels of AR mRNA in
the male preeclamptic compared to the female preeclamptic placentae was not statistically
significant (
P
=.33; Fig. 3A).
The levels of aromatase mRNA in preeclamptic placentae were significantly higher if the
fetus was a female (
P
=.04) while it was significantly lower if the fetus was a male (
P
=.04)
compared to their respective sexes in normal placentae Fig. 3B). The levels of aromatase
mRNA in the normal placentae were significantly higher in male than female fetus (
P
=
0.02; Fig. 3B). On the other hand, in the preeclamptic placentae the aromatase mRNA levels
were significantly lower in male than female fetus (
P
< 0.04; Fig. 3B). Changes in AR and
aromatase protein levels are consistent with changes in their mRNA abundance suggesting
that preeclampsia may influence placental gene expression of the AR and aromatase at the
transcriptional level.
Discussion
The placenta is an endocrine organ that plays an important role during pregnancy. Placenta
produces numerous hormones that regulate maternal function and fetal growth. There have
been a number of reports that women with preeclampsia have higher plasma testosterone
levels compared with those of healthy pregnant women.14-25 Although the origin of the
increased androgens during pregnancy remains uncertain, studies suggests that elevation of
testosterone production during pregnancy is likely of ovarian origin.26,27 Whether the
placenta also contributes to the increased testosterone levels in the maternal circulation
remains largely unresolved.26,28,29 While the human placenta lacks 17β-hydroxylase and
17,20-desmolase,30 it does express 17β-hydroxysteroid dehydrogenase (17β-HSD)31 and
aromatase as well as 3β-hydroxysteroid dehydrogenase (3β-HSD).32 Placenta can therefore
synthesize androstenedione from adrenal or ovarian DHEAS and can undertake the onward
synthesis of both testosterone and estradiol. Normally, androgens synthesized by the
placenta are rapidly converted to estrogens by placental aromatase,33,34 and therefore the
placental androgens may contribute only slightly to the increased androgen observed in
normal pregnancy. In this study, the placental mRNA and protein levels of aromatase, a rate
limiting enzyme converting androgens to estrogens, varied depending on fetal sex. If the
fetus was a female, the aromatase expression was higher in preeclamptic than normal
placentae. On the other hand if the fetus was a male, the aromatase expression was lower in
preeclamptic than normal placentae. Previous studies suggest that maternal testosterone
levels are higher in preeclamptic pregnancies irrespective of the sex of the fetus compared to
normal pregnancies. However, testosterone levels are significantly higher in male- than in
female-bearing preeclamptic pregnancies.35 Based on our findings, it is possible that the
increased expression of aromatase in the placentae of female fetus-bearing preeclamptic
women could have partially metabolized the excess testosterone contributing for relatively
Sathishkumar et al. Page 5
J Perinatol
. Author manuscript; available in PMC 2013 July 16.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

lower maternal testosterone levels. This may be an adaptive protective mechanism to
prevent the female fetuses from virilization when the mothers themselves have high
circulating testosterone levels. Despite higher aromatase levels in preeclamptic placentae of
female fetus, higher maternal circulating levels are observed in female bearing preeclamptic
pregnancies36 suggesting that testosterone production is higher such that the increased
expression of aromatase may not be sufficient to metabolize androgens to levels that are
observed in normal pregnancies. In the placenta with male fetus, the decrease in aromatase
levels could have contributed for the relatively higher testosterone levels by altering the
equilibrium between estrogens and androgens in favor of androgens. These findings imply
that increased testosterone during preeclamptic pregnancies may be primarily of non
placental origin but the placenta, depending on fetal sex, may modulate the levels of
maternal testosterone. Thus, the fetal sex specific abnormal maternal profile of androgens in
preeclampsia may be attributed, at least in part, to altered aromatase levels in the placenta. It
would be interesting to assess if such fetal sex-dependent differential expression in
aromatase levels also exists in tissues or organs other than placenta.
The mechanisms that contribute to the inhibition of aromatase in the preeclamptic placenta
with male fetus is not known. In the placenta, the major factors involved in regulating
aromatase activity (retinoids,37 tumor-necrosis factor alpha,38 and lipid radicals39) are all
dysregulated during preeclampsia in a way that could potentially down-regulate
aromatase.40-43 Aromatase expression in the trophoblast is barely detectable under hypoxic
conditions44 (which mirror the actual conditions of the placenta in the context of
preeclampsia). Moreover, insulin15 and leptin,30 which are significantly increased in
preeclamptic patients, has been shown to inhibit aromatase in human cytotrophoblasts. Why
the inhibitory effect of placental aromatase is specific to male sex is not known at this time.
It is suggested that the placenta with female fetus has greater adaptability to adverse
maternal environment that placenta with male fetus.45 Similar findings of fetal sex specific
differences in placental cytokine expression, insulin-like growth factor pathways and the
placental response to cortisol in relation to the complication of asthma during pregnancy are
reported.46-49
Even in the normal pregnancies, the placentae with male fetus have higher aromatase levels
than placentae with female fetus. The male fetus produces testosterone starting as early as 8
weeks of age with peak levels reaching upto 150 ng/dl around mid gestation. Despite greater
production of testosterone by male fetus, the maternal testosterone levels are not
significantly different between the male and female bearing normal pregnant women.35 This
suggests that the increased aromatase levels in placentae of male fetus may act as an
effective barrier to prevent transfer of testosterone from fetal side to maternal circulation.
Previous studies show inconclusive results regarding the presence of AR in the human
placenta.50-53 In this study, we show that the mRNA and protein of AR, are detectable in the
syncytiotrophoblasts. The most significant finding of this study is that the expression of AR
in the preeclampsia placentae is considerably increased irrespective of fetal sex compared to
their respective sexes in normal pregnancies. Although there is no information available at
this time regarding the role of androgen signaling in the placenta, androgens are known to be
pleiotropic hormones with genomic and non-genomic activity involving a myriad of
biological processes. Dysregulation in androgen signaling in the placenta may profoundly
interfere with its development and function. It is well known that increase in testosterone
levels and altered
in utero
environment during pregnancy increases the risk of
cardiovascular dysfunction in the mothers5-8 as well as program for adult life cardiovascular,
metabolic and endocrine dysfunctions in the offspring.54-58 Therefore, it is likely that a
combination of overexpression of placental AR and fetal sex-specific dysregulation in
Sathishkumar et al. Page 6
J Perinatol
. Author manuscript; available in PMC 2013 July 16.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

placental androgen production in preeclampsia may play a significant role in contributing
for development of gender-specific diseases later in life.
Although this pilot study provided initial evidence for increased placental androgen receptor
levels in preeclamptic pregnancies and the placental aromatase levels varied in a fetal sex-
specific manner in both normal and preeclamptic pregnancies, the limited number of patients
is a potential weakness. Our results will have to be confirmed in a larger cohort, with
longitudinal data to assess the full impact of our studies.
5. Conclusions
The aromatase levels in placentae vary depending on fetal sex in normal and preeclamptic
pregnancies. In preeclamptic pregnancies with male fetuses, the observed increase in
circulating testosterone may be associated, at least in part, to due to the decrease in placental
aromatase that reduces the conversion of testosterone to estrogens. In preeclamptic
pregnancies with female fetuses, the relatively lower circulating testosterone may be due to
the increased placental aromatase levels. Placental androgen receptor levels are upregulated
in preeclamptic pregnancies with both fetal sexes suggesting that the androgen signaling
pathways may be over-activated in the placentae of pregnancies with preeclampsia.
Dysregulation of these androgen signaling networks may be involved in the development of
placental abnormalities which eventually increase the frequency of maternal and fetal
complications associated with preeclampsia.
Acknowledgments
Financial support: is provided in part by grants HD69750, HL58144 and HL72650 from the National Institute of
Health.
References
1. Gude NM, Roberts CT, Kalionis B, King RG. Growth and function of the normal human placenta.
Thromb.Res. 2004; 114:397–407. [PubMed: 15507270]
2. Lei, ZM.; Rao, CV. Endocrinology of trophoblastic tissue. In: Becker, Kenneth L., editor. Principles
and practice of endocrinology and metabolism. 3rd ed. Lippincott Williams & Wilkins;
Philadelphia: 2001. p. 180-186.
3. Report of the National High Blood Pressure Education Program Working Group on High Blood
Pressure in Pregnancy. Am J Obstet.Gynecol. 2000; 183:S1–S22.
4. Sibai BM, Caritis S, Hauth J. What we have learned about preeclampsia. Semin.Perinatol. 2003;
27:239–246. [PubMed: 12889591]
5. Geelhoed JJ, Fraser A, Tilling K, Benfield L, Davey SG, Sattar N, et al. Preeclampsia and
gestational hypertension are associated with childhood blood pressure independently of family
adiposity measures: the Avon Longitudinal Study of Parents and Children. Circulation. 2010;
122:1192–1199. [PubMed: 20823385]
6. Jayet PY, Rimoldi SF, Stuber T, Salmon CS, Hutter D, Rexhaj E, et al. Pulmonary and systemic
vascular dysfunction in young offspring of mothers with preeclampsia. Circulation. 2010; 122:488–
494. [PubMed: 20644018]
7. Luft FC. Pre-eclampsia and the maternal cardiovascular risk. Nephrol.Dial.Transplant. 2003;
18:860–861. [PubMed: 12686652]
8. Laivuori H, Kaaja R, Rutanen EM, Viinikka L, Ylikorkala O. Evidence of high circulating
testosterone in women with prior preeclampsia. J Clin Endocrinol Metab. 1998; 83:344–347.
[PubMed: 9467538]
9. Redman CW. Current topic: pre-eclampsia and the placenta. Placenta. 1991; 12:301–308. [PubMed:
1946241]
Sathishkumar et al. Page 7
J Perinatol
. Author manuscript; available in PMC 2013 July 16.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

10. Zhong Y, Tuuli M, Odibo AO. First-trimester assessment of placenta function and the prediction of
preeclampsia and intrauterine growth restriction. Prenat.Diagn. 2010; 30:293–308. [PubMed:
20166149]
11. Roberts CT. IFPA Award in Placentology Lecture: Complicated interactions between genes and
the environment in placentation, pregnancy outcome and long term health. Placenta. 2010;
31:S47–S53. [PubMed: 20096927]
12. Foidart JM, Schaaps JP, Chantraine F, Munaut C, Lorquet S. Dysregulation of anti-angiogenic
agents (sFlt-1, PLGF, and sEndoglin) in preeclampsia--a step forward but not the definitive
answer. J Reprod.Immunol. 2009; 82:106–111. [PubMed: 19853925]
13. Furuya M, Ishida J, Aoki I, Fukamizu A. Pathophysiology of placentation abnormalities in
pregnancy-induced hypertension. Vasc.Health Risk Manag. 2008; 4:1301–1313. [PubMed:
19337544]
14. Laivuori H, Kaaja R, Rutanen EM, Viinikka L, Ylikorkala O. Evidence of high circulating
testosterone in women with prior preeclampsia. J Clin.Endocrinol.Metab. 1998; 83:344–347.
[PubMed: 9467538]
15. Acromite MT, Mantzoros CS, Leach RE, Hurwitz J, Dorey LG. Androgens in preeclampsia. Am J
Obstet.Gynecol. 1999; 180:60–63. [PubMed: 9914579]
16. Salamalekis E, Bakas P, Vitoratos N, Eleptheriadis M, Creatsas G. Androgen levels in the third
trimester of pregnancy in patients with preeclampsia. Eur.J Obstet.Gynecol.Reprod.Biol. 2006;
126:16–19. [PubMed: 16139944]
17. Ghorashi V, Sheikhvatan M. The relationship between serum concentration of free testosterone and
pre-eclampsia. Endokrynol.Pol. 2008; 59:390–392. [PubMed: 18979448]
18. Serin IS, Kula M, Basbug M, Unluhizarci K, Gucer S, Tayyar M. Androgen levels of preeclamptic
patients in the third trimester of pregnancy and six weeks after delivery. Acta
Obstet.Gynecol.Scand. 2001; 80:1009–1013. [PubMed: 11703197]
19. Carlsen SM, Romundstad P, Jacobsen G. Early second-trimester maternal hyperandrogenemia and
subsequent preeclampsia: a prospective study. Acta Obstet.Gynecol.Scand. 2005; 84:117–121.
[PubMed: 15683369]
20. Baksu A, Gurarslan H, Goker N. Androgen levels in pre-eclamptic pregnant women. Int J
Gynaecol.Obstet. 2004; 84:247–248. [PubMed: 15001373]
21. Steier JA, Ulstein M, Myking OL. Human chorionic gonadotropin and testosterone in normal and
preeclamptic pregnancies in relation to fetal sex. Obstet.Gynecol. 2002; 100:552–556. [PubMed:
12220777]
22. Hsu TY, Lan KC, Tsai CC, Ou CY, Cheng BH, Tsai MY, et al. Expression of androgen receptor in
human placentas from normal and preeclamptic pregnancies. Taiwan.J Obstet.Gynecol. 2009;
48:262–267. [PubMed: 19797017]
23. Gerulewicz-Vannini D, Camero Y, Salas J, Hernandez-Andrade E. [High plasmatic androgen
levels in women affected with pregnancy-induced hypertension]. Rev.Invest Clin. 2006; 58:228–
233. [PubMed: 16958298]
24. Atamer Y, Erden AC, Demir B, Kocyigit Y, Atamer A. The relationship between plasma levels of
leptin and androgen in healthy and preeclamptic pregnant women. Acta Obstet.Gynecol.Scand.
2004; 83:425–430. [PubMed: 15059152]
25. Troisi R, Potischman N, Roberts JM, Ness R, Crombleholme W, Lykins D, et al. Maternal serum
oestrogen and androgen concentrations in preeclamptic and uncomplicated pregnancies. Int J
Epidemiol. 2003; 32:455–460. [PubMed: 12777436]
26. Dokras A, Spaczynski RZ, Behrman HR, Duleba AJ. Testosterone levels in pregnant women
correlate with the insulin response during the glucose tolerance test. Fertil.Steril. 2003; 79:492–
497. [PubMed: 12620428]
27. Steier JA, Ulstein M, Myking OL. Human chorionic gonadotropin and testosterone in normal and
preeclamptic pregnancies in relation to fetal sex. Obstet.Gynecol. 2002; 100:552–556. [PubMed:
12220777]
28. Nestler JE. Modulation of aromatase and P450 cholesterol side-chain cleavage enzyme activities of
human placental cytotrophoblasts by insulin and insulin-like growth factor I. Endocrinology. 1987;
121:1845–1852. [PubMed: 3311719]
Sathishkumar et al. Page 8
J Perinatol
. Author manuscript; available in PMC 2013 July 16.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

29. Acromite MT, Mantzoros CS, Leach RE, Hurwitz J, Dorey LG. Androgens in preeclampsia. Am J
Obstet.Gynecol. 1999; 180:60–63. [PubMed: 9914579]
30. Christensen A. Hormone and enzyme assays in pregnancy. I. Studies on the placental and the tissue
cystine-aminopeptidase activity in peripheral plasma from non-pregnant and pregnant women, and
in plasma from the umbilical cord. Acta Endocrinol (Copenh). 1974; 76:189–200. [PubMed:
4406583]
31. Takeyama J, Sasano H, Suzuki T, Iinuma K, Nagura H, Andersson S. 17Beta-hydroxysteroid
dehydrogenase types 1 and 2 in human placenta: an immunohistochemical study with correlation
to placental development. J Clin Endocrinol Metab. 1998; 83:3710–3715. [PubMed: 9768688]
32. Mason JI, Ushijima K, Doody KM, Nagai K, Naville D, Head JR, et al. Regulation of expression
of the 3 beta-hydroxysteroid dehydrogenases of human placenta and fetal adrenal. J Steroid
Biochem.Mol.Biol. 1993; 47:151–159. [PubMed: 8274430]
33. Gant NF, Hutchinson HT, Siiteri PK, MacDonald PC. Study of the metabolic clearance rate of
dehydroisoandrosterone sulfate in pregnancy. Am J Obstet.Gynecol. 1971; 111:555–563.
[PubMed: 4255314]
34. Buster JE, Chang RJ, Preston DL, Elashoff RM, Cousins LM, Abraham GE, Hobel CJ, Marshall
JR. Interrelationships of circulating maternal steroid concentrations in third trimester pregnancies.
II. C18 and C19 steroids: estradiol, estriol, dehydroepiandrosterone, dehydroepiandrosterone
sulfate, delta 5-androstenediol, delta 4-androstenedione, testosterone, and dihydrotestosterone. J
Clin Endocrinol Metab. 1979; 48:139–142. [PubMed: 154525]
35. Steier JA, Ulstein M, Myking OL. Human chorionic gonadotropin and testosterone in normal and
preeclamptic pregnancies in relation to fetal sex. Obstet.Gynecol. 2002; 100:552–556. [PubMed:
12220777]
36. Vlkova B, Vavrova S, Szemes T, Minarik G, Turna J, Celec P. Testosterone and estradiol in
maternal plasma and their relation to fetal sex. Prenat.Diagn. 2010; 30:806–807. [PubMed:
20661893]
37. Zhu SJ, Li Y, Li H, Wang YL, Xiao ZJ, Vihko P, Piao YS. Retinoic acids promote the action of
aromatase and 17beta-hydroxysteroid dehydrogenase type 1 on the biosynthesis of 17beta-
estradiol in placental cells. J Endocrinol. 2002; 172:31–43. [PubMed: 11786372]
38. Diaz L, Noyola-Martinez N, Barrera D, Hernandez G, Avila E, et al. Calcitriol inhibits TNF-alpha-
induced inflammatory cytokines in human trophoblasts. J Reprod.Immunol. 2009; 81:17–24.
[PubMed: 19501915]
39. Milczarek R, Sokolowska E, Hallmann A, Kaletha K, Klimek JN. J Steroid Biochem.Mol.Biol.
2008; 110:230–235. [PubMed: 18499441]
40. Zhang C, Williams MA, Sanchez SE, King IB, Ware-Jauregui S, Larrabure G, et al. Plasma
concentrations of carotenoids, retinol, and tocopherols in preeclamptic and normotensive pregnant
women. Am J Epidemiol. 2001; 153:572–580. [PubMed: 11257065]
41. Williams MA, Woelk GB, King IB, Jenkins L, Mahomed K. Plasma carotenoids, retinol,
tocopherols, and lipoproteins in preeclamptic and normotensive pregnant Zimbabwean women.
Am J Hypertens. 2003; 16:665–672. [PubMed: 12878373]
42. Cackovic M, Buhimschi CS, Zhao G, Funai EF, Norwitz ER, Kuczynski E, et al. Fractional
excretion of tumor necrosis factor-alpha in women with severe preeclampsia. Obstet.Gynecol.
2008; 112:93–100. [PubMed: 18591313]
43. Kaur G, Mishra S, Sehgal A, Prasad R. Alterations in lipid peroxidation and antioxidant status in
pregnancy with preeclampsia. Mol.Cell Biochem. 2008; 313:37–44. [PubMed: 18373068]
44. Jiang B, Kamat A, Mendelson CR. Hypoxia prevents induction of aromatase expression in human
trophoblast cells in culture: potential inhibitory role of the hypoxia-inducible transcription factor
Mash-2 (mammalian achaete-scute homologous protein-2). Mol.Endocrinol. 2000; 14:1661–1673.
[PubMed: 11043580]
45. Clifton VL. Review: Sex and the human placenta: mediating differential strategies of fetal growth
and survival. Placenta. 2010; 31:S33–S39. [PubMed: 20004469]
46. Hodyl NA, Wyper H, Osei-Kumah A, Scott N, Murphy VE, Gibson P, Smith R, Clifton VL. Sex-
specific associations between cortisol and birth weight in pregnancies complicated by asthma are
Sathishkumar et al. Page 9
J Perinatol
. Author manuscript; available in PMC 2013 July 16.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

not due to differential glucocorticoid receptor expression. Thorax. 2010; 65:677–683. [PubMed:
20627904]
47. Clifton VL, Hodyl NA, Murphy VE, Giles WB, Baxter RC, Smith R. Effect of maternal asthma,
inhaled glucocorticoids and cigarette use during pregnancy on the newborn insulin-like growth
factor axis. Growth Horm.IGF.Res. 2010; 20:39–48. [PubMed: 19695914]
48. Scott NM, Hodyl NA, Murphy VE, Osei-Kumah A, Wyper H, Hodgson DM, Smith R, Clifton VL.
Placental cytokine expression covaries with maternal asthma severity and fetal sex. J.Immunol.
2009; 182:1411–1420. [PubMed: 19155488]
49. Engel PJ, Smith R, Brinsmead MW, Bowe SJ, Clifton VL. Male sex and pre-existing diabetes are
independent risk factors for stillbirth. Aust.N.Z.J.Obstet.Gynaecol. 2008; 48:375–383. [PubMed:
18837843]
50. Macaulay JO, Warne GL, Krozowski ZS. Human placenta contains a high affinity R1881 binding
site that is not the androgen receptor. J Steroid Biochem. 1988; 29:497–503. [PubMed: 3259998]
51. Horie K, Takakura K, Imai K, Liao S, Mori T. Immunohistochemical localization of androgen
receptor in the human endometrium, decidua, placenta and pathological conditions of the
endometrium. Hum.Reprod. 1992; 7:1461–1466. [PubMed: 1291578]
52. Iwamura M, Abrahamsson PA, Benning CM, Cockett AT, di Sant’Agnese PA. Androgen receptor
immunostaining and its tissue distribution in formalin-fixed, paraffin-embedded sections after
microwave treatment. J Histochem.Cytochem. 1994; 42:783–788. [PubMed: 8189040]
53. Chan CC, Lao TT, Ho PC, Sung EO, Cheung AN. The effect of mifepristone on the expression of
steroid hormone receptors in human decidua and placenta: a randomized placebo-controlled
double-blind study. J Clin Endocrinol Metab. 2003; 88:5846–5850. [PubMed: 14671179]
54. King AJ, Olivier NB, Mohankumar PS, Lee JS, Padmanabhan V, Fink GD. Hypertension caused
by prenatal testosterone excess in female sheep. Am.J.Physiol Endocrinol.Metab. 2007;
292:E1837–E1841. [PubMed: 17327368]
55. Sathishkumar K, Elkins R, Yallampalli U, Yallampalli C. Elevated Androgen Levels During
Pregnancy Impair Fetal Growth Due to Placental Insufficiency and Programs for Adult
Hypertension in Rats. Biology of Reproduction. 2009; 83:250. (Abstract).
56. Ortega HH, Salvetti NR, Padmanabhan V. Developmental programming: prenatal androgen excess
disrupts ovarian steroid receptor balance. Reproduction. 2009; 137:865–877. [PubMed: 19261835]
57. Demissie M, Lazic M, Foecking EM, Aird F, Dunaif A, Levine JE. Transient prenatal androgen
exposure produces metabolic syndrome in adult female rats. Am.J.Physiol Endocrinol.Metab.
2008; 295:E262–E268. [PubMed: 18544644]
58. Veiga-Lopez A, Ye W, Phillips DJ, Herkimer C, Knight PG, Padmanabhan V. Developmental
programming: deficits in reproductive hormone dynamics and ovulatory outcomes in prenatal,
testosterone-treated sheep. Biol.Reprod. 2008; 78:636–647. [PubMed: 18094354]
59. Stark MJ, Clifton VL, Wright IM. Neonates born to mothers with preeclampsia exhibit sex-specific
alterations in microvascular function. Pediatr.Res. 2009; 65:292–295. [PubMed: 19391250]
Sathishkumar et al. Page 10
J Perinatol
. Author manuscript; available in PMC 2013 July 16.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Sathishkumar et al. Page 11
J Perinatol
. Author manuscript; available in PMC 2013 July 16.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Sathishkumar et al. Page 12
J Perinatol
. Author manuscript; available in PMC 2013 July 16.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Fig. 1.
Immunofluorescence staining of AR in normal and preeclampsia placentae with female (A)
and male (B) fetus. Immunostaining of aromatase in placentae of female (C) and male (D)
fetus. (100x magnification). (E) Quantification of AR and aromatase staining intensity
(green fluorescence) per nuclei (blue fluorescence). The mean staining intensity in the
normal placentae with female fetus was assigned a value of 1, and the mean density of the
other groups was calculated relative to normal female placentae. Values are given as means
± SEM. Bars with different letter superscripts differ significantly (
P
<0.05; n=3 in each
group)
Sathishkumar et al. Page 13
J Perinatol
. Author manuscript; available in PMC 2013 July 16.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Fig. 2.
Western blotting analysis of AR and aromatase protein levels in preeclamptic and normal
placenta of female and male fetus. Top panels show representative blots of AR and
aromatase along with β-actin, and bottom panel is the summary of densitometric analysis of
AR (A) and aromatase (B). The mean density in the normal placentae with female fetus was
assigned a value of 1, and the mean density of the other groups was calculated relative to
normal female placentae. Values are given as means ± SEM. Bars with different letter
superscripts differ significantly (
P
<0.05; n=5-7 in each group)
Sathishkumar et al. Page 14
J Perinatol
. Author manuscript; available in PMC 2013 July 16.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Fig. 3.
Quantitative RT-PCR analysis of placental gene expression of AR (A) and aromatase (B) in
preeclamptic and normal placenta with female and male fetus. The mean mRNA expression
of the normal placentae with female fetus was assigned a value of 1 and the mean of the
other groups were calculated relative to the normal female placenta. Values are given as
means ± SEM. Bars with different letter superscripts differ significantly (
P
<0.05; n=5-7 in
each group)
Sathishkumar et al. Page 15
J Perinatol
. Author manuscript; available in PMC 2013 July 16.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Sathishkumar et al. Page 16
Table 1
Patient Characteristics
Normal Pregnant Preeclampsia
Characteristics Female Male Female Male
Maternal age, y 23.1±2.18 24.8±1.26 21.5±2.87 22.4±1.43
Gestational age, weeks 38.8±1.34 39.1±1.23 37.6±0.91 37.1±1.51
BMI (kg/m2)
a
35.2±3.85 34.2±1.01 36.9±5.53 35.7±2.17
Systolic blood pressure, mm Hg 107.7±1.07 118.0±3.67 152.7±3.75
*
155.0±5.54
*
Diastolic blood pressure, mm Hg 62.1±2.69 69.4±3.87 83.2±7.33
*
98.8±5.20
*
Birthweight, g 3425.7±172.16 2927.9±585.29 2393.3±413.12
*
2716.0±537.10
Number of placenta (n) 7 7 5 6
Ethnicity
Hispanic
White
African-American
7
-
-
6
1
-
4
-
1
4
1
1
Data are expressed as mean ± SEM. Unpaired Student t test (2-tailed) was used for statistical analysis.
*P
< .05 vs respective gender in Normal Pregnant.
a
BMI: Body mass index
J Perinatol
. Author manuscript; available in PMC 2013 July 16.