p14(ARF) regulates E2F activity

Abstract

The ARF protein product of the ink4a/arf locus is induced by a variety of oncogenic signals. ARF facilitates growth arrest through the p53 pathway by hindering the down-regulation of p53 activity mediated by MDM2, through the formation of a protein complex with MDM2. Here we have explored the possibility that human p14(ARF) activity is integrated with growth regulating pathways other than p53, and report our results that p14(ARF) can control the activity of the E2F transcription factor. p14(ARF) regulates E2F activity in different cell-types, including p53(-/-)/mdm(-/-) MEFs, thus excluding that the effects of p14(ARF) are indirectly caused through MDM2 modulation. p14(ARF) down-regulates E2F-dependent transcription, and in cells undergoing E2F-dependent apoptosis prompts cell cycle arrest. p14(ARF) possesses multiple binding domains for E2F-1, one of which resides within the N-terminal region and coincides with the regulation of E2F activity. A mutational analysis of p14(ARF) indicates that the E2F-1 and MDM2 binding domains can be distinguished. These results highlight the potential interplay between p14(ARF) and E2F, and establish p14(ARF) as a pleiotrophic regulator of cell growth that acts by targetting at least two key pathways in the control of proliferation, namely E2F and p53.

Full text

p14
ARF
regulates E2F activity
Sarah L Mason
1
,O
È
onagh Loughran
1
and Nicholas B La Thangue*
,1
1
Division of Biochemistry and Molecular Biology, Institute of Biomedical and Life Sciences, Davidson Building, University of
Glasgow, Glasgow G12 8QQ, UK
The ARF protein product of the ink4a/arf locus is
induced by a variety of oncogenic signals. ARF
facilitates growth arrest through the p53 pathway by
hindering the down-regulation of p53 activity mediated
by MDM2, through the formation of a protein complex
with MDM2. Here we have explored the possibility that
human p14
ARF
activity is integrated with growth
regulating pathways other than p53, and report our
results that p14
ARF
can control the activity of the E2F
transcription factor. p14
ARF
regulates E2F activity in
dierent cell-types, including p53
7/7
/mdm
7/7
MEFs,
thus excluding that the eects of p14
ARF
are indirectly
caused through MDM2 modulation. p14
ARF
down-
regulates E2F-dependent transcription, and in cells
undergoing E2F-dependent apoptosis prompts cell cycle
arrest. p14
ARF
possesses multiple binding domains for
E2F-1, one of which resides within the N-terminal region
and coincides with the regulation of E2F activity. A
mutational analysis of p14
ARF
indicates that the E2F-1
and MDM2 binding domains can be distinguished. These
results highl ight the potential interplay between p14
ARF
and E2F, and establish p14
ARF
as a pleiotrophic regulator
of cell growth that acts by targetting at least two key
pathways in the control of proliferati on, namely E2F and
p53.
Oncogene (2002) 21, 4220 ± 4230. doi :10.1038/s j.onc.
1205524
Keywords: E2F; P14
ARF
; MDM2; p53
Introduction
The ink4a/arf locus is frequently mutated in human
cancer (Chin et al., 1998; Sherr, 1998). In humans, the
locus encompasses two independent but overlapping
genes that encode two proteins, p16
INK4a
and p14
ARF
(Quelle et al., 1995). The p16
INK4a
protein acts through
the pathway of control governed by the retinoblastoma
tumour suppressor protein pRb which, in normal cells,
negatively regulates the G1 to S phase transition
(Dyson, 1998; Sherr, 1998). p16
INK4a
blocks the activity
of cyclinD/cdk4 kinase by binding to the catalytic cdk
subunit, thus preventing pRb phosphorylation and
retaining pRb in a hypo-phosphorylated and growth-
suppressing state (Serrano et al., 1993; Sherr, 1998).
The principal target through which pRb regulates
growth is believed to be the E2F transcription factor,
which plays an important role in controlling the
transcriptional activity of genes required for cells to
progress into S phase (Dyson, 1998).
On the other hand, ARF expression appears to act
as a sensor for oncogenic signals and cause growth
arrest by modu lating the activity of the p53 tumour
suppressor protein through interfering with the regula-
tion of p53 by MDM2 (Palmero et al., 1998;
Pomerantz et al., 1998; Zhang et al., 1998). MDM2
binds to p53 through a motif located in the p53
transcriptional activation domain, thereby preventing
the activation of p53 target genes (Ko and Prives,
1996). The control of p53 activity requires the E3
ubiquitin ligase of MDM2, which stimulates the
ubiquitin-dependent degradation of p53, together with
the relocalization of p53 to the cytosol (Haupt et al.,
1997; Honda et al., 1997; Kubbutat et al., 1997; Roth
et al., 1998; Tao and Levine, 1999). Throu gh the
physical interaction with MDM2, ARF is believed to
act to prevent the down-regulation of p53 (Honda and
Yasuda, 1999).
Transcription of the ARF gene can be induced
through a variety of oncogenic stimu li, including viral
oncoproteins such as adenovirus E1A, and cellular
oncogenes, like c-Myc, Ras and E2F-1 (Bates et al.,
1998; De Stanchina et al., 1998; Dimri et al., 2000;
Schmitt et al., 1999; Zhang and Xiong, 1999), a lthough
oncogenic Ras does not induce arf expression in
human cells (Wei et al., 2001). Under these conditions,
p14
ARF
binds to and blocks MDM2 activity, thereby
inducing p53 levels and thereafter the p53 response
resulting in cell cycle arrest or apoptosis ( Sherr, 1998).
A part of this mechanism may involve ARF causing
MDM2 to relocalise to nucleoli (Serrano et al., 1993;
Zhang and Xiong, 1999; Lohrum et al., 2000; Llanos et
al., 2001).
A trans criptional regulator of ARF expression
appears to be E2F-1 (Bates et al., 1998). The human
ARF promoter, located in exon 1b of the ink4a/arf
locus, contains several potential E2F binding sites, and
it has been shown that E2F-1 can increase ARF
promoter activity (Bates et al., 1998). The induction of
ARF expression by E2F-1 may help explain the
observed co-operation between E2F-1 and p53 in the
Oncogene (2002) 21, 4220 ± 4230
ã
2002 Nature Publishing Group All rights reserved 0950 ± 9232/02 $25.00
www.nature.com/onc
*Correspondence: NB La Thangue;
E-mail: N.LaThangue@bio.gla.ac.uk
Received 13 February 2002; revised 20 March 2002; accepted 26
March 2002

induction of apoptosis (Bates et al., 1998; Dyson,
1998).
A number of studies have suggested that MDM2,
ARF, and p53 are not necessarily connected only
through a single linear pathway. For example, MDM2
activity is integrated with the pRb/E2F pathway
(Martin et al., 1995; Xiao et al., 1995; Loughran and
La Thangue, 2000); MDM2 can regulate E2F activity
in p53
7/7
cells (Loughran and La Thangue, 2000) and
form a protein complex with pRb (Xiao et al., 1995).
These observations are consistent with results from Em-
Myc transgenic mice which develop tumours that
harbour mutations in the murine p19
ARF
and p53 loci,
but overexpress MDM2 (Eischen et al., 1999). More-
over, ARF-dependent growth arrest has been shown to
be dependent not only upon the activity of p53, but
also the control of the pRb pathway (Carnero et al.,
2000). Furthermore, the reintroduction of p19
ARF
into
triple knockout (in arf, p53 and mdm2) MEFs arrests
cell cycle progression in G1, an eect that is not
alleviated by the subsequent inhibition of pRb by the
HPV E7 oncoprotein (Weber et al., 2000a).
Given the increasing evidence for a role for the pRb
pathway in the growth regulating eects of ARF,
together with the suggestion that a target for ARF lies
downstream of pRb, we reasoned that E2F may be a
candidate target for regulation by ARF. This idea led
us to explore the role of p14
ARF
in E2F control, and
here we report that indeed p14
ARF
can regulate E2F
activity. We ®nd that p14
ARF
down-regulates E2F-1
activity, and further that this eect correlates with the
inhibition of E2F-dependent apoptosis. p14
ARF
forms a
physical complex with E2F-1, and multiple binding
domains reside in p14
ARF
for E2F-1. A domain in the
N-terminal region of p14
ARF
, that can be distinguished
from a previous ly identi®ed MDM2 binding domain, is
capable of autonomously down-regulating E2F activ-
ity. Thes e results de®ne E2F-1 as a target in p14
ARF
-
dependent growth control. In addition, they imply a
model in which the E2F-1-regulation of arf transcrip-
tion is subject to negative auto-regulation by ARF
protein.
Results
p14
ARF
regulates E2F-dependent apoptosis
Previous studies suggested that human MDM2
(hDM2) can modulate the apoptotic activity of E2F
(Loughran and La Thangue, 2000). In SAOS2 tumour
cells, which are p53
7/7
/Rb
7/7
, the introduction of
E2F-1 and DP-1, two subunits of the E2F hetero-
dimer (Bandara et al., 1993; Dyson, 1998), into
growth-arrested cells resulted in signi®cant levels of
apoptosis, which could be overcome upon the co-
expression of hDM2 (Figure 1a). As we previously
reported, the ability of hDM2 to down-regulate E2F-
dependent apoptosis correlates with an hDM2-depen-
dent growth stimulation (Loughran and La Thangue,
2000).
We performed a similar experiment to study the
eect of p14
ARF
upon E2F-dependent apoptosis and
found, to our surprise, that exogenous ARF could
reduce the level of cells undergoing apoptosis (Figure
lb). Whilst of considerable interest, nevertheless this
result was not anticipated, as we would have expected
that p14
ARF
, through its interaction with endogeno us
hDM2 (Sherr, 1998), would overcome the down-
regulation of E2F to augment E2F activity. Indeed, it
is consistent with this prediction that in conditions of
hDM2 down-regulation of E2F-dependent apoptosis,
that co-expressing p14
ARF
overcame the anti-apoptotic
activity of hDM2 (Figure 1c). These results suggest
that p14
ARF
may possess activities involved in regulat-
ing hDM2 and the control of E2F activity.
Whilst previous studies have shown that hDM2 and
E2F can co-operate in cell cycle progression (Lough-
ran and La Thangue, 2000), it was important to assess
the consequence of the p14
ARF
down-regulation of
E2F activity on the cell cycle. Thus, we studied the
kinetics of cell cycle progression by ¯ow cytometry. In
SAOS2 cells the introduction of wild-type p53 caused
an increase in the size of the sub-G1 DNA content
apoptosing popul ation of cells, and the co-expression
of E2F-1 and DP-1 likewise resulted in an induction
of sub-G1 cells (Figure 1d). Most importantly, the co-
expression of p1 4
ARF
with E2F-1 and DP-1 abrogated
the sub-G1 population of cells, favouring the
accumulation of cells in G1 (Figure 1d). That this
eect was dependent upon p14
ARF
activity was
supported by the action of hDM2, which overcam e
p14
ARF
activity resulting in an induction of sub-G1
cells (Figure 1d). The combined conclusion from these
results argues that p14
ARF
can regulate E2F-dependent
apoptosis.
p14
ARF
can down-regulate E2F-dependent transcription
The results suggest that p14
ARF
can regulate the
apoptotic activity of E2F-1. Because E2F-dependent
apoptosis in part requires E2F transcriptional activity
(Irwin et al., 2000; Lissy et al., 2000), the results in turn
raised the possibility that p14
ARF
may in¯uence the
ability of E2F to activate target genes. We tested this
idea by studying the eect of p14
ARF
on dierent E2F-
responsive promoters, including the p14
ARF
promoter
located in exon1b of arf (Bates et al., 1998), cyclinE
(Botz et al., 1996), apaf1 (Moroni et al., 2001) and
36WT, an arti®cial promoter containing three tandem
E2F sites (Zamanian and La Thangue, 1992); repre-
sentative examples of the results are presented.
In SAOS2 cells the exon1b promoter was induced by
E2F-1 and DP-1, and the co-introduction of p14
ARF
caused a striking reduction in transcriptional activity
(Figure 2a). This activity was abolished by the presence
of hDM2, which overcame the p14-dependent reduc-
tion (Figure 2b). An eect was observed on the other
E2F responsive promoters, including cyclinE, Apaf1
and 36WT (Figure 2c, d, and data not shown), and
there was little change in E2F or p14
ARF
protein levels
in co-transfected cells (Figure 2e). Thus, the observed
Oncogene
p14
ARF
regulates E2F activity
SL Mason et al
4221

eect was a p14
ARF
on E2F-dependent apoptosis and
cell cycle progression (Figure 1), and are consistent
with the idea that p14
ARF
can regu late E2F activity,
and that this regulation is responsible for mediating the
eects on E2F-dependent apoptosis. The eect of
p14
ARF
was reproducibly less striking on the cyclinE
promoter compared to the exon 1b and Apaf1
promoters, the reasons for which remain to be
elucidated.
p14
ARF
regulates E2F activity in p53
7/7
/mdm2
7/7
MEFs
Whilst the results derived from SAOS2 cells suggest
that p14
ARF
regulates E2F activity, because SAOS2 are
tumour cells that express hDM2 and may harbour
unknown genetic lesions that aect ARF activity, it
was not possible to rule out that the observed eects of
p14
ARF
on E2F were mediated through hDM2 or other
genetic abnormalities. To exclude this possibility, we
studied the eect of p14
ARF
on BrdU incorporation
and E2F-dependent transcription in early passage
p53
7/7
/mdm2
7/7
MEFs. Exogenous p14
ARF
reduced
the level of BrdU incorporation (Figure 3a), a result
that concurs with other recent studies on the eect of
murine p19
ARF
in p53
7/7
/mdm2
7/7
MEFs (Weber et
al., 2000a). In addition, the p14
ARF
reduction in BrdU
incorporation was apparent when E2F-1 and DP-1
were introduced into the cells and E2F-1/DP-1 co uld
overcome the eect of ARF on BrdU incorporation
(Figure 3a). Similarly, in p53
7/7
/mdm
7/7
MEFs
p14
ARF
could down-regulate the transcriptional activity
of E2F-1 on the 36WT and exon 1b promoter (Figure
3b). The overall conclusion from the studies performed
in SAOS2 cells and p53
7/7
/mdm2
7/7
MEFs implies
that p14
ARF
can reduce E2F activity, and that it does
Figure 1 p14
ARF
regulates E2F activity. (a±c) SAOS2 cells were transfected as described with expression vectors for E2F-1, DP-1,
hDM2 and p14 (6 mg of each) as indicated. After transfection, cells were washed and further grown in 0.2% foetal calf serum in
DMEM when apoptosis was assayed 18 h post-transfection. The data was expressed as the percentage TUNEL positive cells relative
to the total number of transfected cells (determined by immunostaining with a relevant antibody against one of the exogenous
proteins). The data shown is representative of at least three independent experiments. (d) SAOS2 cells were transfected with vectors
for E2F-1, DP-1, hDM2, p14 and p53 (10 mg of each) as indicated together with an expression vector for CD20 (4 mg). Cells were
washed 6 h post-transfection and ¯ow cytometry performed 18 h post-transfection. The data is represented as the percentage change
in cell cycle population relative to mock transfected cells. The data shown is representative of at least three independent experiments
p14
ARF
regulates E2F activity
SL Mason et al
4222
Oncogene

Figure 2 p14
ARF
regulates E2F target genes. (a) SAOS2 cells were transfected with expression vectors for E2F-1 (50 ng), DP-1
(500 ng), and p14 (250 ng, 500 ng, 750 ng, 1 mg) together with the exon 1b-luc reporter (500 ng). Cells were harvested 40 h post-
transfection with each treatment performed in duplicate. CMV-bgal (500 ng) was included as an internal control. The data shown
represents the ratio of luciferase to b galactosidase, and is representative of at least three independent experiments. (b) SAOS2 cells
were transfected with expression vectors for E2F-1 (50 ng), DP-1 (500 ng), p14 (1 mg) and hDM2 (1 mg) together with the exon 1b-
luc reporter (500 ng) as indicated, and treated as described in a.(c) SAOS2 cells were transfected with expression vectors for E2F-1
(50 ng), DP-1 (500 ng) and p14 (2 and 4 mg) as indicated, together with the cyclinE-luc reporter (500 ng), and treated as described in
a.(d) SAOS2 cells were transfected with expression vectors for E2F-1 (50 ng), DP-1 (500 ng), and p14 (2 and 4 mg) as indicated,
together with the Apa¯(7396/+208)-luc reporter (500 ng), and treated as described in a.(e) SAOS2 cells were transfected with
expression vectors for E2F-1 (50 ng) and p14 (2 mg) as indicated, and at 40 h post-transfection harvested. Immunoblotting for
E2F-1 and p14 was performed as described
Oncogene
p14
ARF
regulates E2F activity
SL Mason et al
4223

so in a fashion that is mechanistically and functionally
independent of p53 and MDM2.
p14
ARF
can physically interact with E2F-1
The most likely mechanism to explain the eect of
p14
ARF
on E2F activity was that an interaction
between ARF and E2F was in part responsible. We
tested this idea by investigating if GST-p14
ARF
could
bind to E2F-1 in SAOS2 cell and p 53
7/7
/mdm2
7/7
MEF extracts. Relative to the control GST treatment,
we found that GST-p14
ARF
bound to E2F-1 in both
cell extracts (Figure 4a).
Next, we demonstrated an association between
p14
ARF
and E2F under physiological conditions by
performing immunoprecipitation from HeLa cells with
anti-p14 or anti-E2F-1 followed by immunoblotting
with anti-hDM2, anti-E2F-1 or anti-p14. In p14
ARF
immunoprecipitates hDM2, E2F-1 and p14
ARF
were
present, and similarly in the reciprocal immunopreci-
pitation with anti-E2F-1 (Figure 4b). Thus, p14
ARF
and
E2F-1 can associate under physiological conditions.
The observed co-immunoprecipitation was not due to
the presence of hDM2, as E2F-1 was unde tectable in
anti-hDM2 immunoprecipitates (Figure 4b).
Figure 3 p14
ARF
regulates E2F in p53
7/7
/mdm2
7/7
MEFs. (a)
p53
7/7
/mdm2
7/7
MEFs were transfected with expression vectors
for E2F-1, DP-1 and p14 (5 mg of each) as indicated. After
transfection, cells were washed and grown, when BrdU
incorporation was assayed at 18 h post-transfection. The data
were expressed as the percentage BrdU positive cells relative to
the total number of transfected cells (determined by monitoring b
galactosidase activity derived from pCMV-bgal). The data shown
are representative of three independent experiments. (b) p53
7/7
/
mdm2
7/7
MEFs were transfected with expression vectors for
E2F-1 (500 ng) and p14 (500 ng) together with p36WT-luc
(1 mg), p36MT-luc (1 mg) or the exon1b-luc (4 mg) reporter as
indicated. Cells were harvested at 40 h post-transfection with each
treatment performed in duplicate. CMV-bgal (500 ng) was
included as an internal control. The data shown represents the
ratio of luciferase to b galactosidase, and is representative of at
least three independent experiments
Figure 4 p14
ARF
binds to E2F-1. (a) Extracts were prepared
from SAOS2 cells and p53
7/7
/mdm2
7/7
MEFs and 200 mg of cell
extract incubated with GST-p14 (1 mg) or GST (1 mg) protein.
Binding reactions were performed as described and analysed by
immunoblotting with anti-E2F-1. Tracks 1 and 4 show 10% input
(IN) extract. (b) HeLa cell nuclear extract (500 mg) was
immunoprecipitated (IP) with the control anti-HA (track 1),
anti-MDM2 (track 2), anti-p14
ARF
(track 3) or anti-E2F-1 (track
4) and immunocomplexes subsequently immunoblotted (IB) with
the indicated antibodies; hDM2, E2F-1 and p14
ARF
are indicated
p14
ARF
regulates E2F activity
SL Mason et al
4224
Oncogene

A domain in E2F-1 interacts with p14
ARF
To delineate the regions in E2F-1 that are responsible
for binding to p14
ARF
, we used a panel of E2F-1
mutants and measured the binding of in vitro
translated E2F-1 to GST-p14
ARF
(Figure 5a). Wild-
type E2F-1 could bind to GST-p14
ARF
, and analysing
the binding properties of the series of E2F-1 mutants
Figure 5 p14
ARF
binds to E2F-1. (a) Diagram summarising the E2F-1 derivatives; CYA shows the position of the cyclinA binding
domain, and act/pp the trans activation and pocket protein binding domain (Helin et al., 1993). (b) The indicated E2F-1 derivatives
were in vitro translated and incubated with GST-p14 (1 mg) or GST (1 mg) protein. Reactions were washed and subjected to SDS ±
PAGE gel analysis as described. (c) The indicated E2F-1 derivatives were treated as described in b. Note that the results in (b) and
(c) were derived from experiments performed in parallel, and re¯ect equivalent exposure times. (d) Puri®ed His-E2F-1 (0.5 mg) was
incubated with puri®ed GST, GST-DP-1 or GST-p14 (0.5 mg) and thereafter binding between the indicated proteins assessed by
immunoblotting with either anti-p14
ARF
(tracks 1, 2 and 4) or anti-DP-1 (track 3)
Oncogene
p14
ARF
regulates E2F activity
SL Mason et al
4225

mapped an interaction domain to the central region of
E2F-1, encompassing a part of the DNA binding
domain, from residue 181 to 261 (Figure 5a). However,
E2F-1
181 ± 261
reproducibly exhibited reduced binding to
GST-p14
ARF
compared to wild-type E2F-1 (reduced by
about 75%), suggesting that this region approached the
minimal ARF binding domain.
Furthermore, although the results derived from the
in vitro binding assays are consistent with a direct
interaction between E2F-1 and p14
ARF
, we could not
rule out an indirect association mediated through
another unidenti®ed protein. To test this possibility,
we assessed the binding of puri®ed GST-DP-1 or GST-
p14
ARF
to His-E2F-1. As expected, there was a direct
and speci®c interaction between E2F-1 and DP-1 and,
in addition, speci®c binding was reproducibly observed
between E2F-1 and p14
ARF
(Figure 5d). These results
therefore support the idea that p14
ARF
and E2F-1 can
directly interact.
Binding domains in p14
ARF
for E2F-1
To elucidate the regions in p14
ARF
that are involved in
binding to and the control of E2F, we undertook both
a functional and biochemical study. In the initial
analysis, we utilized two derivatives of p14
ARF
,
representing the N- and C-terminal halves of the
protein (Figure 6a) and assessed their activity upon
the E2F-1-dependent activation of the exon1b promo-
ter. Whereas the C-terminal half had negligible eect, a
clear reductio n in E2F-1 activity was seen upon
expression of the N-terminal half (Figure 6b). These
results imply that the N-terminal half of p14
ARF
is
functionally important in regulating E2F-dependent
transcription.
In order to resol ve further the interaction domains,
we studied the properties of a panel of p14
ARF
derivatives (Figure 6a) which were co-expressed
together with E2F-1 in SAOS2 cells and thereafter
immunoprecipitated. An interaction was evident be-
tween wild-type p14
ARF
and E2F-1, and both the N-
and C-region domains bound to E2F-1 (Figure 6c).
Since the functionally relevant interaction domain in
E2F control was located in the N-terminal half (Figure
6b), we further analysed this region and mapped the
minimal N-terminal binding region to within 34
residues, since a p14 derivative encompassing residues
1 to 34, but not one containing residue 1 to 22, was
capable of binding to E2F-1 (Figure 6c).
The N-terminal E2F binding domain in p14
ARF
regulates
E2F activity
Since the C-terminal half of p14
ARF
fails to regulate
E2F activity, we focussed on the minimal binding
domain mapped to the N-terminal region, and asked if
this domain was sucient to regulate E2F-1 activity. In
a similar fashion to the eect of wild-type p14
ARF
,we
found that residues 1 to 34 could down-regulate E2F
activity. Furthermore, as an ticipated from the lack of
binding between residue 1 to 22 there was no apparent
down-regulation when this mutant was co-expr essed
with E2F-1 (Figure 7d). In fact, p14
1±22
was frequently
observed to stimulate E2F activity, perhaps because of
a dominant-negative acti on on endogenous ARF
activity.
Overall, the analysis of the ARF mutant derivatives
mapped a functionally important p14
ARF
/E2F-1 inter-
action domain to the N-terminal 34 residues of ARF.
Since there was a correl ation between this ARF/E2F-1
binding domain and reduced E2F activity, the results
suggest that a physical interaction is required for the
p14
ARF
-dependent down-regulation of the E2F activity.
Discussion
p14
ARF
regulates E2F
ARF is a protein of central importance in cell cycle
control. ARF expression is induced by the action of
diverse oncogenic signals, culminating in cell cycle
arrest, apoptosis or senescence (Chin et al., 1998;
Sherr, 1998). An established mechanism through which
ARF hinders proliferation is through the physical
interaction with MDM2 to prevent the destabilization
of p53, and thereby facilitate the p53 response
(Pomerantz et al., 1998; Zhang et al., 1998). The
interaction between ARF and MDM2 may involve the
sequestration of MDM2 to a nucleolar locat ion,
although the importance of this process of relocaliza-
tion for ARF function remains unclear (Weber et al.,
1999; Zhang and Xiong, 1999; Lohrum et al., 2000;
Llanos et al., 2001; Lomax and Fried, 2001; Korgaon-
kar et al., 2002).
MDM2 is clearly an important target in mediating
the eects of ARF, although mechanisms other than
the direct regulation of MDM2 have been suggested
based upon a variety of studies (Carnero et al., 2000;
Weber et al., 2000b). Perhaps most compelling are
those studies which document ARF activity in the
absence of an intact MDM2/p53 pathway. Thus,
murine p19
ARF
can induce senescence in p53
7/7
MEFs
(Carnero et al., 2000), an d in triple knock-out p53
7/7
/
mdm
7/7
/arf
7/7
MEFs causes growth inhibition (We-
ber et al., 2000b).
Previous studies have established a connection
between MDM2 activity and G1 to S phase control
by the pRb/E2F pathway. For example, by forming a
complex with pRb, MDM2 can hinder pRb-dependent
growth inhibition (Xiao et al., 1995). Further, MDM2
can interact with E2F and down-regulate apoptosis in
favour of cell cycle pro gression (Loughran and La
Thangue, 2000). Indeed, these earlier studies led us to
investigate the role of ARF in the control of E2F
activity.
The results presented in this study strongly suggest
that human p14
ARF
can eect E2F activity in a fashion
that results in E2F down-regulation. That this eect of
p14
ARF
was observed in p53
7/7
/mdm2
7/7
cells argues
that an intact p53/MDM2 pathway is not essential for
the process. M oreover, in the conditions of our
p14
ARF
regulates E2F activity
SL Mason et al
4226
Oncogene

investigation exogenous p14
ARF
led to ecient cell
cycle arrest, whilst interfering with the level of E2F-
dependent apoptosis, a result which at a general level
agrees with recent reports (Russell et al., 2002). These
results highlight a signi®cant dierence between the
regulation by ARF of the p53 and E2F pathways.
Speci®cally, by blocking the interaction between
MDM2 and p53, ARF facilitates diverse outcomes,
Figure 6 An N-terminal binding domain in p14
ARF
in¯uences E2F activity. (a) Diagram summarising the p14 derivatives, and their
E2F binding and functional properties. (b) SAOS2 cells were transfected with expression vectors for E2F-1 (50 ng) and DP-1
(500 ng) together with either p14
1±64
or p14
65 ± 132
(1 mg) and the exon 1b-luc reporter (500 ng). Cells were harvested 40 h post-
transfection and each treatment performed in duplicate. CMV-bgal (500 ng) was included as an internal control. The data shown
represent the ratio of luciferase to b galactosidase, and are representative of three independent experiments. (c) SAOS2 cells were
transfected with expression vectors for E2F-1 (10 mg) alone or together with the indicated p14 derivatives (10 mg). Extracts were
prepared and immunoprecipitated with anti-E2F-1 antibody and immunoblotted with anti-myc (for p14, indicated by *) or anti-HA
(for E2F-1, indicated by *). Each pair of tracks shows the input (IN) and immunoprecipitate (IP). Note that tracks 1 to 10, and
tracks 11 and 12, were derived from separate SDS gels. (d) SAOS2 cells were transfected with expression vectors for E2F-1 (50 ng)
and DP-1 (500 ng) alone or together with the indicated p14 derivatives (1 mg) and the exon 1b-luc reporter (1 mg). Cells were
harvested and treated as described in a
Oncogene
p14
ARF
regulates E2F activity
SL Mason et al
4227

including apoptosis and cell cycle arrest (Quelle et al.,
1995; Chin et al., 1998; Sherr, 1998; Dimri et al., 2000).
In contrast, p14
ARF
regulation of E2F appears to
favour cell cycle arrest at the expense of apoptosis.
p14
ARF
binds to E2F
Whilst the mechanism through which p14
ARF
regulates
E2F activity remains to be determined, the results
presented here suggest that p14
ARF
can associate with
E2F under physiological conditions, a conclusion based
upon results derived from a variety of in vitro and cell-
based studies. Furthermore, an interaction domain was
mapped to the central region of the E2F-1, in the
region of the DNA binding domain. In this respect,
whilst ARF-dependent regulation of MDM2 has been
connected with an ARF-dependent relocalization of
MDM2 to a nucleolar location (Weber et al., 1999;
Zhang and Xiong, 1999; Lohrum et al., 2000; Llanos et
al., 2001), we have failed to de tect signi®cant
relocalization of E2F-1 under the cond itions of
p14
ARF
expression in our experimental conditions (data
not shown).
Our results are in general agreement with recently
published studies documenting a physical interaction
between ARF and certain E2F family members,
resulting in E2F destabilization and regulation (Eymin
et al., 2001; Martelli et al., 2001). However, these
studies were performed in cell-types in which the
MDM2 gene remained intact, suggesting a role for
MDM2 in the observed eects. The results presented
here strengthen the evidence for the interplay between
ARF and E2F, but also formally rule out a role for
MDM2 and p53 in this process, as p14
ARF
was seen to
regulate E2F activity when both mdm2 and p53 were
genetically inactivated, most prob ably through the
direct interaction between p14
ARF
and E2F-1.
Another noteworthy observation is the location in
the N-terminal 34 residues of p14
ARF
required for the
interaction with E2F-1. A nucleolar localization signal
and MDM2 binding domain exists in the N-terminal
22 residues of p14
ARF
(Weber et al., 1999; Lohrum et
al., 2000), although this region was not sucient to
bind to and regulate E2F-1 (Figure 6). Nevertheless,
the close proximity of the E2F-1 and MDM2 binding
domains in the N-terminal region of p14
ARE
does not
exclude the possibility that under certain conditions
E2F-1 and MDM2 may compete for ARF.
Auto-regulation of arf expression
Our results suggest a model in which arf transcription
is subject to auto-regulation through the ARF protein.
Speci®cally, the E2F-dependent activation of the exon
1b promoter will be in¯uenced by ARF protein as its
levels increase through transcription of arf.We
envisage as the levels of ARF increase, that ARF
functionally interacts with MDM2. It is possible that
subsequent increases in ARF, target and functi onally
inactivate E2F, and thereafter lower arf transcription
(Figure 7). This model provides an autoregulatory
mechanism in which arf expression is subject to
negative control by ARF once the levels of MDM2
have been titrated and inactivated.
At a general level, our results oer an explanat ion
for the eec ts of ARF in cells lacking functional p53
and MDM2 (Carnero et al., 2000; Weber et al ., 2000b),
which we would argue are likely to be mediated
through the regulation of E2F activity. Moreover, the
identi®cation of E2F as a target of ARF control
de®nes ARF with a speci®c and perhaps more direct
role in the control of the G1 to S phase transition.
Materials and methods
Plasmids and expression vectors
The following plasmids have been previously described; HA-
E2F1 (Helin et al., 1992), E2F1Y411C (Helin et al., 1993),
CMV-DP1 (Bandara et al., 1993), CMVp14
ARF
(Bates et al.,
1998), pchDM2 (Loughran and La Thangue, 2000),
pCMVbgal (Zamanian and La Thangue, 1992), pcDNA3-
mycp 14, pcDNA3mycN62, pcDNA3mycC65 (44), TxARF
1 ± 132, 1 ± 22, 1 ± 34, 1 ± 64, and 65 ± 132 (Lohrum et al.,
2000). pGEXp14
ARF
was prepared by digesting CMVp14
ARF
and cloning the fragment into the BamH1/EcoRI site in
pGEX
KG
(Pharmacia). HA-E2F-1
181 ± 280
and HA-E2F-1
141 ±
280
were prepared by PCR ampli®cation using the following
pairs of primers: Forward - 141 - GGGGATCC-
GAGCTGCTGAGCCACTCGGCT and reverse GGTCTA-
GAC TCCGAAGAGTCCACGGCTTG, and forward - 181 -
GGGGATCC# GCCAAGAA GTCCAAGAACCAC and
reverse GGTCTAGACTCCGAAGAGTCCACGGCTTG
the ampli®ed fragments being subsequently cloned into
pcDNA3.
Transient transfection and reporter assays
Transfection was carried out in SAOS2 cells or early passage
p53
7/7
/mdm2
7/7
mouse embryo ®broblasts (MEFs) grown
in DMEM by the calcium phosphate procedure (as
Figure 7 Regulation of E2F activity by ARF. It is envisaged
that the E2F-dependent transcriptional activation of arf gives rise
to levels of ARF protein that target and inactivate MDM2 (a).
Increasing levels of ARF titrate our MDM2 and, through the
interaction with E2F, down-regulate arf expression (b). This
model provides an autoregulatory mechanism for the control of
ARF protein levels
p14
ARF
regulates E2F activity
SL Mason et al
4228
Oncogene

previously described; Loughran and La Thangue, 2000;
Morris et al., 2000); 500 ng CMV-bgal was included as an
internal control per 6 cm plate. The quantity of DNA per
transfection was kept constant by the addition of pcDNA3 or
pSG5 empty vector; assays were performed at least in
duplicate. The following reporters were used; Exon 1b-luc
(Bates et al., 1998), Apa¯(7396/+208)-luc (Moroni et al.,
2001), cyclinE-luc (Botz et al., 1996), 36WT and 36MT
(Zamanian and La Thangue, 1992).
Recombinant proteins
The following GST and His-tagged proteins were expressed
in BL21 and puri®ed as previously described; GST-DP1,
GST-p14
ARF
and His-E2F1 (Bandara et al., 1993; Girling et
al., 1993).
Cell extracts and biochemical assays
Nuclear extracts were prepared from SAOS2 cells and early
passage p53
7/7
/mdm2
7/7
MEFs by scraping monolayers
and swelling in buer (20 m
M HEPES, 20% glycerol,
250 mM NaCl
2
, 1.5 mM MgCl
2
,1mM EDTA, 0.1% Triton
X) for 30 min, and centrifugation at 2000 r.p.m. for 10 min
before lysis in 50 m
M Tris pH 8.0, 150 mM NaCl
2
,5mM
EDTA, 0.5% NP40 on ice. Supernatants were collected by
centrifugation and thereafter used for biochemical binding
assays where nuclear extract (about 200 mg) was incubated
with the GST protein (about 1 mg) at 48C. Binding reactions
were carried out in TNE (50 m
M Tris pH 8.0, 150 mM NaCl
2
,
5m
M EDTA, 0.5% NP40 containing 1 mM DTT, 1 mM
PMSF and protease inhibitors). Glutathione beads were
washed three times and resuspended in SDS buer for gel
electrophoresis. For in vitro translated proteins derived from
the T7 TNT coupled system (Promega), an equal amount of
translated protein was added to GST protein (about 1 mg) in
200 ml buer. Reactions were incubated at 48C and then
washed three times before being resuspended in SDS buer
for gel electrophoresis. For the in vitro binding assay using
GST proteins, about 1 mg of puri®ed protein (as indicated)
was incubated in 50 m
M Tris, 150 mM NaCl
2
,5mM EDTA,
0.5 m
M NP40 with His-E2F1 for 1 h at 48C.
TUNEL and BrdU incorporation
For TUNEL assays SAOS2 cells (3610
5
) were plated onto
coverslips and transfected with each of the indicated plasmid
(about 6 mg) as described previously (Loughran and La
Thangue, 2000). Following transfection, the cells were
washed twice in PBS and serum starved (0.2% serum)
overnight. Cells were ®xed for 15 min in 4% paraformalde-
hyde and permeabalized for 10 min in 0.1% Triton, 0.1%
sodium citrate in PBS. TUNEL was performed as described
by the manufacturer (Roche). Cells were counted a
minimum of three times under low and high power
¯uorescence microscopy, and normalized for transfection
eciency. Transfection eciency was determined by im-
munostaining cells with a relevant antibody against an
exogenous protein.
For the BrdU assay p53
7/7
/mdm2
7/7
MEFs (1610
5
)
were plated on coverslips and transfected with each plasmid
(about 5 mg). Following transfection cells were washed twice
in PBS and left overnight in DMEM containing 10% FCS.
BrdU labelling was carried out for 15 min at 378C and cells
were then ®xed in ethanol: glycine buer (pH 2.0) for a
minimum of 30 min at 7208C, and stained according to the
BrdU Labelling Kit 1 (Roche). BrdU was detected by
staining with anti-BrdU. Cells were mounted and examined
as described for the TUNEL assay. Transfection eciency
was determined by including pCMV-bgal (about 6 mg) in the
transfection and monitoring b galactosidase activity.
Flow cytometry
SAOS2 cells were transfected with the indicated plasmids
(about 10 mg) and the CD20 expression vector (about 4 mg)
and harvested 24 h post-transfection. Cells were suspended in
200 ml DMEM, and incubated with the anti-CD20 antibody
for 45 min. Cells were washed twice in PBS, ®xed in 50%
ethanol/PBS and stored overnight at 48C. Samples were
washed twice in PBS before the addition of 100 mg/ml of
RNase and 50 mg/ml of propidium iodide. Cell cycle analysis
was performed on a Becton Dickinson cell sorter using the
CellQuest software (BD) as described previously (Morris et
al., 2000). Relative percentage change in cell cycle progression
was calculated with respect to the mock (empty vector)
control.
Immunoprecipitation and immunoblotting
For the immunoprecipitation of endogenous protein com-
plexes HeLa cell nuclear extracts (500 mg) were incubated
with anti-E2F-1 (KH95, Santa Cruz), anti-p14 (C18, Santa
Cruz), anti-MDM2 (H221, Santa Cruz), or anti-HA (HA11,
BabCo) antibody in a total volume of 100 ml TNE overnight
at 48C with rotation. Protein A agarose was then added to
the samples, and further incubated for 3 h at 48C with
rotation. Immunoprecipitates were washed in TNE binding
buer and re-suspended in SDS loading buer, and
subsequently analysed by SDS ± PAGE and immunoblotting
with the appropriate antibody.
Acknowledgments
We thank Karen Vousden, Y Xiong, David Lane, Stephen
France and Laurent Delavaine for providing reagents,
Marie Caldwell for assistance in preparing the manuscript,
and the Medical Research Council, the Leukaemia Re-
search Fund and the Cancer Research Campaign for
supporting this research.
References
Bates S, Phillips AC, Clarke PA, Stott F, Peters G, Ludwig
RL an d Vousden KH. (19 98). Nature, 395, 124 ± 125.
Bandara LR, Buck VM, Zamanian M, Johnston LH and La
Thangue N B. (1993). EMBO J., 12, 4317 ± 4324.
BotzJ,Zerfass-ThomeR,DeliusH,VogtB,EilersM,
Hatzigeorgiou A and Jansen-Du
È
rr P. (1996). Mol. Cell.
Biol., 16, 3401 ± 3409.
Carnero A, Hudson JD , Price CM and Be ach DH. (2000).
Nat. Cell Biol., 2, 148 ± 155.
Chin L, Pomerantzv J and DePinho RA. (1998). Trends
Biochem. Sci., 23, 291 ± 296.
De Stanchina E, McCurrach ME, Zindy F, Shieh SY,
Ferbeyre G, Samuelson AV, Proves C, Roussel MF, Sherr
CJ and Lowe SW. (19 98). Genes Dev., 12, 2434 ± 2442.
Oncogene
p14
ARF
regulates E2F activity
SL Mason et al
4229

Dimri GP, Itahana K, Acosta M and Campisi J. (2000). Mol.
Cell. Biol., 20, 273 ± 285.
Dyson N. (199 8). Genes Dev., 12, 2245 ± 2262.
Eischen CM, Weber JD, Roussel MF, Sherr CJ and
Cleveland JL. (1999). Genes Dev., 13, 2658 ± 2669.
Eymin B, Karayan L, Se
Â
ite
Â
P, Brambilla C, Brambilla E,
LarsenC-JandGazze
Â
ri S. (2001). Oncogene, 20, 1033 ±
1041.
GirlingR,PartridgeJF,BandaraLR,BurdenN,TottyNF,
Hsuan J J and La Thangue NB. (1993). Nature, 362, 83 ±
87.
Haupt Y, Maya R, Kazaz A and Oren M. (1997). Nature,
387, 29 6 ± 299.
Helin K, Lees J, Vidal M, Dyson N, Harlow E and Fattaey
AR. (1992). Cell, 70, 337 ± 350.
Helin K, Harlow E and Fattaey AR. (1993). Mol. Cell. Biol.,
13, 650 1 ± 6508.
Honda R, Tanaka H and Y asuda H. (1997). FEBS Lett., 4 20,
25 ± 27.
Honda R and Yasuda H. (1999). EMBO J., 18, 22 ± 27.
Irwin M, Marin MC, Philips AC, Seelan RS, Smith DI, Liu
W, Flores ER, Tsai KY, Ja cks T, Vousden KH and Kaelin
Jr WG. (2000). Nature, 407, 645 ± 6 48.
Ko LJ and Prives C. (1996). Genes Dev., 10, 1054 ± 1072.
Korgaonkar C, Zhao L, Modeatou M and Quelle DE.
(2002). Mol. Cell. Biol., 22, 196 ± 206.
Kubbutat MH, Jones SN and Vousden KH. (1997). Nature,
387, 29 9 ± 303.
Lissy NA, Davis PK, Irwin M, Kaelin WG and Dowdy SF.
(2000). Nature, 407, 642 ± 644.
Llanos S, Clark PA, Rowe J and Peters G. (2001). Nat. Cell
Biol., 3, 445 ± 452.
Lohrum MA , Ashcro ft M, Kubbutat MH and Vousden KH.
(2000). Curr. Biol., 10, 539 ± 542.
Lomax M and Fried M. (2001). Oncogene, 20, 4951 ± 4960.
Loughran O
È
and La Thangue NB. (2000). Mol. Cell. Biol.,
20, 218 6 ± 2197.
Martelli F, Hamilton T, Silver DP, Sharpless NE, Bardeesy
N, Rokas M, DePinho RA, Livingston DM and Gross-
man SR. (2001). Proc. Natl. Acad . Sci. USA, 98, 44 55 ±
4460.
Martin KD, Trouche C, Hagemeier TS, Sùrensen NB, La
Thangue and Kouzarides T. (1995). Nature, 37 3, 691 ±
694.
MoroniMC,HickmanES,DenchiEL,CapraG,ColliE,
CecconiF,Mu
È
ller H and Helin K. (2001). Natur e Cell
Biol., 3, 552 ± 557.
Morris L, Allen KE and La Thangue NB. (2000). Nature Cell
Biol., 12, 232 ± 239.
Palmero I, Pantoja C and Serrano M. (1998). Nature, 39 5,
125 ± 126.
Pomerantz J, Schreiber-Agus N, Lie
Â
geois NJ, Silverman A,
Alland L, Chin L, Potes J, Chen K, Orlow I, Lee H-W,
Cordon-Cardo C and DePinho R. (1998). Cell, 92, 713 ±
723.
Quelle DE, Z indy F, Ashmun RA and Sherr CJ. (1995). Cell,
83, 993 ± 1 000.
Russell JL, Powers JT, Rounbehler RJ, Rogers PM, Conti
CJ and Johnson DG. (2002). Mol. Cell. Biol., 22, 1360 ±
1368.
Roth J, D obbelstein M, Freedman DA, Shenk T and Levine
AJ. (1998). EMBO J., 17, 554 ± 564.
Schmitt CA, McCurrach ME, de Stanchina E, Wallace-
Brodeur V and Lowe S W. (1999). Ge nes Dev., 13, 2670 ±
2677.
Serrano M, Hannon V and Beach D . (1993). Nature, 36 6,
704 ± 707.
Sherr C J. (1998). Genes Dev., 12, 2984 ± 2991.
Tao W and Levine AJ. (1999). Proc. Natl. Acad. Sci. USA,
96, 307 7 ± 3080.
Weber JD, Taylor LJ, Roussel MF, Sherr CJ and Bar-Sagi
D. (1999). Nat. Cell Biol., 1, 20 ± 26.
Weber JD, Jeers JR, Rehg JE, Randle DH, L ozano G,
Roussel MF, Sherr CJ and Zambetti GP. (2000a). Genes
Dev., 14, 2345 ± 2365.
Weber JD, Kuo M-L, Bothner B, D iGiammarino EL,
Kriwacki RW, Roussel MF a nd Sherr CJ. (2000b). Mol.
Cell. Biol., 20, 2517 ± 2528.
Wei W, Hemmer RM and Sedivy JM. (2001). Mol. Cell.
Biol., 21, 6748 ± 6757.
Xiao ZH, Chen J, Levine AJ, M odjathedi N, Zing J, Sellers
WR and Livingston D M. (1995). Nature, 37 5, 694 ± 698.
Zamanian M and La Thangue NB. (199 2). EMBO J., 11,
2603 ± 2610.
Zhang Y, Xiong Y and Yarbrough WG. (1998). Cell, 92,
725 ± 734.
Zhang Y and Xiong Y. (1999). Mol. Cell, 3, 579 ± 591.
p14
ARF
regulates E2F activity
SL Mason et al
4230
Oncogene