Molecular Identification and Prevalence of Some Virulence Genes among Pseudomonas aeruginosa Isolated from Iraqi Patients

Abstract

Genomic variation of Pseudomonas aeruginosa, an opportunistic pathogen, play dramatic impacts on its ability to cause infection. It was predicted it's virulence depend on its genomic content. This study focused on prevalence of some main virulence genes of one hundred seventy three of P.aeruginosa isolated from different diseases including wounds, burns, keratitis, otitis and diabetic foot ulcers between September 2018 to November 2019 from hospitalized patients in Baghdad. In this study, it was used duplex and multiplex PCR in detection of virulence genes which are plcN, algD, lasB, exoS, plcH, respectively. The prevalence average of studied genes in the burns isolates was; algD(93.5%), plcN(82.6%), lasB(95.6%), exoS(80.4%) and plcH(98%);from wounds isolates was; algD(81.5%), plcN(87%), lasB(87%), exoS(63%) and plcH(94.7%);from keratitis isolates was; algD(25%), plcN(75%), lasB(91.6%), exoS(12.5%) and plcH(71.4%); from otitis isolates was; algD(14.3%), plcN(75%), lasB(89.2%), exoS(17.8%) and plcH(71.4%) and from diabetic foot ulcers isolates was; algD(70.2%), plcN(83.8%), lasB(94.6%), exoS(75.6%) and plcH(89.1%). The higher prevalence gene in burns and wound is pclH while in otitis and diabetic foot ulcers is lasB as well as in keratitis isolates lasB and plcH gave the higher rate equally. This finding show there are an important correlation between the virulence factors and the infections' site by this bacterium so they represent beneficial markers in diagnosis of clinical strains of P.aeruginosa.

Full text

1542| International Journal of Pharmaceutical Research | Jan - Jun 2020 | Supplementary Issue 1
Research Article
Molecular Identification and Prevalence of Some
Virulence Genes among
Pseudomonas aeruginosa
Isolated from Iraqi Patients
SANA MH AL-SHIMMARY1*
1Department of Biology, College of Science for Women, University of Baghdad, Iraq
*Corresponding Author
Email ID: sana.habib@csw.uobaghdad.edu.iq
Received: 11.04.20, Revised: 11.05.20, Accepted: 11.06.20
ABSTRACT
Genomic variation of Pseudomonas aeruginosa, an opportunistic pathogen, play dramatic impacts on its ability to
cause infection. It was predicted it's virulence depend on its genomic content. This study focused on
prevalence of some main virulence genes of one hundred seventy three of P.aeruginosa isolated from different
diseases including wounds, burns, keratitis, otitis and diabetic foot ulcers between September 2018 to
November 2019 from hospitalized patients in Baghdad. In this study, it was used duplex and multiplex PCR in
detection of virulence genes which are plcN, algD, lasB, exoS, plcH, respectively. The prevalence average of
studied genes in the burns isolates was; algD(93.5%), plcN(82.6%), lasB(95.6%), exoS(80.4%) and
plcH(98%);from wounds isolates was; algD(81.5%), plcN(87%), lasB(87%), exoS(63%) and plcH(94.7%);from
keratitis isolates was; algD(25%), plcN(75%), lasB(91.6%), exoS(12.5%) and plcH(71.4%); from otitis isolates was;
algD(14.3%), plcN(75%), lasB(89.2%), exoS(17.8%) and plcH(71.4%) and from diabetic foot ulcers isolates was;
algD(70.2%), plcN(83.8%), lasB(94.6%), exoS(75.6%) and plcH(89.1%). The higher prevalence gene in burns and
wound is pclH while in otitis and diabetic foot ulcers is lasB as well as in keratitis isolates lasB and plcH gave
the higher rate equally. This finding show there are an important correlation between the virulence factors and
the infections' site by this bacterium so they represent beneficial markers in diagnosis of clinical strains of
P.aeruginosa.
Keywords: P. aeruginosa, virulence genes, duplex PCR, multiplex PCR
INTRODUCTION
Pseudomonas aeruginosa is an aerobic, Gram
negative bacterium that belonged to
Pseudomonadaceae and it represents one among
12 members of subtypes [1]. P. aeruginosa status
among the highest pathogens infecting
pulmonary, urinary tract, bloodstream, soft tissue
and surgical site in intensive care units [2]. It
causes a high percentage of morbidity and
mortality with low immune systems in hospitalized
patients [3]. Recently, the mortality associated with
this bacterium ranged (18% to 61%) in hospitals
[4]. It deems one of the most causative agents of
nosocomial contagions in Baghdad [5,6]. It is
infective only when inserted in to areas freed from
normal defenses [7]. The diversity of virulence
factors helped this bacterium to invade and
adhere the host by destroying the immune
responses and formation a barrier to antibiotics.
It's virulence factors are classified in to secreted
virulence and cell associated factors [8]. There are
different genes which encode these virulence
factors, seeing that the hall genome of it
represents one of the largest bacterial genomes
[9]. In this study, using molecular technique in
detection of some virulence genes for
P.aeruginosa like lasB, exoS, plcH, plcN and
algD. lasB is encoded for elastase, which is one
of extracellular enzymes, it's active on elastin as
well as inactivate human immunoglobulin and
degrade collagen. The gene exoS is encoded for
important enzyme which is exoenzyme S
(adenosine diphophate ribosyltansferase) which is
a member of TTSS(Type III secretion system) of
P.aeruginosa [10] so exoenzyme S inhibits protein
synthesis [11] and causing apoptosis by disrupting
actin cytoskeletonin the host' cells [10]. The P.
aeruginosa algD gene encodes GDP mannose
dehydrogenase, an enzyme which converts GDP-
mannose to GDP-mannuronic acid, a precursor
of the exopolysaccharide alginate [12]. Other
virulence factors in P.aeruginosa are two
phospholipase C enzyme (plc) which are
hemolytic and nonhymolytic produced by plcH
and plcN genes respectively [13]. Both enzymes
play a critical role in P.aeruginosa invasion by
breaking down phospholipids [14]. Some studies
showed that there is a comparative contribution of
several virulence factors in infections by
P.aeruginosa, for example elastase and type III
secretion system represent the most important
virulence factors in pneumonia case while
ISSN 0975-2366
DOI: https://doi.org/10.31838/ijpr/2020.SP1.237

Sana Mh Al-Shimmary et al / Molecular Identification and Prevalence of Some Virulence Genes among
Pseudomonas aeruginosa Isolated from Iraqi Patients
1543| International Journal of Pharmaceutical Research | Jan - Jun 2020 | Supplementary Issue 1
proteases important in burn infections,
pneumonia and keratitis [15,16]. Current study
aimed to determine the prevalence average of the
virulence genes in P.aeruginosa which isolated
from burns, keratitis, wounds, otitis and diabetic
foot ulcers in Baghdad 's hospitals.
MATERIALS AND METHODS
Samples collection: One hundred seventy three
isolates of P. aeruginosa were collected from
burns(46), wounds(38), keratitis(24), otitis(28)
and diabetic foot ulcers(37) from September
2018 to November 2019 from Different hospitals
in Baghdad from both genders with ages between
20 to 70 years old. P.aeruginosa isolates were
collected using pseudomonas and Citrimide agar,
then all isolates were tested by Vitek 2 tests to
ensure the diagnosis of bacteria.
DNA extraction: All clinical isolates were
undergone to DNA extraction to get genomic
DNA by using DNA extraction kit from
Promega(USA),then they were stored in -20°С.
Molecular Test: Molecular test include two PCR
tests :duplex PCR for algD and plcN genes and
multiplex PCR for lasB, exoS and plcH genes
using specific primers table(1) [17]. Total volume
for each test was 25 µl containing: 1 µl of each
primer, 2µl of genomic DNA,12.5µl of master mix
and 8.5 µl of distilled water. PCR tests were
performed under conditions show in table (2)
depending on previous study [18] and all PCR
products detected by using gel electrophoreces in
1.5 agarose gel stained with ethidium bromide in
biology department of college of science for
women in university of Baghdad, Iraq.
Table 1: Oligonucleotides of primers using in detection of virulence genes
Target gene
Sequence 5′→3′
Product
algD-FP
5 CGTCTGCCGCGAGATCGGCT 3
313bp
algD-RP
5 GACCTCGACGGTCTTGCGGA 3
plcN -FP
5 TCCGTTATCGCAACCAGCCCTACG 3
481bp
plcN -RP
5 TCGCTGTCGAGCAGGTCGAAC 3
lasB-FP
5 GGAATGAACGAAGCGTTCTCCGAC 3
284bp
lasB-RP
5 TTGGCGTCGACGAACACCTCG 3
exoS-FP
5 CGTCGTGTTCAAGCAGATGGTGCTG 3
444bp
exoS-RP
5 CCGAACCGCTTCACCAGGC 3
pclH-FP
5 GCACGTGGTCATCCTGATGC 3
608bp
pclH-RP
5 TCCGTAGGCGTCGACGTAC 3
Table 2: PCR conditions were performed in detection of virulence genes
PCR type
genes
conditions
Duplex PCR
algD and plcN
30 cycles at 94°С (1min), at 60°С (1.5) and at 72°С(1min)
triplex PCR
lasB, exoS and pclH
30 cycles at 94°С (1min), at 60°С (1.5) and at 72°С(1min)
RESULTS AND DISCUSSION
In epidemiological investigation, P. aeruginosa is
a considerable problem of health system in world
because of their variety of virulence factors [19].
Clinical results of P. aeruginosa invasion rely on
both bacterial virulence factors and suitable
response of the cell host which is neutralized by
virulence factors [20]. In the present study, all
isolates were veiled to the spread of some
virulence genes in P. aeruginosa. After insurance
of bacterial diagnosis by conventional laboratory
tests, genomic DNA were extracted (fig.1) then
PCR detected virulence genes for 173 isolates of
P. aeruginosa (fig.2).
Fig.1: Bacterial genomic DNA on gel electrophoresis using 8% of agarose

Sana Mh Al-Shimmary et al / Molecular Identification and Prevalence of Some Virulence Genes among
Pseudomonas aeruginosa Isolated from Iraqi Patients
1544| International Journal of Pharmaceutical Research | Jan - Jun 2020 | Supplementary Issue 1
Fig. 2: Agarose gel electrophoresis were done: A) multiplex PCR in detection of plcH, exoS and lasB
genes which their amplicons are 608bp,444bp and284bp respectively; B) duplex PCR in detection
of plcN gene(amplicon 481bp) and algD gene (amplicon 313bp),using ladder 100bp.
The result showed 52(30%) isolates gave positive
results with all tested virulence genes while only
11(6.4%) gave negative results with all of them so
the residual isolates 110(63.6%) showed variety in
appearance of different virulence genes (fig.3).
Fig.3: The spread of the virulence genes in studied P.aeruginosa isolates
Positive results with algD gene is 110(63.6%)
isolates involving 43(93.5%) with burns,
31(81.5%) with wounds, 6(25%) with keratitis,
4(14.3%) with otitis and 26(70.2%); the positive
results with plcN gene is 141(81.5%) isolates
representing by 38(82.6%) with burns, 33(87%)
with wounds, 18(75%) with keratitis, 21(75%) with
otitis and 31(83.8%)with diabetic foot ulcers;
positive results with lasB is 159(92%) isolates
including 44(95.6%) with burns, 33(87%)with
wounds, 22(91.6%)with keratitis, 25(89.2%)with
otitis and 35(94%) with diabetic foot ulcers;
positive results with exoS gene is 97(56%) isolates
comprising 37(80.4%) with burns,24(63%) with
wounds, 3(12.5%) with keratitis, 5(17.8%) with
otitis and 28(75.6%) with diabetic foot ulcers and
finally the positive results with plcH is 156(90.2%)
isolates consisting of 45(98%) with
burns,36(94%)with wounds, 22(91%) with
keratitis, 20(71.4%) with otitis and33(89.1%) with
diabetic foot ulcers; these numbers and
percentage show in table(3) as well as (fig.4)
shows the diagram of correlation between
infection sites and appearance of virulence genes.
Table 3: The numbers and percentage of prevalence each studied virulence genes of P.aeruginosa
with the different infection sites.
Virulence
genes
Source of isolates
Total (173)
Burns(46)
Wounds(38)
Keratitis(24)
Otitis(28)
Diabetic foot
ulcers (37)
alg
D
43(93.5%)
31(81.5%)
6(25%)
4(14.3%)
26(70.2%)
110(63.6%)
plc
N
38(82.6%)
33(87%)
18(75%)
21(75%)
31(83.8%)
141(81.5%)
las
B
44(95.6%)
33(87%)
22(91.6%)
25(89.2%)
35(94.6%)
159(92%)
exo
S
37(80.4%)
24(63%)
3(12.5%)
5(17.8%)
28(75.6%)
97(56%)
plc
H
45(98%)
36(94.7%)
22(91.6%)
20(71.4%)
33(89.1%)
156(90.2%)

Sana Mh Al-Shimmary et al / Molecular Identification and Prevalence of Some Virulence Genes among
Pseudomonas aeruginosa Isolated from Iraqi Patients
1545| International Journal of Pharmaceutical Research | Jan - Jun 2020 | Supplementary Issue 1
Fig.4: The correlation between the site infection and appearance of virulence genes in P.
aeruginosa
Many studies suggested that there is a correlation
between the infection's site and the virulence
factors of P. aeruginosa, they noticed that
presence of exoenzyme S, phospholipase C,
exotoxinA and elastase are produced with
different infections [21]. Some studies referred that
it is important to secrete a high level of elastase
and phospholipase C in all site's infections [22,23].
Lee et al. showed that Type III secretion system
which is encoded by exoS gene represents an
important virulence factor in acute infections and
this toxin secreting in to the host cell directly after
contacting between them [24]. Hua et al. showed
the invasion of tissue is promoted by protease,
cytotoxin, hemolysins and elastase [25]. This study's
results near to the other studies like (Pournajaf et
al.) that showed lasB, plcH genes prevalence in
P.aeruginosa is 100% and 96.5% from 143
isolates from CF patients [26 ]. Other study referred
that lasB gene is important in all type of infections
and their expression is related to availability of
substrates like elastin, collagen, fibronectin,
transferrin, fibrin and others [27]. Fariji et al.,
reported that toxA, lasB and exoS genes were
higher in children with cystic fibrosis and lasB is
higher than other virulence genes [18]. This is near
to our finding, that shows the higher prevalence
gene in burns and wound is pclH while in otitis
and diabetic foot ulcers is lasB as well as in
keratitis isolates lasB and plcH gave the higher
rate equally. The high appearance of elastase
encoding by lasB gene indicates that is important
for pathogenesis of this bacterium in cleaving
collagen and elastin. In fact elastase play an
origin role in destruction the junctions of epithelial
cells and it alters mobility of this cells causing
inhibition of cell injury [28,29]. The high level of
plcH gene refers to the importance of hemolytic
phospholipase C in invasion the host cells and
causing infections with most type of infections by
causing breaking down of the cell wall lipid of
epithelial cells [30] the prevalence of algD is
correlated with mucoid strains that over product
alginate increasing the pathogenisi and resistance
of the bacterium by protect it in a major
exopolysacchrides in a biofilm matrix [31] almost,
there is a high correlation between the chronic
infection and lasB and algD genes [32]. exoS gene
play important role especially with burns infection
by contributing dissemination of bacteria [33].
Diversity of virulence gene reflect the ability of
bacterial strains to adapt in different conditions as
well as their ability to quick evolution. It can use
these genes as a diagnostic virulence markers in
detection of P.aeruginosa strains.
CONCLUSION
The identification of virulence genes of any
pathogen is important to monitor and defeat this
pathogen, so in our study we show the correlation
between virulence genes of P. aeruginosa and the
infection sites. The prevalence of algD, lasB, exoS,
plcH and plcN genes is differ with infection type.
This correlation helps to determine the target
virulence factor and use the specific mechanism
to control it.
REFERENCES
1. Todar K Todar’s online textbook of
bacteriology. University of Wisconsin-Madison
Department of Bacteriology, 2008.
2. Trautmann M, Lepper PM, Haller M Ecology of
Pseudomonas aeruginosa in the intensive care unit
and the evolving role of water outlets as a
reservoir of the organism. Am J Infect Control
2005; 33:S41–S49.
3. Sadikot RT, Blackwell TS, Christman JW, Prince
AS Pathogen-host Interactions in Pseudomonas
aeruginosa pneumonia. Am J Respir Crit Care Med
2005; 171:1209–1223.
4. Moghaddam MM, Abolhassani F, Babavalian H et
al Amani Comparison of in vitro antibacterial
activities of two cationic peptides CM15 and

Sana Mh Al-Shimmary et al / Molecular Identification and Prevalence of Some Virulence Genes among
Pseudomonas aeruginosa Isolated from Iraqi Patients
1546| International Journal of Pharmaceutical Research | Jan - Jun 2020 | Supplementary Issue 1
CM11against five pathogenic bacteria:
Pseudomonas aeruginosa, Staphylococcus aureus,
Vibrio cholerae, Acinetobacter baumannii, and
Escherichia coli Probiotics Antimicrob Proteins 2012;
4(2):133—9.
5. AL-Shimmary SMH, Almohaidi AMS, Al-Qaysi, S,
Mohamed, N Improvement Rapid Molecular
Detection of Pseudomonas aeruginosa infected
some Iraqi Patients and It's antimicrobial
susceptibility. RJPBC 2016. 7(5)1256-1264.
6. AL-Shimmary SMH, Jawad NH, Wahhab, TA
Detection of toxA gene in clinical isolates of
Psedomonas aeruginosa using real time PCR. Ann
Trop Med Public Health. 2019; 21: SP2043-19
7. Streeter K, Katouli M Pseudomonas aeruginosa: A
review of their Pathogenesis and Prevalence in
Clinical Settings and the Environment. Infect
Epidemiol Microbiol 2016; 2(1): 25-32.
8. Holban L, Cotar AI, Mariana Carmen Chifiriuc
MC, et al Variation of virulence profiles in some
Staphylococcus aureus and Pseudomonas
aeruginosa stains isolated from different clinical
patients. Afr. J. Microbiol. Res. 2013; 7(27): 3453-
3460
9. Freschi L, Vincent AT, Jeukens J, et al The
Pseudomonas aeruginosa Pan-Genome Provides
New Insights on Its Population Structure,
Horizontal Gene Transfer, and Pathogenicity.
Genome Biology and Evolution 2019; 11(1): 109–
120. https://doi.org/10.1093/gbe/evy259
10. Sawa T The molecular mechanism of acute lung
injury caused by Pseudomonas aeruginosa: from
bacterial pathogenesis to host response. Journal
of Intensive Care 2014; 2:10.
11. Bever R A, Iglewski BH Molecular
Characterization and Nucleotide Sequence of
the Pseudomonas aeruginosa Elastase Structural
Gene. J. Bacteriol 1998; 170(9); 4309-4314.
12. Nikbin VS, Aslani MM, Sharafi Z, et al Molecular
identification and detection of virulence genes
among Pseudomonas aeruginosa isolated from
different infectious origins. Iran J Microbiol 2012;
4:118–23.
13. Woniak DJ Integration Host Factor and
Sequences Downstream of the Pseudomonas
aeruginosa algD Transcription Start Site Are
Required for Expression. Journal of Bacteriology.
1994; 176 (16): 5068-5076.
14. Konig B, Vasil ML, Konig W Role of haemolytic
and non-haemolytic phospholipase C from
Pseudomonas aeruginosa in interleukin-8 release
from human monocytes. J Med Microbiol 1997;
46:471–478.
15. Flores-Díaz M, Monturiol-Gross L, Naylor C et
al Bacterial Sphingomyelinases and
Phospholipases as Virulence Factors. Microbiol
Mol Biol Rev 2016; 80(3):597-628.
doi:10.1128/MMBR.00082-15
16. Michalska M, Wolf P Pseudomonas Exotoxin A:
optimized by evolution for effective killing,
Front. Microbiol 2015; 6 :963.
17. Berre R Le, Nguyen S, Nowak E et al Relative
contribution of three main virulence factors in
Pseudomonas aeruginosa pneumonia. Crit Care
Med 2011; 39: 2113-2120.
18. Wolska K, Szweda P Genetic features of clinical
Pseudomonas aeruginosa strains. Pol J Microbiol
2009; 58: 255-260.
19. Faraji F, Mahzounieh M, Ebrahimi A, et al
Molecular detection of virulence genes in
Pseudomonas aeruginosa isolated from children
with Cystic Fibrosis and burn wounds in Iran.
Microbial Pathogenesis 2016; 99: 1-4
20. Deshpande LM, Fritsche TR, Jones RN
Molecular epidemiology of selected multidrug-
resistant bacteria: a global report from the
SENTRY Antimicrobial Surveillance Program.
Diagn Microbiol Infect Dis 2004; 49: 231-236.
21. Khalifa A BH, Moissenet D, Thien H Vu,
Khedher M Virulence factors in Pseudomonas
aeruginosa: mechanisms andmodes of regulation.
Ann Biol Clin 2011; 69(4): 393-
403,http://dx.doi.org/10.1684/abc.2011.0589.
22. Coggan K A, Wolfgang M C Global regulatory
pathways and cross-talk control Pseudomonas
aeruginosa environmental lifestyle and virulence
phenotype. Curr Issues Mol Biol., 2012; 14: 47–70.
doi: 10.21775/cimb.014.047.
23. Hamood AN, Griswold JA, Duhan CM
Production of extracellular virulence factors by
Pseudomonas aeruginosa isolates obtained from
tracheal, urinary tract, and wound infections. J
Surg Res 1996; 61(2):425-32.
24. Lee B, Schjerling CK, Kirkby N, Hoffmann, N et
al Mucoid Pseudomonas aeruginosa isolates
maintain the biofilm formation capacity and the
gene expression profiles during the chronic lung
infection of CF patients. APMIS 2011; 119:263-
274.
25. Hua Yu, He X, Xie W, et al Elastase Las B of
Pseudomonas aeruginosa promotes biofilm
formation partly through rhamnolipid-mediated
regulation. Canadian Journal of Microbiology 2014;
60(4):227-235.
26. Pournajaf A, Razav S, Irajian G, et al Integron
types, antimicrobial resistance genes, virulence
gene profile, alginate production and biofilm
formation in Iranian cystic fibrosis Pseudomonas
aeruginosa isolates. Le Infenzioni Mededicina 2018;
26(3):226-236
27. Wa'ad M R Distribution of algD, lasB, pilB and
nan1 genes among MDR clinical isolates of
Pseudomonas aeruginosa in respect to site of
infection. Tikrit Medical Journal. 2011; 17(2):148-
160.
28. . Fadhil L, Al-Marzoqi AH, Zahraa MA, Shalan
AA Molecular and phenotypic study of virulence
genes in a pathogenic strain of Pseudomonas

Sana Mh Al-Shimmary et al / Molecular Identification and Prevalence of Some Virulence Genes among
Pseudomonas aeruginosa Isolated from Iraqi Patients
1547| International Journal of Pharmaceutical Research | Jan - Jun 2020 | Supplementary Issue 1
aeruginosa isolated from various clinical origins
by PCR: profiles of genes and toxins. Res J
Pharm, Biol Chem Sci 2016; 7: 590–598.
29. Khattab MA, Nour MS, ElSheshtawy NM
Genetic identification of Pseudomonas aeruginosa
virulence genes among different isolates. J
Microb Biochem Technol 2015; 7, 274–277
30. Jackson AA, Gross MJ, Daniels EF, et al Anr and
its activation by PlcH activity in Pseudomonas
aeruginosa host colonization and virulence. J
Bacteriol 2013; 195, 3093–3104.
31. Whitney J C, Whitfield GB, Marmont LS, et al
Dimeric c-di-GMP is required for
posttranslational regulation of alginate
production in Pseudomonas aeruginosa J Biol
Chem 2015; 290:12451–12462.
32. Mitov I, Tanya S, Boyka M Prevalence of
virulence genes among bulgarian nosocomial and
cystic fibrosis isolates of Pseudomonas aeruginosa
Braz J Microbiol 2010; 41, 588–595
33. Jabalameli F, Mirsalehian A, Khoramian B, et al
Evaluation of biofilm production and
characterization of genes encoding type III
secretion system among Pseudomonas aeruginosa
isolated from burn patients. Burns 2012;
38(8):1192–7. doi: 10.1016/j.burns.2012.07.030.