Content uploaded by Rusul Najm
Author content
All content in this area was uploaded by Rusul Najm on Aug 30, 2023
Content may be subject to copyright.
_____________________________________________________________________________________________________
++ M.Sc- Student, First Part of Thesis;
*Corresponding author: Email: rusul-na@gmail.com;
Uttar Pradesh J. Zool., vol. 44, no. 5, pp. 55-59, 2023
Uttar Pradesh Journal of Zoology
Volume 44, Issue 5, Page 55-59, 2023; Article no.UPJOZ.2486
ISSN: 0256-971X (P)
Phylogenetic Detection of Patho Genic
Escherichia coli Isolated from Different
Sources in Najaf Hospitals
Rusul Najm a++* and Jinan Mohammed a
a Department of Biology, College of Education for Girls, University of Kufa, Iraq.
Authors’ contributions
This work was carried out in collaboration between both authors. Authors RN and JM managed the
research. Authors RN and JM done the research and wrote the main manuscript text. Authors RN
and JM prepared tables and wrote a part of manuscript text. All authors read and approved the final
manuscript.
Article Information
DOI: 10.56557/UPJOZ/2023/v44i53442
Editor(s):
(1) Dr. P. Veera Muthumari, V. V. Vanniaperumal College for Women, India.
Reviewers:
(1) Grishma Kulkarni, Deccan College of Medical Sciences, India.
(2) Huda Zuheir Majeed, Mustansiriyah University, Iraq.
Received: 28/01/2023
Accepted: 30/03/2023
Published: 06/04/2023
ABSTRACT
The Aim :The training intended to quarantine bacteria Escherichia coli from urinary tract infection,
wound, burns patients and investigating the genes ChuA, yjaA, TspE4.C2 of the phylogenetic
groups.
Study Design: 100 samples were collected from patients with urinary tract infection, wounds and
burns, for a period from the twenty-seventh of July 2022 to the eleventh of December 2023, and
after diagnosing the samples in the laboratory by means of selective media, the addition of the
VITEK-2 compact.
Place and Duration of Study: All samples collected from July to December 2023. Samples were
cultured on a MacConkey and Eosin Methylene Blue agar (EMB) and VITEK2 compact.
Original Research Article
Najm and Mohammed; Uttar Pradesh J. Zool., vol. 44, no. 5, pp. 55-59, 2023; Article no.UPJOZ.2486
56
Methodology: A total of 100 sample from bacteria Escherichia coli sample Isolated from urine,
wounds, burns Collected from several hospitals in city of Najaf included (Al-Sadr Teaching Hospital,
Al-Najaf Teaching Hospital, Al-Furat Al-Awsat Hospital, Al-Hakim General Hospital, Al-Zahra
Teaching Hospital, Burns Center, Public Health Laboratory).
Results: The results showed that the incidence of urinary tract infection 91%, and wound was 7%,
while burns was 2%. the genes ChuA, yjaA, TspE4.C2 of the phylogenetic groups isolates were
investigated using the PCR technique.
Conclusion: they were classified into four groups according to the presence or absence of these
genes, so the results for group B1 was (44%), B2 (43%), D (12%), and A (1%).
Keywords: Genes; ChuA; yjaA; TspE4.C2; Escherichia coli.
1. INTRODUCTION
Escherichia coli belong to the family
Enterobacteriaceae, it is found as normal flora in
the intestines of mammals , negative gram’s
stain, facultative anaerobic, rod shaped, cause
many diseases such as urinary tract infection
(UTI), genital infection, wound infections,
respiratory infections ]1[. The genus
Escherichia
has species (E. coli, E. hermanii, E. blattae, E.
fergosonii, E. vuneris), and these species differ
among themselves in terms of biochemical
interactions, and the species E. coli is the most
common in causing diseases ]2[. Escherichia coli
is one of the most common isolates and
classified into three major groups, according to
their biological significance to humans, groups is
1- extraintestinal pathogenic strains 2- intestinal
pathogenic strains 3- commensal strains ]3[.
Commensal strains belong to phylogenetic
groups A or B1, while extraintestinal pathogenic
strains belong to phylogenetic groups B2 or D,
which possess more virulence factors than
commensal ]3[. Clermont and Colleagues
developed a triplex PCR assay to detect the
genes chuA, TspE4.C2, yjaA in 2000 ]4[.
Clermont and colleagues found 100% of the
ChuA gene present in group D and B2, the
function of this gene being heme-transporting in
E.coli O157:H7 and not found in group A
and B1 ]5 .[ and found the TspE4.C2 gene
present in group A and missing in
group B1, and the yjaA gene identified in The
beginning of the sequence E. coli K-12
which is found in group B2 and missing in group
D]4 [.
2. MATERIALS AND METHODS
2.1 Bacterial Strains
Overall of 100 sample from bacteria Escherichia
coli sample Isolated from urine, wounds, burns
Collected from several hospitals in city of Najaf
included (Al-Sadr Teaching Hospital, Al-Najaf
Teaching Hospital, Al-Furat Al-Awsat Hospital,
Al-Hakim General Hospital, Al-Zahra Teaching
Hospital, Burns Center, Public Health
Laboratory) collected from July to December
2023. Samples were cultured on a MacConkey
and Eosin Methylene Blue agar (EMB) and
VITEK2 compact, it is shown in Fig. 1.
Fig. 1. E. coli isolated on MacConkey and EMB agar
Najm and Mohammed; Uttar Pradesh J. Zool., vol. 44, no. 5, pp. 55-59, 2023; Article no.UPJOZ.2486
57
Table 1. primer sequences used in the study
Target gene
Primer sequence
Product size (bp)
References
TspE4.C2
GAGTAATGTCGGGGCATTCA F
CGCGCCAACAAAGTATTACG R
152
Clermont et
al., (2000)
YjaA
F TGAAGTGTCAGGAGACGCTG
ATGGAGAATGCGTTCCTCAAC R
211
ChuA
F GACGAACCAACGGTCAGGAT
R TGCCGCCAGTACCAAAGACA
279
2.2 Phylogenetic Detection
All isolates were assigned to one of the four main
E.coli phylogenetic groups (A, B1, B2, D) by use
of the multiplex PCR ]4[ . DNA was extracted for
all isolates by boiling method. phylogenetic
groups was determined by PCR using primers
TspE4.C2, YjaA, ChuA. Primer sequences are
shown in Table 1. PCR amplifications
under the following conditions: TspE4.C2 initial
denaturation at 93°C for 5 min and denaturation
93°C for 30 sec and annealing 54°C for 30 sec
and extention 72°C for 30 sec and cycles 35 and
final elongation 72 °C for 5 min. while yjaA initial
denaturation at 95 °C for 5 min and denaturation
95°C for 30 sec and annealing 56°C for 30 sec
and extention 72°C for 30 sec and cycles 35 and
final elongation 72°C for 5 min. ChuA initial
denaturation at 94°C for 5 min and denaturation
94°C for 30 sec and annealing 55°C for 30 sec
and extention 72 °C for 30 sec and cycles 35 and
final elongation 72°C for 5 min.
3. RESULTS
3.1 Distribution of Phylogenetic Groups
in Pathogenic and Commensal Strains
The distribution of phylogenetic groups isolates
from urine, wound and burns: B1(44%),
B2(43%), D(12%), A (1%), respectively, shown in
Fig. (2), Table (2). It found 100% of the ChuA
gene present in group D and B2, the function of
this gene being heme-transporting in E. coli
O157:H7 and not found in group A and B1 ]5
[.and found the TspE4.C2 gene present in group
A and missing in group B1, and the yjaA gene
identified in The beginning of the sequence E.coli
K-12 which is found in group B2 and missing in
group D., It is shown in Fig. (2).
Fig. 2. shows genes ChuA, yjaA, TspE4.C2
Table 2. phylogenetic groups of E.coli isolated from different sources
Phylogenetic groups
Urine
Wound
Burns
A
1%
0
0
B1
41%
1%
2%
B2
38%
5%
0
D
11%
1%
0
Najm and Mohammed; Uttar Pradesh J. Zool., vol. 44, no. 5, pp. 55-59, 2023; Article no.UPJOZ.2486
58
4. DISCUSSION
The current study showed, the percentage of
phylogenetic groups for infection with urinary
tract infection, wounds and burns, where the
percentage of group B1 (44%), followed by group
B2 (43%), then D (12%), and A (1%), and this
pattern is contradicts with Which was observed in
a previous study of pathogenic bacteria
Escherichia coli outside the intestine associated
with urinary tract infection of Russian females,
where the percentage of group A was (55%)
followed by B1 and D (23%), and there was no
isolate representing B1]6[. In previous studies,
the resistant bacteria Escherichia coli involved in
UTI showed a shift in evolution from group B2 to
group A ]7,8[. Some studies showed that group A
is dominant ]9,10,6 [ and there are other studies
that showed that group D is dominant ]11,12[.
And it contradicted with phylogenetic analyzes,
which showed that pathogenic strains outside the
intestine mostly belong to group B2 and less than
group D ]13,14,15[. This study agreed with
another study, where the percentage of group B1
was the highest, reaching 21% and lower the
group D and B2 ]16-22[.
5. CONCLUSION
The consequences exhibited that the incidence
of urinary tract infection 91%, and wound was
7%, while burns was 2%. The genes ChuA,
yjaA, TspE4.C2 of the phylogenetic groups
isolates were investigated using the PCR
technique. They were classified into four groups
according to the presence or absence of these
genes, so the results for group B1 was (44%), B2
(43%), D (12%), and A (1%)
CONSENT
As per international standard or university
standard, patients’ written consent has been
collected and preserved by the author(s).
ETHICAL APPROVAL
As per international standard or university
standard written ethical approval
has been collected and preserved by the
author(s).
COMPETING INTERESTS
Authors have declared that no competing
interests exist.
REFERENCES
1. Oliveira RV, Oliveira MC, Pelli A. Disease
Infection by Enterobacteriaceae Family in
Fishes: A Review. J Microbiol Exp.
2017;4(5):00128.
2. Olowe BM, Oluyege JO, Famurewa O,
Ogunniran AO, Adelegan O. (Molecular
Identification of Escherichia coli and New
Emerging Enteropathogen, Escherichia
fergusonii, from Drinking Water Sources in
Ado- Ekiti, Ekiti State, Nigeria. J Microbiol
Res. 2017;7(3):45-54.
3. Russo TA, Johnson JR. Proposal for a new
inclusive designation for extraintestinal
pathogenic isolates of Escherichia coli:
ExPEC. J Infect Dis. 2000;181:1753- 1754.
4. Clermont O, Bonacorsi S, Bingen E. Rapid
and simple determination of the
Escherichia coli phylogenetic group. Appl
Environ Microbiol. 2000;66:4555-4558.
5. King-sun Y. Epidemiology and Virulence
Characteristics of Multidrug Resistant -
Escherichia coli from Women with Acute
Uncomplicated Cystitis. Thesis. Master of
Philosophy, University of Hong Kong; 2007
6. Grude N, Potaturkina-Nesterova NI,
Jenkins A, et al. A comparison of
phylogenetic group, virulence factors and
antibiotic resistance in Russian and
Norwegian isolates of Escherichia coli from
urinary tract infection. Clin Microbiol Infect.
2007;13:208-211.
7. Skurnik D, Le Menac'h A, Zurakowski D, et
al. Integron-associated antibiotic
resistance and phylogenetic grouping of
Escherichia coli isolates from healthy
subjects free of recent antibiotic exposure.
Antimicrob Agents Chemother.
2005;49:3062-3065.
8. Mahmood NA, Jawad S. Preparation,
Spectral Characterization, Thermal Study,
and Antifungal Assay of (Formazane -
Mefenamic acid)- Derivatives., Egyptian
Journal of Chemistry. 2022;411 65(2).
DOI: 10.21608/EJCHEM.2021.88727.4266
9. Rijavec M, Starcic Erjavec M, Ambrozic
Avgustin J, et al. High prevalence of
multidrug resistance and random
distribution of mobile genetic elements
among uropathogenic Escherichia coli
(UPEC) of the four major phylogenetic
groups. Curr Microbiol. 2006;53:158-162.
10. Romanus II, Eze AT. Antibiotics
susceptibility patterns and clonal
relatedness of uropathogenic Escherichia
Najm and Mohammed; Uttar Pradesh J. Zool., vol. 44, no. 5, pp. 55-59, 2023; Article no.UPJOZ.2486
59
coli in Abakaliki, Ebonyi state. Canad J
Pure Appl Sci. 2011;5(2):1475–1479.
11. Derakhshandeh A, Firouzi R, Motamedifar
M, Arabshahi S, Novinrooz A, Boroojeni
AM, et al. Virulence characteristics and
antibiotic resistance patterns among
various phylogenetic groups of
Uropathogenic Escherichia coli isolates.
Jpn J. Infect Dis. 2015;68:428–431.
DOI: 10.7883/yoken.JJID.2014.327.
12. AL-Fatlawi HY, Jwad SM. Assessing the
level of a trial natriuretic peptide and some
biochemical parameters in men with type 2
diabetic nephropathy. Uttar Pradesh
Journal of Zoology. 2022;43(9):1-13.
13. Themphachana M, Kongpheng S,
Rattanachuay P, Khianngam S,
Singkhamanan K, Sukhumungoon P.
Molecular characterization of virulence and
antimicrobial susceptibility profiles of
uropathogenic Escherichia coli from
patients in a tertiary hospital, southern
Thailand. Southeast Asian J Trop Med
Public Health. 2016;46(6):1021–1030.
14. Hussein A. Detection of role the enzyme
adenosine deaminase in leishmaniasis as
biomarkers during of infection . Al-Salam
Journal for Biochemical and Medical
Science. 2022;1(2):9–18.
Available:https://doi.org/10.55145/ajbms.2
022.1.2.002
15. Gao Q, Zhang D, Ye Z, Zhu X, Yang W,
Dong L, et al. Virulence traits and
pathogenicity of uropathogenic Escherichia
coli isolates with common and
uncommonserotypes. Microb Pathog.
2017;104:217e224.
DOI: 10.1016/j.micpath.2017.01.027
16. Basu S, Mukherjee SK, Hazra A,
Mukherjee M. Molecular characterization
of uropathogenic Escherichia coli: nalidixic
acid and ciprofloxacin resistance,
virulent factors and phylogenetic
background, Journal of Clinical and
Diagnostic Research. 2013;7(12):2727–
2731.
17. Mahmood A M A, Mahmood SJ.
Estimation of the protective efficacy of the
alcoholic extract of Lepidium sativum
seeds on the level of erythropoietin and
some physiological parameters of albino
male rats dosed with acetaminophen.,
Uttar Pradesh Journal of Zoology. 2022;
43(7):42-51.
18. Raad M, Ahmed AH, Ahmed F.
Identification of MRSA (methicillin resistant
Staphylococcus aureus) by mecA gene.
Al-Salam Journal for Biochemical and
Medical Science. 2022;1(2):25–30.
Available:https://doi.org/10.55145/ajbms.2
022.1.2.004
19. Moreno E, Andreu A, Pigrau C, Kuskowski
MA, Johnson JR, Prats G. Relationship
between Escherichia coli strains causing
acute cystitis in women and the fecal E.
coli population of the host, Journal of
Clinical Microbiology. 2008;46(8):2529–
2534.
20. Nada AM, Younan MA. Dapagliflozin
improves cardiovascular risk factors in
Emirati patients with T2DM. Therapeutic
Advances in Endocrinology and
Metabolism. 2021;12: 2042018821995364
21. Takahashi S. Kanamaru, H. Kurazono et
al., “Escherichia coli isolates associated
with uncomplicated and complicated
cystitis and asymptomatic bacteriuria
possess similar phylogenies, virulence
genes, and O-serogroup profiles. Journal
of Clinical Microbiology. 2006;44(12):
4589–4592.
22. Mojaz-Dalfardi N, Kalantar-Neyestanaki D,
Hashemizadeh Z, Monsouri S.
Comparison of virulence genes and
phylogenetic groups of Escherichia coli
isolates from urinary tract infections and
normal fecal flora. Journal pre-proof; 2020.
© Copyright MB International Media and Publishing House. All rights reserved.
