The Largest Subunit of Human TFIIIC Complex, TFIIIC220, a Lysine Acetyltransferase Targets Histone H3K18: Supplementary Figures

Abstract

TFIIIC is a multisubunit complex that recognizes promoter elements and recruits TFIIIB and RNA polymerase III. Human TFIIIC complex possess lysine acetyltransferase activity which is critical in relieving chromatin mediated repression for RNA polymerase III-mediated transcription; two subunits of the TFIIIC complex, TFIIIC110 and TFIIIC90, were shown to acetylate H3 in vitro. Here we show that the largest and DNA binding subunit of TFIIIC complex, TFIIIC220, possesses intrinsic lysine acetyltransferase activity and acetylates histone H3K18 residue. By employing homology search we have identified the potential catalytic domain of TFIIIC220 which efficiently acetylate core histones in vitro. Point mutations at the critical residues of the identified acetyltransferase domain drastically reduces the acetyltransferase activity. Significantly, knockdown of TFIIIC220 in HepG2 cell line dramatically reduces global H3K18 acetylation level suggesting that TFIIIC220 is a crucial KAT to maintain acetylation homeostasis in the cell.

Full text

The Largest Subunit of Human TFIIIC Complex, TFIIIC220, a
Lysine Acetyltransferase Targets Histone H3K18
Moumita Basu1, Ramachandran Boopathi1≠, Sadhan Das1*, Tapas K Kundu1¶
1 Transcription and Disease Laboratory, Molecular Biology and Genetics Unit,
Jawaharlal Nehru Centre for Advanced Scientific Research, Bangalore, India
Present Addresses: ≠Université Grenoble Alpes, CNRS UMR 5309, INSERM U1209,
Institute for Advanced Biosciences (IAB), Site Santé - Allée des Alpes, 38700 La Tronche,
France; Université de Lyon, Ecole Normale Supérieure de Lyon, CNRS, Laboratoire de
Biologie et de Modélisation de la Cellule LBMC, 46 Allée d'Italie, 69007 Lyon, France.
*Department of Diabetes Complications and Metabolism, Diabetes Metabolism Research
Institute, Beckman Research Institute of City of Hope, Duarte, CA 91010, USA
¶Correspondence: Prof. Tapas K Kundu, Transcription and Disease Laboratory,
Molecular Biology and Genetics Unit, Jawaharlal Nehru Centre for Advanced Scientific
Research, Bangalore 560064, India
Email: tapas@jncasr.ac.in
Tel. +91 80 2208 2840
Fax: +91 80 22082766
All rights reserved. No reuse allowed without permission.
(which was not peer-reviewed) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
The copyright holder for this preprint. http://dx.doi.org/10.1101/513127doi: bioRxiv preprint first posted online Jan. 6, 2019;

ABSTRACT
TFIIIC is a multisubunit complex that recognizes promoter elements and recruits TFIIIB and
RNA polymerase III. Human TFIIIC complex possess lysine acetyltransferase activity which
is critical in relieving chromatin mediated repression for RNA polymerase III-mediated
transcription; two subunits of the TFIIIC complex, TFIIIC110 and TFIIIC90, were shown to
acetylate H3 in vitro. Here we show that the largest and DNA binding subunit of TFIIIC
complex, TFIIIC220, possesses intrinsic lysine acetyltransferase activity and acetylates histone
H3K18 residue. By employing homology search we have identified the potential catalytic
domain of TFIIIC220 which efficiently acetylate core histones in vitro. Point mutations at the
critical residues of the identified acetyltransferase domain drastically reduces the
acetyltransferase activity. Significantly, knockdown of TFIIIC220 in HepG2 cell line
dramatically reduces global H3K18 acetylation level suggesting that TFIIIC220 is a crucial
KAT to maintain acetylation homeostasis in the cell.
INTRODUCTION
Acetylation of protein is one of the most prevalent posttranslational modification in eukaryotic
system. Co-translational Nα-acetylation occurs in almost ~80% of proteins which regulates
their interaction, localization and stability (Aksens et al., 2010). Posttranslational addition of
acetyl group from acetyl-CoA to Nε of lysines is mostly catalyzed by lysine acetyltransferases
(KATs) and has been classically associated with permissible chromatin structure, hence,
transcriptional activation; but, later has also been shown to be critical for chromatin
architecture (Shogren-Knaak et al., 2006), DNA repair (Chatterjee et al., 2012), protein
stability and protein-protein interaction (Kouzarides, 2007). Currently, over 35,000 acetylation
sites exist in human cells; abundance of this modification is almost comparable to that of
protein phosphorylation (Hornbeck et al., 2012).
All rights reserved. No reuse allowed without permission.
(which was not peer-reviewed) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
The copyright holder for this preprint. http://dx.doi.org/10.1101/513127doi: bioRxiv preprint first posted online Jan. 6, 2019;

Eukaryotes possess very distinct set of nuclear lysine acetyltransferases which are majorly
categorized based on structural and biochemical features of catalysis into the following
subclasses; GCN5-related N-acetyltransferases (GNAT), the p300/CREB-binding protein
(p300/CBP), and, the MOZ, Ybf2, Sas2, and Tip60 (MYST) family. However, some
acetyltransferases which do not belong to any of these classes have also been identified later;
among those there are nuclear hormone-related KATs SRC1 and ACTR (SRC3) and
transcription factors such as human TFIID subunit TBP associated factor 250 (TAFII250)
(reviewed in Torchia et al., 1998). General transcription factors like TFIIB and TFIIF has been
found to possess autoacetylation properties which induces RNA polymerase II mediated
transcription (reviewed in Choi et al., 2004). Also, most KATs belong to multiprotein
complexes with various associated subunits, which regulate their catalytic activities and
substrate specificities, especially in the case of histone acetylation (Shahbazian et al., 2007).
Acetylation is a reversible process; metal-dependent lysine deacetylases (KDACs) catalyze the
hydrolysis of acetyl-L-lysine side chains in proteins to yield L-lysine and acetate. Acetylation
and deacetylation of nucleosomal histones provide a balance between open and closed
chromatin conformation for the regulation of transcription. Like KATs, KDACs lack intrinsic
DNA-binding activity and are recruited to target genes via their direct association with
transcriptional activators and repressors, as well as their incorporation into large multiprotein
transcriptional complexes (reviewed in Lombardi et al., 2011).
RNA polymerase III (pol III) transcribes small, untranslated structural RNAs contributing to
~15% of total RNA by weight. RNAPIII can initiate transcription from at least four different
types of promoters; two of them being internal control region situating downstream of
transcription start site (TSS) (Dieci et al., 2007; Schramm et al., 2002). Transcription from
these two promoters essentially requires one general transcription factor, a multisubunit
complex, TFIIIC. Once bound to promoter region TFIIIC can recruit TFIIIB and RNA
All rights reserved. No reuse allowed without permission.
(which was not peer-reviewed) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
The copyright holder for this preprint. http://dx.doi.org/10.1101/513127doi: bioRxiv preprint first posted online Jan. 6, 2019;

polymerase III and form preinitiation complex. TFIIIC has been shown to be required for
reinitiating transcription cycle and context dependent repression of RNA polymerase III
mediated transcription. Other than RNA polymerase III mediated transcription TFIIIC has also
been shown to possess barrier or insulator function, facilitate transposon insertion, localize in
perinucleolar heterochromatin, facilitate or repress adjacent RNA polymerase II targeted
transcription. TFIIIC has genome wide footprint majority of which is devoid of bound active
RNA polymerase III, and, mediates ‘extra transcriptional effects’. TFIIIC may act as a stably
bound, global “bookmark” within chromatin to establish, maintain, or demarcate chromatin
states as cells divide or change gene expression patterns (Policarpi et al., 2017; reviewed in
Donze, 2011 and Van et al., 2012). Human TFIIIC is ~600kDa multisubunit complex existing
in different forms comprised of various subunits in cells (Oettel et al., 1997). Active TFIIIC
comprises of at least six subunits (Lagna et al., 1994; Ducrot et al., 2006). The largest subunit
is a 200kDa protein which recognizes and tightly binds to B box subunit through its N-terminal
zinc finger binding motifs. Although functionally TFIIIC is conserved from yeast to human,
TFIIIC220 homolog is not present in yeast; instead of 220kDa subunit a polypeptide of 138kDa
binds to B-box region in yeast. Human TFIIIC holocomplex possesses acetyltransferse activity
which aids in relieving chromatin mediated repression during transcription; TFIIIC can
acetylate free and nucleosomal histones H3 and H4 in solution and can acetylate H2A as well
in native HeLa nucleosome (Kundu et al., 1999). In this regard TFIIIC was found to be different
from other general transcription factors possessing acetyltransferase activity such as TFIID
subunit TAFII250 which can only acetylate H3 and H4 (Mizzen et al., 1996). Intrinsic
acetyltransferase activities of two of TFIIIC subunits TFIIIC90 and TFIIIC110 have been
characterized, their catalytic activities are specific for H3 (Kundu et al.,1999; Hsieh et
al.,1999). However, if TFIIIC220 is an acetyltransferase or not is still unclear. A TFIIIC220
like protein in C. tentans, P2D10 has acetyltransferase activity specific for H3 and H4 in vitro
All rights reserved. No reuse allowed without permission.
(which was not peer-reviewed) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
The copyright holder for this preprint. http://dx.doi.org/10.1101/513127doi: bioRxiv preprint first posted online Jan. 6, 2019;

(Sjölinder et al., 2005). This prompted us to investigate the acetyltransferase activity of human
TFIIIC220. To understand whether TFIIIC220 is an acetyltransferase and its functional
significance we purified recombinant human TFIIIC220 as well as its acetyltransferase domain
and showed that hTFIIIC220 has intrinsic acetyltransferase activity. Most significantly, we
showed that TFIIIC220 is an acetyltransferase with strong specificity for H3K18 residue in
vitro as well as in the cellular context.
RESULTS AND DISCUSSION
TFIIIC220 has intrinsic acetyltransferase activity
In-gel histone acetyltransferase assay indicated that the human TFIIIC complex possesses three
polypeptides, 220, 110 and 90kDa with intrinsic acetyltransferase enzymatic activity. The
catalytic activities of TFIIIC110 and TFIIIC90 were confirmed using recombinant deletion
mutation domains or baculovirus expressed full length protein and were shown to efficiently
acetylates core histones (Kundu et al., 1999; Hseih et al., 1999) However, the catalytic activity
of the largest subunit of TFIIIC complex, TFIIIC220 is yet to be established. Since TFIIIC
complex was found to pull down robust acetyltransferase p300 (Mertens et al., 2008) it might
also be the factor contributing to the acetyltransferase activity of the complex. To characterize
the contribution of catalytic activity of the 220 kDa subunit we constructed the recombinant
baculovirus using full length clone of human TFIIIC220and purified it from Sf21 cells infected
with the baculovirus containing His-tagged full length human TFIIIC220 isoform 1 (Figure
1A). The expression of the protein was confirmed by TFIIIC220 specific antibody (Figure 1A).
Immunoblottting the eluted fraction with p300 specific antibody confirmed that eluted fraction
of TFIIIC220 was not contaminated with p300 from Sf cells (Supplementary figure 1). We
next examined intrinsic catalytic activity of TFIIIC220 by in vitro enzymatic assays using
recombinant core histones H3, H2A and H4, since substrate specificity of TFIIIC holocomplex
All rights reserved. No reuse allowed without permission.
(which was not peer-reviewed) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
The copyright holder for this preprint. http://dx.doi.org/10.1101/513127doi: bioRxiv preprint first posted online Jan. 6, 2019;

were found to be specific for histones H3, H4 and H2A but not for H2B. Full length TFIIIC220
was found to possess significant amount of enzymatic activity (Figure 1B) and it could
acetylate recombinant H3, H2A and H4 (Figure 1C).
TFIIIC220 KAT activity maps to predicted acetyl CoA binding sites
We next mapped TFIIIC220 domains responsible for its acetyltransferase activity. TFIIIC220
did not show any sequence similarity with known acetyltransferases, but three regions of
human TFIIIC220 matched the highly conserved acetyl CoA recognition and binding motif
(R/Q)XXGX(G/A) (Dutnall et al., 1998); Two of those aa 834-839 and aa 896-901 lies in the
mid region and motif 3 aa 1941-1946 is in the C terminal of isoform 1 (Figure 2B);
Interestingly, we found that isoform 2 of human TFIIIC220 lacks putative motif 3. Motif 1 and
2 are 100% conserved among mammals but unlike motif 1, motif 2 is conserved across other
vertebrates as well (Supplementary figure 2 and Figure 2B). We considered ~50kDa region
spanning motif 1 and 2 to be the putative acetyltransferase domain and purified recombinant
KAT domain from E.coli (Figure 2C). Purified protein was identified by immunoblotting with
antibodies specific for His tag which recognized the protein corresponding to ~50kDa (Figure
2C). 50kDa protein was also confirmed to be the putative acetyltransferase domain of
hTFIIIC220 by mass spectrometric analysis (Supplementary figure 3). Additional proteins in
the elution corresponding to molecular weights of ~25 and ~75kDa were identified as common
histidine rich contaminants from BL21 cells by mass spectrometric analysis (Data not shown,
as mentioned in Bolanos-Garcia et al., 2006). Purified TFIIIC220 KAT domain possessed
significant acetyltransferase activity and acetylated histone H3 in vitro (Figure 2D). Next, we
introduced point mutations in putative acetyl CoA binding motif to destabilize interaction with
acetyl CoA by mutating glycines with electronegative and bulky aspartic acid and arginines
with small neutral amino acid alanine. Introduction of destabilizing point mutations in putative
acetyl CoA binding motif 1 abrogated its acetyltransferase activity by ~40% in in vitro
All rights reserved. No reuse allowed without permission.
(which was not peer-reviewed) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
The copyright holder for this preprint. http://dx.doi.org/10.1101/513127doi: bioRxiv preprint first posted online Jan. 6, 2019;

enzymatic assay (Figure 2D). The remnant catalytic function might result from intact motif 1
present in the putative catalytic domain.
TFIIIC220 KAT differs from known acetyltransferases
Effects of acetyltransferase activities of different KAT families have been found to be diverse.
Although in general acetylation of histones opens up the chromatin structure and activates
transcription, KATs have also been shown to have implication in DNA repair, protein
stabilization, protein-protein interaction etc. Since, KAT domain of TFIIIC220 did not bear
similarities with other known classes of nuclear KATs we expected its acetylation signature to
be different as well. In order to characterize the residue specificity of the KAT activity of
TFIIIC220 recombinant acetyltransferase domain of TFIIIC220 was used for in vitro
acetyltransferase assay. Since p300 is one the most robust and well conserved acetyltransferase
known to acetylate all the core histones in many lysine residues we used recombinant human
p300 KAT domain as positive control for our assays. The results showed that TFIIIC220 KAT
domain could efficiently acetylate H3K18 residue which is known to be associated with open
chromatin and active transcription. Surprisingly TFIIIC220 KAT domain failed to modify other
N -terminal lysine residues of H3 such as K9, K14, K27, and, K56 and H4 K8 and K12 in vitro
(Figure 3A). Since specificity of KATs for histones could be close to the in vivo context when
nucleosomes are used as substrates we reconstituted mononucleosomes using HeLa cells core
histones and used as substrates in enzymatic assay. Full length TFIIIC220 also showed specific
acetyltransferase activity towards reconstituted mononucleosome and acetylated at H3K18
residue. Recombinant full length TFIIIC220 could not acetylate H3K14 and H3K56 residues
in vitro further indicating it is free from p300 contamination (Supplementary figure 4). To
address the in vivo specificity of KAT activity of TFIIIC220 we downregulated TFIIIC220
expression in HepG2 cells by TFIIIC220 specific shRNA stable transfection and probed for
All rights reserved. No reuse allowed without permission.
(which was not peer-reviewed) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
The copyright holder for this preprint. http://dx.doi.org/10.1101/513127doi: bioRxiv preprint first posted online Jan. 6, 2019;

H3K18 acetylation in TFIIIC220 knockdown cells. Knockdown of TFIIIC220 drastically
reduced global H3K18 acetylation level in HepG2 cells (Figure 3C and D).
TFIIIC220 has autoacetylation property
Like kinases the lysine acetyltransferases also possess self-enzymatic activity. Most of the
KATs have been shown to be autoacetylated which enhance their catalytic activity. We
therefore investigated whether TFIIIC220 possesses autocatalytic property. We found that
purified full length TFIIIC220 from Sf cells are highly acetylated or undergoes rapid
acetylation under in vitro assay conditions (Figure 4A). To distinguish the cellular acetyl CoA
pool from that of the assay we used tritiated acetyl CoA and found that full length TFIIIC220
as well as its KAT domain stably incorporated tritiated acetyl group in its structure (Figure 4B
and C).
This study has provided experimental evidence to establish TFIIIC220 as a bona fide histone
acetyltransferase. Full length TFIIIC220 could acetylate nucleosomal and free histone H3 in
vitro and specifically acetylated H3K18 residue. Earlier TFIIB and TFIIF, general transcription
factors for RNA polymerase II was found to possess acetyltransferase activity, they regulated
themselves by autoacetylation and their catalytic activities have implication in transcription
(Choi et al., 2004). Our study will be a first finding of a general transcription factor which
directly binds to DNA also possesses histone acetyltransferase activity along with
autoacetylation property. Given the versatility of TFIIIC complex intrinsic catalytic activities
of its subunits might play important roles in orchestrating its multitudinal effector function.
TFIIIC220 being the DNA binding subunit and main recruitment factor of TFIIIC holocomplex
we presume that acetyltransferase activity of this subunit holds special significance.
Acetylation of different lysine residues of histones is closely linked to various biological
phenomena. TFIIIC220 preferentially acetylates Lys18 in H3 N-terminal. Lys18 in H3 is also
All rights reserved. No reuse allowed without permission.
(which was not peer-reviewed) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
The copyright holder for this preprint. http://dx.doi.org/10.1101/513127doi: bioRxiv preprint first posted online Jan. 6, 2019;

a preferred substrate for acetylation by human p300/CBP and ELP3. Acetylation of this
particular site is shown to be enriched in active TSS, implicated in nucleolar heterochromatin
dynamics, cytotoxicity and poor prognosis in cancer (Juliano et al., 2016; Damodaran et al.,
2017; Hiraoka et al., 2013; Ianni et al., 2017)
TFIIIC220 is a higher eukaryote protein, no homologue of TFIIIC220 is found in yeast.
Although a functional homolog of TFIIIC220 is identified in Drosophila it does not bear
significant sequence similarity and acetyltransferase activity of the protein is not characterized.
TFIIIC220 in vertebrates are conserved more or less; the homologs being almost identical in
mammals gives rise to the possibility of highly evolved function of the protein.
Figure 1: Recombinant TFIIIC220 possesses acetyltransferase activity
All rights reserved. No reuse allowed without permission.
(which was not peer-reviewed) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
The copyright holder for this preprint. http://dx.doi.org/10.1101/513127doi: bioRxiv preprint first posted online Jan. 6, 2019;

A. SDS PAGE profile of purified full length human TFIIIC220. Purified protein was probed
with anti-His polyclonal antibody. TFIIIC220 specific antibody recognizes the intact protein of
~250kda (indicated with black star) as well as some of the degraded products (indicated with
brown stars). B. In vitro filter binding assay was performed using full length TFIIIC220 and
human p300 KAT domain. 1µg histone H3 and 50nCi 3H-acetyl CoA were used as substrates.
C. In vitro KAT assay was performed using full length TFIIIC220, 1µg of histone H3, H4 and
H2A and 50nCi 3H-acetyl CoA were used as substrates. Reaction mixtures were loaded onto
12% SDS-PAGE and developed on X ray films.
All rights reserved. No reuse allowed without permission.
(which was not peer-reviewed) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
The copyright holder for this preprint. http://dx.doi.org/10.1101/513127doi: bioRxiv preprint first posted online Jan. 6, 2019;

Figure 2: Identification of acetyltransferase domain of TFIIIC220
A. Schematic diagram of full length TFIIIC220 protein. Relative positions of three putative
acetyl CoA binding motifs are indicated. [DBD= DNA binding region] B. Sequence
conservation of motif 1 and motif 2 across different vertebrate species using Clustal Omega
(EMBL-EBI). C. SDS-PAGE profile of purified recombinant KAT domain and mutants. D. In
vitro filter binding assay was performed using ~200 ng wild type and mutant TFIIIC220 KAT
domains, 1µg of histone H3, H4 and H2A and 50nCi 3H-acetyl CoA were used as substrates.
Student’s unpaired t test was used for statistical analysis; N=2; p ns>0.05, p*<0.05, p**<0.001,
p***<0.0005
Figure 3: Site specificity of TFIIIC220 on core histones in vitro
All rights reserved. No reuse allowed without permission.
(which was not peer-reviewed) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
The copyright holder for this preprint. http://dx.doi.org/10.1101/513127doi: bioRxiv preprint first posted online Jan. 6, 2019;

A. In vitro KAT assay was performed using ~200ng of recombinant TFIIIC220 KAT domain.
~1µg of recombinant H3, H4 and 40µM acetyl CoA were used as substrates. Reaction mixtures
were loaded on 12% SDS PAGE and probed with site specific acetyllysine antibodies. Human
p300 KAT domain was taken as positive control for all the reactions. B. In vitro KAT assay was
performed using reconstituted nucleosome and then loaded on 12% SDS PAGE and probed
with acetylated H3K18 specific antibody. Human p300 KAT domain was taken as positive
control. C and D. HepG2 cells were stably transfected with shTFIIIC220 or shNS (scrambled)
and treated with 2µg/mL doxycycline for 96 hours. RIPA and Laemmli lysates were loaded
onto 12% SDS PAGE and probed with TFIIIC220 (normalized against tubulin) and acetylated
H3K18 specific antibodies (normalized against histone H3) (in C); cells were probed with
acetylated H3K18 specific antibody and observed under microscope for immunofluorescence.
Scale bar: 20µm.
All rights reserved. No reuse allowed without permission.
(which was not peer-reviewed) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
The copyright holder for this preprint. http://dx.doi.org/10.1101/513127doi: bioRxiv preprint first posted online Jan. 6, 2019;

Figure 4: TFIIIC220 autoacetylates.
In vitro KAT assay was performed using ~100 ng full length and ~200ng KAT domain of
TFIIIC220. 1µg of recombinant core histones (H3, H2A, and, H4) and 40µM acetyl CoA or
50nCi 3H-acetyl CoA were used as substrates. Reaction mixtures were loaded onto 12% SDS
PAGE and probed with acetyl-lysine specific antibody (in A) or developed onto X ray films (in
B and C)
MATERIALS AND METHODS
Cell lines and culture
All rights reserved. No reuse allowed without permission.
(which was not peer-reviewed) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
The copyright holder for this preprint. http://dx.doi.org/10.1101/513127doi: bioRxiv preprint first posted online Jan. 6, 2019;

HepG2 cells (ATCC) were grown in MEM (Gibco) with 2mM Glutamine, 10% FBS at 37 °C
and 5.0% CO2. Cell lines were tested for mycoplasma contamination. Sf21 cells (Invitrogen)
were grown at 27 °C in Grace’s Insect Medium (Gibco) with 10% FBS.
Stable cell line generation
shTFIIIC220 or scrambled shRNA construct (Dharmacon) containing lentivirus were
generated using calcium phosphate mediated precipitation of 5µg of pSPAX2, 0.75µg
pCMV-Rev, 1.75µg pVSVG and 5µg of respective shRNAs in HEPES buffered saline (pH
7.05) onto HEK293T cells in 90mm dish containing 10mL of DMEM supplemented with
10% FBS. Stable cell line was generated by infecting HepG2 cells with lentivirus containing
shRNAs for ~8 hours. Cells were selected with 1 mg/mL Puromycin (Sigma) and expression
of shRNAs were monitored under microscope by RFP expression after 96 hours treatment
with 2mg/mL Doxycycline (Sigma).
Plasmid constructs
PTRF-IIICa clone was a kind gift from Dr. Zhengxin Wang, MD Anderson Cancer Research
Centre, Texas. TFIIIC220 full length construct was subcloned into pENTR-DTOPO vector
using Topo TA cloning kit (Invitogen) and primers listed below. TFIIICFP topo 5’
CACCATGGACGCGCTGGAGTC 3’, Topo 1st RP 5’
CTCGAGCGGAATTCCGCTCTAGAGGAAGCACTCAGCT 3’, Topo 2nd FP 5’
CTAGTCTAGATCAGAAAGTGGACGGATGAAAAAAAG 3’, Topo 2nd RP:
5’CGGAATTCCTTAGGGCTGAACTGAACTTTTC 3’, Topo 3rd FP: 5’
CGGAATTCTAACCTTGAAATCCCAGACACAC 3’, Topo 3rd RP: 5’
CCGCTCGAGGAGGTGGATCCACTTG 3’, TFIIICRP topo 5’
GAGGTGGATCCACTTGTTCCAGTTGACC 3’. Clone was confirmed by sequencing and
cloned into baculovirus using BaculoDirect Bacoluvirus Expression system kit (Invitrogen).
C- terminally His6 tagged TFIIIC220 KAT domain was cloned in the pET28b vector using
All rights reserved. No reuse allowed without permission.
(which was not peer-reviewed) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
The copyright holder for this preprint. http://dx.doi.org/10.1101/513127doi: bioRxiv preprint first posted online Jan. 6, 2019;

PCR based cloning from TFIIIC220 full length clone. Catalytic mutants were generated by site
directed mutagenesis (Agilent Quik Change II Mutagenesis Kit). Primers used: GTF3C1 KAT
domain forward: 5’ CATGCCATGGCAATGTTTCTGTGGTAC 3’, GTF3C1 KAT domain
reverse: 5’ CCGCTCGAGAACCAGTAGTTTTCCAC 3’, SDM1 forward: 5’
GTGTCCCTGAAGCTGAAACTGACCCGAGAGCAG 3’, SDM1 reverse: 5’
CACAGGGACTTCGACTTTGACTGGGCTCTCGTC 3’, SDM2 forward: 5'
GAGCCCAGTCAAAGTCGAAGTCCGCGTGG 3', SDM2 reverse: 5'
CCACGCGGACTTCGACTTTGACTGGGCTC 3', SDM3 forward: 5’
GAGCCCAGTCAAAGTCGAAGTCCGCGTGG 3’, SDM3 reverse: 5’
CCACGCGGACTTCGACTTTGACTGGGCTC 3’
Recombinant protein expression and purification
Protein purification protocol was adapted from Bornhorst and Falke, 2000. Full length
TFIIIC220 was purified from Sf21 cells infected with TFIIIC220 baculovirus for 72 hours.
Recombinant wildtype and mutant KAT domains of TFIIIC220 were co-expressed with Sirt2
in E. coli BL21 (DE3) cells to reduce toxic effect of KAT overexpression and induced with 0.4
mM IPTG at 30 °C for 5 h. Cells were lysed in BC300(20 mM Tris-Cl pH 7.4, 20% Glycerol,
300 mM KCl, 0.1% NP40, 2 mM PMSF, 2 mM beta mercaptoethanol, Protease Inhibitor
Cocktail (Sigma)) and sonicated until lysate was clear. Lysates were incubated with Ni-NTA
beads (Novagen) for 3 h and washed with BC300. Proteins were eluted in BC100 containing
250 mM Imidazole. 6His-tagged p300 HAT domain (aa 1284-1673) was purified from cells
co-transformed with p300 HAT domain and SirT2 construct in E. coliBL21(DE3) as described
previously in Thompson et al., 2004.
Reagents
Antibodies used for immunoblots and immunofluorescence are anti-TFIIIC220 (Bethyl
Laboratories, A301-291A), anti-tubulin (Calbiochem, CP06), histone modifications antibodies
All rights reserved. No reuse allowed without permission.
(which was not peer-reviewed) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
The copyright holder for this preprint. http://dx.doi.org/10.1101/513127doi: bioRxiv preprint first posted online Jan. 6, 2019;

were raised in-house. Secondary antibodies: Goat Anti-Rabbit IgG H&L (HRP), Abcam
(Catalog no. ab97051); Goat anti-Rabbit IgG (H+L) Cross-Adsorbed, Alexa Fluor® 488,
Thermo Fisher Scientific (Catalog no. A-11008).
In vitro filter binding assay and gel assay
Filter binding HAT assay was performed using 50nCi 3H acetyl-CoA and 1μg recombinant H3
or ~1μg of reconstituted nucleosome as substrate (Berndsen and Denu, 2005) and analyzed by
capturing the acetylated products on Whatman p81filter paper. After stringent washes to
remove residual free acetyl CoA, acetylation levels were quantified with Wallac 1409 Liquid
Scintillation Counter. For gel assay reaction mixtures were loaded onto 12% SDS PAGE and
then transferred onto PVDF membrane (Merck Millipore) and immunoblotted with antibodies
as mentioned. Nucleosome reconstitutions were performed by salt gradient dialysis as
described previously (Hayes et al., 1997) 601 DNA (kind gift from Jonathan Widom) amplified
from pGEM3z clone using appropriate primers (listed below) and HeLa core histones and free
DNA in 1:1 molar ratio were incubated in Buffer A (10mM Tris-HCl pH 7.9, 1mM EDTA,
1mM β-Me) containing 2M NaCl. Reaction was step dialysed in Buffer A containing 1, 0.8,
0.6, 0.1 M NaCl. Finally reaction was dialysed against Buffer B (10mM Tris-HCl pH 7.9,
0.25mM EDTA, 10mM NaCl) for overnight at 4ºC.
601 FP: 5’ GCTCGGAATTCTATCCGACTGGCACCGGCAAG 3’
601 RP: 5’ GCATGATTCTTAAGACCGAGTTCATCCCTTATGTG 3’
Acknowledgement
We acknowledge JNCASR confocal facility for confocal imaging and IISc Bangalore MBU
mass spectrometric facility for LC-MS service.
Funding
This work was supported by Jawaharlal Nehru Centre for Advanced Scientific Research
(JNCASR) and Department of Biotechnology (DBT). MB is a CSIR-SRF. TKK is Sir J. C.
All rights reserved. No reuse allowed without permission.
(which was not peer-reviewed) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
The copyright holder for this preprint. http://dx.doi.org/10.1101/513127doi: bioRxiv preprint first posted online Jan. 6, 2019;

Bose Fellow, Department of Science and Technology (DST), India (Grant No. SR/S2/JCB-
28/2010).
References
Aksnes H, Drazic A, Marie M, Arnesen T. First Things First: Vital Protein Marks by N-
Terminal Acetyltransferases. Trends Biochem Sci. 2016;41(9):746–60
Berndsen CE, Denu JM (2005) Assays for mechanistic investigations of protein/histone
acetyltransferases. Methods 36:321–331.
Bolanos-Garcia VM, Davies OR (2006). Structural analysis and classification of native
proteins from E. coli commonly co-purified by immobilised metal affinity chromatography.
Biochim Biophys Acta. 1760(9):1304-13.
Chatterjee, S., Senapati, P., and Kundu, T.K. (2012). Post-translational modifications of lysine
in DNA-damage repair. Essays in Biochemistry 52, 93-111.
Choi CH, Burton ZF, Usheva A (2004). Auto-acetylation of transcription factors as a control
mechanism in gene expression. Cell Cycle. 3(2):114-5.
Dieci G, Fiorino G, Castelnuovo M, Teichmann M, Pagano A (2007) The expanding RNA
polymerase III transcriptome. Trends Genet 23: 614–622
Donze D. (2012) Extra-transcriptional functions of RNA Polymerase III complexes: TFIIIC as
a potential global chromatin bookmark. Gene 493(2):169-75
Ducrot C, Lefebvre O, Landrieux E, Guirouilh-Barbat J, Sentenac A, Acker J (2006).
Reconstitution of the yeast RNA polymerase III transcription system with all recombinant
factors. J Biol Chem 281(17):11685-92.
All rights reserved. No reuse allowed without permission.
(which was not peer-reviewed) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
The copyright holder for this preprint. http://dx.doi.org/10.1101/513127doi: bioRxiv preprint first posted online Jan. 6, 2019;

Dutnall, R.N., Tafrov, S.T., Sternglanz, R., and Ramakrishnan, V. (1998). Structure of the
histone acetyltransferase Hat1: a paradigm for the GCN5-related N-acetyltransferase
superfamily. Cell 94, 427-438.
Hayes, J. J., and K. M. Lee. 1997. In vitro reconstitution and analysis of mononucleosomes
containing defined DNAs and proteins. Methods 12:2-9
Hornbeck, P.V., Kornhauser, J.M., Tkachev, S., Zhang, B., Skrzypek, E., Murray, B., Latham,
V., and Sullivan, M. (2012). PhosphoSitePlus: a comprehensive resource for investigating the
structure and function of experimentally determined post-translational modifications in man
and mouse. Nucleic acids research 40, D261-270.
Hsieh YJ, Kundu TK, Wang Z, Kovelman R, Roeder RG. (1999) The TFIIIC90 subunit of
TFIIIC interacts with multiple components of the RNA polymerase III machinery and contains
a histone-specific acetyltransferase activity. Mol Cell Biol. 19(11):7697-704.
Kouzarides, T. (2007). Chromatin modifications and their function. Cell 128, 693-705.
Kundu TK, Wang Z, Roeder RG. (1999) Human TFIIIC relieves chromatin-mediated
repression of RNA polymerase III transcription and contains an intrinsic histone
acetyltransferase activity. Mol Cell Biol. 19(2):1605-15.
Lagna G, Kovelman R, Sukegawa J, Roeder RG (1994). Cloning and characterization of an
evolutionarily divergent DNA-binding subunit of mammalian TFIIIC. Mol Cell Biol.
14(5):3053-64.
Lombardi PM, Cole KE, Dowling DP, Christianson DW. (2011) Structure, mechanism, and
inhibition of histone deacetylases and related metalloenzymes. Curr Opin Struct Biol.
21(6):735-43.
All rights reserved. No reuse allowed without permission.
(which was not peer-reviewed) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
The copyright holder for this preprint. http://dx.doi.org/10.1101/513127doi: bioRxiv preprint first posted online Jan. 6, 2019;

Mertens C, Roeder RG (2008). Different functional modes of p300 in activation of RNA
polymerase III transcription from chromatin templates. Mol Cell Biol. 28(18):5764-76.
Mizzen CA, Yang XJ, Kokubo T, Brownell JE, Bannister AJ, Owen-Hughes T, Workman J,
Wang L, Berger SL, Kouzarides T, Nakatani Y, Allis CD(1996) The TAF(II)250 subunit of
TFIID has histone acetyltransferase activity. Cell 87(7):1261-70.
Oettel S, Härtel F, Kober I, Iben S, Seifart KH (1997) Human transcription factors IIIC2 , IIIC1
and a novel component IIIC0 fulfil different aspects of DNA binding to various pol III genes.
Nucleic Acids Res. 25(12):2440-7.
Policarpi C, Crepaldi L, Brookes E, Nitarska J, French SM, CoAtti A, Riccio A. (2017)
Enhancer SINEs Link Pol III to Pol II Transcription in Neurons. Cell Rep. 21(10):2879-2894
Schramm L, Hernandez N (2002) Recruitment of RNA polymerase III to its target promoters.
Genes Dev 16(20):2593-620.
Shogren-Knaak, M., Ishii, H., Sun, J.M., Pazin, M.J., Davie, J.R., and Peterson, C.L. (2006).
Histone H4-K16 acetylation controls chromatin structure and protein interactions. Science 311,
844-847.
Sjölinder M, Björk P, Söderberg E, Sabri N, Farrants AK, Visa N (2005). The growing pre-
mRNA recruits actin and chromatin-modifying factors to transcriptionally active genes. Genes
Dev. 19(16):1871-84.
Thompson, P. R., Wang, D., Wang, L., Fulco, M., Pediconi, N., Zhang, D., An, W., Ge, Q.,
Roeder, R. G., Wong, J., Levrero, M.; Sartorelli, V., Cotter, R. J., Cole, P. A. (2004).
Regulation of the p300 HAT domain via a novel activation loop. Nat. Struct. Mol. Biol. 11,
308–315.
All rights reserved. No reuse allowed without permission.
(which was not peer-reviewed) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
The copyright holder for this preprint. http://dx.doi.org/10.1101/513127doi: bioRxiv preprint first posted online Jan. 6, 2019;

Torchia J, Glass C, Rosenfeld MG (1998). Co-activators and co-repressors in the integration
of transcriptional responses. Curr Opin Cell Biol.10(3):373-83
Van Bortle K, Corces VG. (2012) tDNA insulators and the emerging role of TFIIIC in genome
organization. Transcription 3(6):277-84
All rights reserved. No reuse allowed without permission.
(which was not peer-reviewed) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
The copyright holder for this preprint. http://dx.doi.org/10.1101/513127doi: bioRxiv preprint first posted online Jan. 6, 2019;