Content uploaded by Ruijing Liu
Author content
All content in this area was uploaded by Ruijing Liu on Jun 23, 2022
Content may be subject to copyright.
Available via license: CC BY-NC-ND 4.0
Content may be subject to copyright.
Ecotoxicology and Environmental Safety 239 (2022) 113623
Available online 11 May 2022
0147-6513/© 2022 Published by Elsevier Inc. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Effects of Bisphenol A on reproductive toxicity and gut microbiota dysbiosis
in male rats
Ruijing Liu
a
, Dongbao Cai
b
, Xusheng Li
b
, Boping Liu
a
, Jiali Chen
b
, Xinwei Jiang
b
, Haiwei Li
b
,
Zhenhua Li
c
, Katja Teerds
d
, Jianxia Sun
e
, Weibin Bai
b
,
*
, Yulong Jin
a
,
**
a
Key Laboratory for Bio-Based Materials and Energy of Ministry of Education, College of Materials and Energy, South China Agricultural University, Guangzhou
510630, PR China
b
Department of Food Science and Engineering, Institute of Food Safety and Nutrition, Guangdong Engineering Technology Center of Food Safety Molecular Rapid
Detection, Jinan University, Guangzhou 510632, PR China
c
Zhuhai Precision Medical Center, Zhuhai People’s Hospital (Zhuhai Hospital Afliated with Jinan University), Jinan University, Zhuhai 519070, PR China
d
Department of Animal Sciences, Human and Animal Physiology, Wageningen University, Wageningen, The Netherlands
e
School of Chemical Engineering and Light Industry, Guangdong University of Technology, Guangzhou 510006, PR China
ARTICLE INFO
Edited by Dr Yong Liang
Keywords:
Bisphenol A
Male reproduction
Hormone
Mammalian target of rapamycin
Apoptosis
Gut microbiota
ABSTRACT
Bisphenol A (BPA) is an environmental endocrine disruptor. Recent studies have shown an association between
decreased spermatogenesis and gut microbiota alteration. However, the potential associations and mechanisms
of BPA exposure on spermatogenesis, hormone production, and gut microbiota remain unknown. This study aims
to investigate BPA-induced male reproductive toxicity and the potential link with gut microbiota dysbiosis. Male
Sprague Dawley rats were exposed to BPA at different doses by oral gavage for thirty consecutive days. The
extent of testicular damage was evaluated by basic parameters of body weight and hematoxylin-eosin (H&E)
staining. Next, we determined the mRNA levels and protein levels of apoptosis, histone-related factors, and
mammalian target of rapamycin (mTOR) pathway in testes. Finally, 16 S rDNA sequencing was used to analyze
gut microbiota composition after BPA exposure. BPA exposure damaged testicular histology, signicantly
decreased sperm count, and increased sperm abnormalities. In addition, BPA exposure caused oxidative stress
and cell apoptosis in testes. The levels of histone (H2A, H3) were signicantly increased, while ubiquitin histone
H2A (ub-H2A) and ubiquitin histone H2B (ub-H2B) were markedly reduced. Furthermore, BPA activated the
PI3K and AKT expression, but the protein expressions of mTOR and 4EBP1 in testes were inhibited signicantly.
Additionally, the relative abundance of class Gammaproteobacteria, and order Betaproteobacteriales was
signicantly higher when treated with a high dose of BPA compared to the control group, which was negatively
correlated with testosterone level. This study highlights the relationship between BPA-induced reproductive
toxicity and gut microbiota disorder and provides new insights into the prevention and treatment of BPA-induced
reproductive damage.
Abbreviations: BPA, Bisphenol A; NOAEL, No observed adverse effect level; LOAEL, Lowest observed adverse effect level; PI3K, Phosphoinositide 3-kinase; mTOR,
Mammalian target of rapamycin; 4EBP1, 4E-binding protein 1; EDC, Endocrine-disrupting chemical; LH, Luteinizing hormone; FSH, Follicle-stimulating hormone;
DHT, Dihydrotestosterone; INHB, Inhibin B; E2, Estradiol; GnRH, Gonadotrophin-releasing hormone; HPG, Hypothalamic-pituitary-gonadal; EE, Ethinyl estradiol;
Bax, Bcl-2-associated X protein; Bcl-2, B-cell lymphoma 2; TUNEL, Terminal deoxynucleotidyl transferase-mediated nick end labeling; eIF4E, Eukaryotic translation
initiation factor 4E; PARP, Poly (ADP-ribose) polymerase; Raptor, Regulatory-associated protein of mTOR; SOD, Superoxide dismutase; GSH, Glutathione; CAT,
Catalase; MDA, Malondialdehyde; GPR54, G protein-coupled receptor 54; BTB, Blood-testis barrier.
* Correspondence to: Department of Food Science and Engineering, Institute of Food Safety and Nutrition, Jinan University, 601 Huangpu Rd, Guangzhou 510632,
PR China.
** Corresponding author.
E-mail addresses: baiweibin@163.com (W. Bai), jyl@scau.edu.cn (Y. Jin).
Contents lists available at ScienceDirect
Ecotoxicology and Environmental Safety
journal homepage: www.elsevier.com/locate/ecoenv
https://doi.org/10.1016/j.ecoenv.2022.113623
Received 12 March 2022; Received in revised form 23 April 2022; Accepted 7 May 2022
Ecotoxicology and Environmental Safety 239 (2022) 113623
2
1. Introduction
Bisphenol A (BPA), a known endocrine-disrupting chemical (EDC)
with estrogenic activity, is a synthetic chemical that is found in large
quantities in the environment (Liu et al., 2021b; Molina et al., 2018). It
is widely used to produce polycarbonate plastics, epoxy resin liners for
food cans, water bottles, some dental sealants and composites, thermal
receipts, and other applications (Ehrlich et al., 2014). BPA can migrate
into the water and food under conditions such as high temperature,
acidity, and alkalinity (Vandenberg et al., 2009). The routes of human
exposure to BPA are various including inhalation (dust, occupational
sources) and dermal contact (household products, cosmetics, medical
devices) (Cho et al., 2012; Demierre et al., 2012; Buckley et al., 2019).
Data from a national survey showed that about 90% of the general
population in Canada had detectable urinary BPA levels (>0.2 ng/mL)
(Health Canada, 2015), and in the US this percentage is even higher
(92.6%) (Calafat et al., 2008). BPA exposure is associated with a variety
of health problems, especially male reproductive disorders. Sing et al.
reported a reduction in the percentage of live sperm and a concomitant
increase in the percentage of dead sperm after exposure to different
doses of BPA (Singh et al., 2015). Analysis of testicular histology
revealed that in ICR mice pups postnatal BPA exposure led to a block in
the progression of meiosis and an increase in germ cell apoptosis during
the rst wave of spermatogenesis (Xie et al., 2016). Moreover, paternal
BPA exposure in CD-1 mice affected spermatogenesis by decreasing the
number stage of VIII seminiferous epithelial cells, causing a decline in
total sperm counts and sperm motility in the F1 offspring (Rahman and
Pang, 2019).
In males, spermatogenesis is a highly complicated process involving
mitosis of spermatogonia, meiosis of spermatocytes, and the differenti-
ation of round spermatids into mature sperm (Liu et al., 2021a). The
main regulators of spermatogenesis are the gonadotropic hormones
luteinizing hormone (LH) and follicle-stimulating hormone (FSH) which
are released by the pituitary in response to the hypothalamic derived
releasing neurohormone gonadotrophin-releasing hormone (GnRH)
(Corradi et al., 2016; Qiu et al., 2018). Furthermore, testosterone syn-
thesis in Leydig cells was mainly controlled by luteinizing hormone
(LH), which together with FSH regulates Sertoli cell function and the
normal progression of spermatogenesis within the seminiferous tubules
(Spaziani et al., 2021). Kisspeptin neurons in the hypothalamus act to
regulate the activity of GnRH neurons and thus, in turn, the downstream
hypothalamic-pituitary-gonadal (HPG) endocrine axis (Abbara et al.,
2021). The GnRH neurons in the hypothalamus are however not directly
able to respond to uctuations in circulating testosterone levels but
respond to changes in kisspeptin release, a neurotransmitter that binds
to the GPR54 receptor on the GnRH neurons. Kisspeptin is produced by
the kisspeptin neurons in the hypothalamus which express androgen
receptors and thus can respond via a negative feedback mechanism, to
changes in circulating testosterone levels (Poling and Kauffman, 2013).
BPA was able to bind androgen receptors (AR) and acted as an androgen
antagonist to block the effect of endogenous androgens, thereby
affecting the transmission of hormone signals in target cells, tissues, and
organs, resulting in the corresponding biological effects, and then
causing dysfunction of the reproductive system of the body (Murata and
Kang, 2018).
In addition, the histone-to-protamine exchange is the rst step dur-
ing post-meiotic male germ cell development, when haploid round
spermatids elongate and transform into spermatozoa. The failure of
histone-to-protamine exchange may contribute to male sterility (Gou
et al., 2017). The mammalian target of rapamycin (mTOR), belonging to
the phosphatidylinositol kinase-related kinase family, is a
serine-threonine protein kinase that is regulated by proline (Xu et al.,
2016). Activation of the phosphoinositide 3-kinase/protein kinase
B/mTOR (PI3K/AKT/mTOR) signaling pathway initiates the efcient
translation of mRNAs required for spermatogonial differentiation. At
present, studies investigating the impact of this pathway on testicular
function are numerous (Gao et al., 2020; Kong et al., 2021; Ni et al.,
2021; Fu et al., 2020).
The intestinal microbiota is a complex ecosystem in humans and
animals, and it has been found to play an important role in controlling
host health. Modulation of the intricate relationship between the host
and microbiome can result in many diseases such as cancer, metabolic,
cardiovascular, immune, and neurobehavioral disorders (Diamante
et al., 2021). Some exogenous compounds can disrupt gut microbiota
composition and induce negative health effects (Zhan et al., 2020).
Low-dose exposures to diethyl phthalate, methylparaben, and triclosan
decreased the body weight of adolescent rats, which coincides with a
decrease in the Firmicutes/Bacteroidetes ratio (Hu et al., 2016). More-
over, BPA is likely to inuence organisms via changes in microbial
companions. A previous study showed that exposure to BPA increased
the abundance of Lactobacilllus, Alcaligenes, and Mycobacterium in the
colon (Wang et al., 2018). Dietary exposure to BPA similarly altered the
gut microbiota composition as the intake of a diet high in fat and sucrose
does (Lai et al., 2016). In addition, BPA and ethinyl estradiol (EE) at
doses that have previously been shown to disturb behavior and meta-
bolism in F1 California mice offspring also led to generational and
sex-dependent changes in the gut microbiome (Javurek et al., 2016).
Despite the growing number of researches, the underlying mecha-
nisms between BPA-induced reproductive toxicity and gut microbiota
are still limited. Therefore, this study aimed to explore the potential link
between BPA-induced intestinal ora disturbance and reproductive
toxicity, further provided new insight into the comprehensive under-
standing of the mechanism of reproductive toxicity of BPA.
2. Materials and methods
2.1. Animals and experimental design
Male Sprague-Dawley rats (3–4weeks) were obtained from Beijing
HFK Bioscience Co., LTD. The animals were housed under temperature
(22–25 ◦C) and humidity (40%–60%) controlled conditions with a 12 h
light/dark cycle. Rats had ad libitum access to chow and water. BPA
(analytical purity≥99%, CAS: 80–05–7) was purchased from Sigma-
Aldrich (St. Louis, Missouri, US). After a 7-day adaptation period, the
rats were randomly divided into four groups (8 rats/group) and treated
as follows: control group (corn oil only), BPA-low (BPA-L), -medium
(-M), and -high (-H) group (30, 90, and 270 mg/kg⋅bw BPA dissolved in
corn oil, respectively).
The no observed adverse effect level (NOAEL) and the lowest
observable adverse effect level (LOAEL) of BPA were 5 mg/kg⋅bw and
50 mg/kg⋅bw, respectively. Here, we chose the “low dose” of BPA ≤50
mg/kg⋅bw, and the “medium and high-dose” of BPA is the using con-
centrations >50 mg/kg bw referring to previous literature (Adegoke
et al., 2022; Peretz et al., 2014). BPA was provided to the rats by daily
oral gavage for 30 days. The animal experiment was approved by the
Animal Care and Protection Committee of Jinan University (Approval
No. IACUC-20201027–12) and was performed by the US NIH Guide for
the Care and Use of Laboratory Animals (No. 8023, revised in 1978).
At the end of the experiment, all animals were anesthetized by
pentobarbital and sacriced. Blood was collected from the abdominal
aorta for further analysis. The testis and epididymis were quickly
removed and weighed. The left testis was snap-frozen and stored at −
80 ◦C until further analysis. The right testis and epididymis were xed in
modied Davidson’s uid (Scientic Phygene) and 4% para-
formaldehyde respectively for further histological analysis. The hypo-
thalamus and pituitary were collected, frozen on dry ice, and stored at −
80 ◦C for RT-qPCR analysis. The testis and epididymis coefcients were
calculated in the following way:
testis coefficient =testis weight(g)
body weight(g)×100%
R. Liu et al.
Ecotoxicology and Environmental Safety 239 (2022) 113623
3
epididymis coefficient =epididymis weight(g)
body weight(g)×100%
2.2. Sperm analysis
The left cauda epididymis was used for the evaluation of sperm pa-
rameters. The cauda epididymis was trimmed of residual adipose tissue,
and then put into a culture dish with 10 mL preheated normal saline
(37 ◦C), cut into small pieces to release the stored sperm, and kept at a
temperature of 37 ◦C for 2 min. After that, 10
μ
L sperm suspension was
subjected to analyze the sperm count, and sperm morphology analysis
using a computer-aided semen analysis system (CASA, mL-608ZII, Song
Jing Tian Lun Biotechnology Co., Ltd.). At least 30 different elds were
analyzed for each sample.
2.3. Determination of oxidative stress in serum and testis
To determine oxidative stress in testis tissue, 0.1 g testis tissue, 10%
(w/v) was homogenized in PBS buffer (pH 7.4). The homogenate was
centrifuged at 1520g for 20 min after which the supernatant was
collected. The assay kits for the detection of superoxide dismutase
(SOD), glutathione (GSH), catalase (CAT), and malondialdehyde (MDA)
were purchased from Nanjing Jiancheng Bioengineering Institute. The
protein concentration of the testis samples was determined by bicin-
choninic acid (BCA) protein assay kit (Applygen Technologies Inc.,
China).
2.4. Histological and immunohistochemical analysis of testis and
epididymis
The left testes and epididymides were xed for 24 h at room tem-
perature, dehydrated in graded ethanol and xylene, and embedded in
parafn. The embedded tissues were cut into 4 µm thick sections and
stained with hematoxylin-eosin (H&E).
Immunohistochemical analysis of mTOR was performed as described
previously (Jiang et al., 2018). In brief, tissue sections were deparaf-
nized after which antigen retrieval in citrate buffer (pH 6.0) was per-
formed. The next sections were blocked with 3% hydrogen peroxide in
methanol for 15 min at room temperature to block endogenous perox-
idase activity and washed three times in phosphate-buffered saline (PBS)
(pH 7.4). After blocking the nonspecic sites with 3% BSA, PI3K (1:200,
Cat# 20584–1-AP, Proteintech), p-AKT (1:250, Cat# ab81283, Abcam),
and mTOR (1:1000, Cat# 66888–1-Ig, Proteintech) primary antibodies
were applied to the separate sections, and slides were kept overnight at
4◦C respectively. Subsequently, sections were incubated with the sec-
ondary antibody for 50 min, followed by DAB staining, and counter-
staining with hematoxylin for 3 min mTOR labeling was examined by a
microscope (NIKON ECLIPSE E100, Japan) equipped with an imaging
system (NIKON DS-U3). To evaluate the amount of cell staining, the
images were analyzed using an image analysis software (Image Pro-Plus
6.0, Media Cybernetics, MD, U.S.A.).
2.5. Determination of hormone levels
Dihydrotestosterone (DHT), FSH, LH, estradiol (E2), inhibin B
(INHB), testosterone, and testicular fructose levels were measured in
serum, while GnRH content was measured in hypothalamic tissue ho-
mogenates, using enzyme-linked immunosorbent assay (ELISA) kits. The
ELISA kits for GnRH, DHT, FSH, LH, E2, and INHB were purchased from
Jiang Lai Biotechnology Co., Ltd. (Shanghai, China). The ELISA kits for
testosterone and fructose were purchased from Cusabio (Wuhan, China)
and Nanjing Jiancheng Bioengineering Institute (Nanjing, China),
respectively. All procedures were carried out according to the manu-
facturers’ instructions.
2.6. Determination of apoptosis rate in testes
Apoptosis of cells in testicular sections was detected using a terminal-
deoxynucleotidyl transferase-mediated nick end labeling (TUNEL)
staining following the manufacturer’s protocols of the assay kit from
Beyotime Biotech (Shanghai, China).
2.7. Quantication of mRNA expression
Total RNA from the hypothalamus and testis was extracted using
TRIzol reagent (Beyotime Institute of Biotechnology, China) following
the manufacturer’s protocol. The cDNA used for quantitative RT-PCR
was synthesized using the Evo M-MLV RT Kit with gDNA Clean for
qPCR II AG11711 (Accurate Biotechnology [Hunan] Co., Ltd, China).
RT-PCR reactions were carried out employing the Applied Biosystems
QuantStudio 6 using the SYBR® Green Premix Pro Taq HS qPCR Kit
AG11701 (Accurate Biotechnology [Hunan] Co., Ltd, China) according
to the following procedure: initial temperature of 95 ◦C for 30 s, fol-
lowed by 5 s at 95 ◦C (45 cycles) for denaturation and annealing at 55 ◦C
for 30 s. The primers were synthesized by Shanghai Sangon Biological
Engineering Co., Ltd (Guangzhou synthesis department). Relative
mRNA expression levels were calculated using the 2
-ΔΔCT
method and
were normalized with β-actin. The primers sequences used are listed in
Table 1.
2.8. Protein expression analysis
Protein extraction and western blot analysis were performed as
previously described (Li et al., 2020). In brief, the testis tissues were
homogenized in RIPA buffer (Beyotime, China) supplemented with
protease inhibitors and phenylmethanesulfonyl uoride (PMSF), fol-
lowed by centrifugation at 14,000g for 10 min at 4 ◦C after which the
supernatant was collected. The BCA protein assay kit was used to
determine the protein content of the samples. Equal amounts of protein
(20
μ
g) were separated by 8–12% sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred
onto polyvinylidene diuoride (PVDF) membranes. Membranes were
blocked with 5% skimmed milk at room temperature for 1.5 h and
incubated with the primary antibodies overnight at 4 ◦C. The primary
antibodies Bax (1:500, Cat# AF1020), Bcl-2 (1:500, Cat# AF6139),
eIF4E (1:500, Cat# AF6110), FAS (1:500, Cat# AF5342), FASL (1:500,
Cat# AF0157), Histone H4 (1:500, Cat# AF6355), and β-actin (1:5000,
Cat# T0022) were acquired from Afnity Biosciences (USA). Histone
H2A (1:5000, Cat# ab177308), Histone H2B (1:1000, Cat# ab52484),
Histone H3 (1:1000, Cat# ab176882), and phospho-AKT (1:5000, Cat#
ab81283) was purchased from Abcam (Cambridge, UK). Cleaved-PARP
(1:1000, Cat# 94885 S), PARP (1:1000, Cat# 9532 T), ub-H2A (1:2000,
Cat# 8240 T), ub-H2B (1:1000, Cat# 5546 T), and were obtained from
Cell Signaling Technology (Massachusetts, USA). mTOR (1:5000, Cat#
66888–1-Ig), Raptor (1:500, Cat# 20984–1-AP), AKT (1:1000, Cat#
10176–2-AP), and PI3K (1:500, Cat# 20584–1-AP) were purchased from
Table 1
Primers used for RT-PCR.
Genes Sequences (5’-3’) Accession No.
Kiss-1 Forward: TGCTGCTTCTCCTCTGTGTG NM_181692.1
Reverse: CCAGGCATTAACGAGTTCCT
Gpr54 Forward: GGAACTCACTGGTCATCTTCGT NM_023992.2
Reverse: GTACGCAGCACAGAAGGAAAGT
P13k Forward: GATGTCTGCGTTAGGGCTTACC NM_001371300.2
Reverse: TCAGCATCATGGAGAACAGGAT
Akt1 Forward: CTCATTCCAGACCCACGAC NM_033230.3
Reverse: ACAGCCCGAAGTCCGTTA
mtor Forward: AGCCGTTGTTGCAGAGACTT NM_019906.2
Reverse: CATGGTTCATGGTGTCTTGC
β-actin Forward: CCCATCTATGAGGGTTACGC NM_031144.3
Reverse: TTTAATGTCACGCACGATTTC
R. Liu et al.
Ecotoxicology and Environmental Safety 239 (2022) 113623
4
Proteintech (Wuhan, China). Then it was followed by incubation with
goat anti-rabbit IgG-HRP (1:2000, Cat# 98164 S) (Cell Signaling Tech-
nology, USA) or anti-mouse IgG-HRP (1:5000, Cat# 91196 S) (Pro-
teintech, Wuhan, China) at room temperature for 1 h, as described
previously (Jiang et al., 2018). ECL reagent was applied to visualize the
bands by the Clinx ChemiScope system (Shanghai, China).
2.9. Gut microbiota analysis by 16S rRNA gene sequencing
Fecal samples were after collection stored at −80 ◦C until further
processing. Total DNA was extracted from the fecal samples using the
MagPure Soil DNA LQ Kit (Magen, China) according to the manufac-
turer’s instructions. DNA concentration and quality were assessed by
NanoDrop 2000 spectrophotometry (Thermo Fisher Scientic, USA) and
agarose gel electrophoresis, respectively. For bacterial diversity anal-
ysis, the V3-V4 variable region of the 16 S rRNA genes was amplied
using the universal primers 338 F (5′-ACTCCTACGGGAGGCAGCA-3′)
and 806 R (5′-GGACTACHVGGGTWTCTAAT-3′). Amplicon quality was
visualized using gel electrophoresis. The PCR products were puried
using Agencourt AMPure XP beads (Beckman Coulter Co., USA) and
quantied using the Qubit dsDNA assay kit (Life Technologies, USA).
Puried amplicons were pooled in equimolar concentrations.
Sequencing was performed on the Illumina NovaSeq 6000 sequencing
platform with the paired-end read of 2 ×250 cycles according to stan-
dard protocols (Illumina Inc., San Diego, CA; OE Biotech Company;
Shanghai, China).
For bioinformatic analysis paired-end reads were assembled using
FLASH (FLASH: fast length adjustment of short reads to improve genome
assemblies). Further processing of paired-end reads including quality
ltering, removal of mismatched barcodes, and sequences were
completed using QIIME version 1.8.0. Clean reads were subjected to
primer sequence removal and clustering to generate operational taxo-
nomic units (OTUs) using Vsearch software with a 97% similarity cutoff.
All representative reads were annotated and blasted against Silva
database Version 132.
2.10. Statistical analysis
Statistical analyses were conducted using SPSS 23.0 (SPSS Inc.,
Chicago, USA). GraphPad Prism software, version 8.0 (San Diego, USA)
and Origin, version 9.1 (OriginLab Corp., Northampton, MA) were used
for gure design. A signicant difference was determined by one-way
Fig. 1. Effects of BPA exposure on sperm quality, and oxidative stress in SD rats. (A) Body weight change. (B) Testis weight. (C) Epididymis weight. (D) Testis
coefcient. (E) Epididymis coefcient. Sperm quality and morphology were analyzed by CASA. (F) Sperm counts. (G) Sperm abnormality. (H) Representative ex-
amples of sperm morphology. Abnormalities characterized by deformed or absent head (black arrows) and docked tail (black triangle) are seen in rats. (I) The levels
of superoxide dismutase activity (SOD), glutathione (GSH), catalase activity (CAT), and malondialdehyde (MDA) in rat serum. (J) The levels of SOD, GSH, CAT, and
MDA in rat testes. Data are expressed as mean ±SD (n =8). Bars with different letters represent a signicant difference between groups (P<0.05).
R. Liu et al.
Ecotoxicology and Environmental Safety 239 (2022) 113623
5
analysis of variance (ANOVA), and the differences between the two
groups were analyzed by the Bonferroni post hoc test. Values were
considered to be signicantly different when P<0.05.
3. Results
3.1. Effects of BPA exposure on anthropomorphic parameters and sperm
quality
Exposure to BPA led to a lower increase in the body weight of the rats
over time when compared to the control animals (Fig. 1A). Body, testis,
and epididymis weights and the coefcients of testes and epididymides
were however not signicantly affected by BPA treatment (Fig. 1B-E).
Exposure to the high dose of BPA (BPA-H) notably decreased total sperm
count compared with the controls (P<0.05) (Fig. 1F, and H).
Concomitantly, the sperm malformation ratio was signicantly
increased in the BPA-M, and BPA-H groups, characterized by the
headless and tail-docking sperm (P<0.05) (Fig. 1G).
3.2. Effects of BPA exposure on serum and testicular oxidative stress
markers
To elucidate the presence of oxidative stress induced by BPA expo-
sure, the levels of MDA and antioxidant markers SOD, GSH, and CAT
were measured in rat serum and testis tissue homogenates. A signicant
decrease in serum SOD and CAT levels was observed in rats of the BPA-H
group compared to the controls (P<0.05) (Fig. 1I). GSH level was
signicantly decreased in the BPA-M group (P<0.05) (Fig. 1I), while
MDA content in serum and testis was higher in the BPA-M and BPA-H
groups when compared to the control animals (P<0.05) (Fig. 1I, J).
As shown in Fig. 1J, exposure to BPA had no signicant effects on the
testicular levels of SOD and CAT, while a signicant decrease in GSH
level was observed in testis tissue in the BPA-M and BPA-H groups.
3.3. Effects of BPA exposure on testis and epididymis histology
As shown in Fig. 2A, the testis tissue showed a regular arrangement
of different stages of germ cells in the seminiferous tubules of the control
group in rats. Sertoli cells and spermatogonia were located on intact
basement membranes. The slides from BPA-treated groups showed
disorganization of the germinal epithelial layers of the seminiferous
tubules. In the BPA-exposed groups, some seminiferous tubules showed
mild atrophy as evidenced by the presence of vacuoles between the germ
cells, while the interstitial space seemed enlarged. Maturation of sperm
largely occurs in the epididymis; in the cauda epididymis, the sperm
acquires motility. Fig. 2A gives the impression that sperm numbers are
reduced in the BPA-M and BPA-H treated animals when compared to the
controls, which is conrmed for the BPA-H group by the total sperm
count shown in Fig. 1F.
3.4. Effects of BPA exposure on hormone levels
In this study, medium and high dosages of BPA administration
signicantly upregulated hypothalamic Kiss1 mRNA expression
(P<0.05) (Fig. 2B). However, Fig. 2C revealed that there was a sig-
nicant decrease in GPR54 mRNA expression in low and high groups.
GnRH protein content in the hypothalamus was also signicantly higher
in the BPA-treated rats compared to the control group (Fig. 2D). Serum
testosterone levels were reduced in the BPA-M and BPA-H groups
compared to the untreated controls (P<0.05) (Fig. 2E). Similarly,
serum INHB level was signicantly decreased in the BPA-H group
(P<0.05) (Fig. 2I), while FSH and DHT levels were signicantly
Fig. 2. Effects of BPA exposure on histology of testis and epididymis, and hormone levels. (A) Testis and epididymis. From left to right: control, BPA-L, BPA-M, BPA-
H. Bar represents 50 µm and 100 µm, respectively. RT-PCR analyses of the mRNA levels of (B) Kiss-1, and (C) Gpr54 in the hypothalamus. (D) GnRH protein content in
the hypothalamus. The levels of (E) testosterone, (F) E2, (G) luteinizing hormone (LH), (H) follicle-stimulating hormone (FSH), (I) inhibin B (INHB), and (J)
dihydrotestosterone (DHT) in rat serum was measured by ELISA. Data are expressed as mean ±SD (n =8). Different letters represent a signicant difference between
groups (P<0.05).
R. Liu et al.
Ecotoxicology and Environmental Safety 239 (2022) 113623
6
elevated in the BPA-M and BPA-H groups (P<0.05) (Fig. 2H, J). There
was no signicant difference in E2 and LH levels among the different
groups.
3.5. Effects of BPA exposure on PI3K/AKT/mTOR pathway in testis
To determine whether chronic BPA administration affects the PI3K/
AKT/mTOR signaling pathway and in this way affects testis function, we
investigated the relative expressions of key proteins and genes in this
pathway by Western blotting and RT-PCR. As shown in Fig. 3A-C,
exposure to BPA had no signicant effect on the gene expression of Pi3k,
Akt, and mtor. However, the protein levels of the PI3K in the high-dose
group were signicantly escalated in testis (P<0.05) (Fig. 3D), as well
as the level of p-AKT in medium and high dosage groups (P<0.05)
(Fig. 3F). Accordingly, the expression of PI3K and p-AKT determined by
immunohistochemically staining were upregulated in BPA-treated
groups. Moreover, we evaluated the localization of mTOR in the testis
by immunohistochemistry. mTOR expression in rat testicular tissue was
seen in Sertoli cells, spermatogonia, spermatocytes, and some Leydig
cells. The protein level of mTOR was signicantly increased in the
testicular after being treated with medium and high dosage BPA
compared with the control group (Fig. 3L). The protein expression of the
Raptor was increased in the BPA-H group compared to the control group
(P<0.01) (Fig. 3I). Interestingly, the protein expression of 4EBP1 was
signicantly reduced in the BPA-M and BPA-H groups compared to the
group (P<0.05) (Fig. 3J), while the protein level of eIF4E was signi-
cantly increased (Fig. 3K).
3.6. Effects of BPA exposure on apoptosis in testes
Apoptosis is one of the main forms of cell death in which mito-
chondria play a key role. To explore whether chronic BPA exposure
leads to an increase in testicular apoptosis, we examined the expression
of apoptosis-related proteins by western blot. As illustrated in Fig. 4A-G,
a signicant increase was observed in cleaved-PARP/PARP, FAS, and
Caspase3 levels after exposure to the high dosage of BPA. No signicant
difference was observed in the levels of FASL, Bax, and Bcl-2 compared
to the control group (P<0.05) (Fig. 4C, F, and G). In addition, apoptotic
cells in the testes section were subsequently detected by TUNEL staining.
As shown in Fig. 4H, BPA-induced apoptosis occurs in both Leydig cells
and germ cells which is characterized by spermatogonia and sper-
matocytes compared to the control. These results indicated that BPA
treatment may increase the incidence of apoptosis to some extent.
3.7. Effects of BPA exposure on histone ubiquitination in testes
To comprehend the expression of H2A, H2B, ub-H2A, ub-H2B, H3,
and H4 in the testes, western blotting was applied to observe the ex-
pressions of these parameters in rats from different groups. H2A and H3
expressions were higher in the medium and high groups (P<0.05,
P<0.01) (Fig. 5A, B, and F), while ubiquitin histone H2A (ub-H2A) and
ubiquitin histone H2B (ub-H2B) was markedly reduced in BPA-exposure
groups compared with the control group (Fig. 5A, D, and E). There was
no signicance in the H2B and H4 protein expressions (Fig. 5C, G).
3.8. Effects of BPA exposure on gut microbiota composition
To determine whether BPA treatment affects gut microbiota
composition, we analyzed the 16S rRNA gene sequence of the micro-
biota. Generally,
α
-diversity reects the abundance of the gut micro-
biota, and β-diversity is used to evaluate the community similarity and
diversity of different groups. As shown in Fig. 6A, the PCA reecting the
β-diversity showed an obvious separation among the groups, which
means that the intestinal microbiota composition changed signicantly
after treatment with BPA. The BPA-M and BPA-H groups exhibited
signicantly lower Chao1 and higher goods coverage (P<0.05,
P<0.01) (Fig. 6B, C). Shannon (Fig. 6D) showed a downward trend in
medium and high groups, implying that BPA exposure may lead to lower
intestinal microbiota diversity. The composition of gut microbiota
among the groups at the phylum, class, order, and family levels is shown
in Fig. 6E-H. At the phylum level, the main gut microbiota were Bac-
teroidetes (66.21% vs 73.96% vs 71.71% vs 63.3%), Firmicutes (26.23%
vs 22.65% vs 23.26% vs 29.06%), Proteobacteria (2.48% vs 2.26%
vs2.63% vs 4.90%), and Epsilonbacteraeota (4.47% vs 0.5% vs 1.71% vs
1.85%) in Control, BPA-L, M, and H groups, respectively. The relative
abundance of class Campylobacteria were 4.45%, 0.6%, 1.69%, and
1.80%, whereas Gammaproteobacteria were 0.83%, 1.23%, 1.81%, and
3.97% in Control, BPA-L, M, and H groups, respectively (Fig. 6F). At the
order level, the BPA-L group showed a lower abundance of Campylo-
bacterales (0.48%) compared to the control rats (4.37%). In addition, the
relative abundance of Betaproteobacteriales was increased in the BPA-H
group (2.32%) compared to the control rats (0.63%) (Fig. 6G). How-
ever, there was no signicant difference in the main microbiota at the
family level among groups.
3.9. Correlations between the intestinal microbiota and hormone
parameters
To conrm the signicant differences in microbiota composition and
identify biomarkers in intestinal microbiota among the treatment
groups, we applied LEfSe, an algorithm for microbial marker detection.
As depicted in Fig. 7A and B, the differential enrichment of specic
bacteria was shown in both cladograms and histograms based on an LDA
score >3. For the control group, the genus Prevotellaceae_Ga6A1_group,
and genus Lachnospiraceae_NK4A136_group were the dominant micro-
biota, while the genus Alloprevotella, genus uncultured_organism, and
genus Prevotellaceae_UCG_001 appeared to be dominant in the BPA-M
group. The LEfSe histogram showed further that the BPA-H group con-
tained the largest number of bacterial taxa, suggesting that the BPA
effect on the bacterial community composition mainly depended on the
doses. Furthermore, we observed that the relative abundance of the class
Gammaproteobacteria and the genus Parasutterella, family Burkholder-
iaceae, order Enterobacteriales were signicantly higher in the BPA-H
group than in the control group, suggesting that these may serve as
taxonomic biomarkers.
The correlation analysis with a heatmap indicated that the relative
abundance of several key intestinal microbial phylotypes was signi-
cantly correlated with the reproductive hormones.
Parameters (Fig. 7C). Fusicatenibacter was notably positively corre-
lated with serum DHT, E2 levels, and kiss-1 expression in the hypo-
thalamus, while a negative correlation was observed with testosterone
levels. Desulfovibrio, Ruminiclostridium, Acetatifactor, Rikenella, and
Ruminiclostridium_5 were negatively correlated with serum FSH, LH,
DHT, and E2 levels, and kiss-1 expression in the hypothalamus, and
positively correlated with serum INHB and testosterone levels, GnRH
protein level and Gpr54 gene expression in the hypothalamus. Overall,
most of the bacterial genera of composition were altered by BPA
administration and exhibited strong correlations with hormones.
4. Discussion
Reports have demonstrated that BPA is a part of many aspects of
daily living, as a variety of common consumer goods ranging from water
bottles, dinner plates, and CDs (Wang et al., 2014). BPA can disrupt the
endocrine function related to hormone levels due to its estrogenic and
antiandrogenic activity and is known to affect male fertility (Cariati
et al., 2019). Although the effect of BPA on the testis has been studied,
whether BPA-induced male reproductive toxicity is associated with the
alteration of gut microbiota has remained largely unknown. In the
present study, in vivo experiment with multiple dimensions analysis was
conducted to elucidate the potential mechanism of BPA exposure on the
reproductive system in male rats.
R. Liu et al.
Ecotoxicology and Environmental Safety 239 (2022) 113623
7
Fig. 3. Effects of BPA exposure on PI3K/AKT/mTOR pathway in testis (A-C) The mRNA expression levels of Pi3k, Akt1, and mtor in testis. (D-K) The protein
expression levels of PI3K, mTOR, p-AKT, p-AKT/AKT, Raptor, 4EBP1, and eIF4E in testis. Different letters indicate signicant differences between groups (P<0.05).
(L) Immunohistochemical staining for PI3K, p-AKT, and mTOR proteins in testes tissue (200×, 400×magnications). Quantitative data are presented as mean ±SD
(n =4). * P<0.05, ** P<0.01, compared with control group.
R. Liu et al.
Ecotoxicology and Environmental Safety 239 (2022) 113623
8
Fig. 4. Effects of BPA exposure on cell apoptosis in testes. (A) Western blotting photographs and relative quantitative analysis of (B) Cleaved-PARP and PARP
protein, (C) FASL, (D) FAS, (E) Cleaved-caspase3, (F) Caspase3, (G) Bcl-2, (H) Bax, and (I) Bcl-2/Bax. Data are expressed as mean ±SD (n =4). Different letters
indicate signicant differences between groups (P<0.05). (H) The assessment of apoptosis in testes sections with TUNEL immunouorescence and the ratio of
apoptosis cells were counted in every eld. Quantitative data are presented as mean ±SD (n =4). * P<0.05, ** P<0.01, compared with control group.
Fig. 5. Effects of BPA exposure on the levels of histone ubiquitination in testes. (A) Representative western blots and relative quantitative analysis of (B) H2A, (C)
H2B, (D) ub-H2A, (E) ub-H2B, (F) H3, and (G) H4. The data are expressed as mean ±SD (n =4). Different letters indicate signicant differences between
groups (P<0.05).
R. Liu et al.
Ecotoxicology and Environmental Safety 239 (2022) 113623
9
Spermatogenesis is a highly ordered and precisely regulated process,
which requires huge epigenetic remodeling (Govin et al., 2006). Normal
spermatogenesis is dependent on well-balanced spermatogenetic cell
proliferation, differentiation, and death in the testes (Zhang et al.,
2012). LH stimulated the production of testosterone by Leydig cells, and
FSH stimulated the local production of estradiol by Sertoli cells. Besides,
FSH and testosterone directly control the expression of genes in Sertoli
cells which are required for the progression of meiotic and post-meiotic
events (O’Shaughnessy et al., 2010). Normal testosterone levels are
necessary for maintaining the development of the male reproductive
system (Zhao et al., 2020). In our study, a high dose of BPA-treated rats
showed less sperm count while a higher deformity rate signicantly.
And the decreased levels of testosterone further conrmed the disrup-
tion of hormones involved in the BPA-induced testicular toxicity. The
testicular normal structure is important for maintaining normal
reproductive function. And the histopathological examination of testis
and epididymis is also important for fertility diagnosis and prognosis
inference in reproductive practice (McLachlan et al., 2007). Consistent
with the data on sperm quality, we observed disarrangement of testic-
ular tissue, and atrophy of spermatogenic tubules in a dose-dependent
manner, suggesting that BPA inuences spermatogenesis.
The kisspeptin system is a key regulator of the reproductive system,
and the formation and function of the kisspeptin signaling pathway are
affected by sex hormones at different stages of the life cycle, which can
regulate the reproductive endocrine system. Kiss-1 gene, as a target for
regulation by testosterone, the increased expression of GnRH, and FSH
can also be understood as negative feedback regulation of testosterone.
The upregulation of hypothalamic Kiss-1 after BPA exposure may
stimulate the synthesis and release of GnRH and gonadotropins in the
hypothalamus and pituitary gland, respectively (Xi et al., 2011). In the
Fig. 6. Effects of BPA exposure on gut microbiota composition of rats. (A) Principal component analysis (PCA) of gut bacterial community composition.
α
-diversity
analysis: (B) Chao1 index, (C) Shannon index, and (D) Simpson index. Composition of microbial community and the main microbiota at (E) phylum, (F) class, (G)
order, and (H) family level. Statistical signicance was determined by one-way ANOVA and the LSD post-hoc test, * P<0.05, ** P<0.01 compared to the con-
trol group.
R. Liu et al.
Ecotoxicology and Environmental Safety 239 (2022) 113623
10
present study, we observed that BPA exposure decreased INHB levels in
serum, and increased the FSH and DHT levels. The decrease in INHB may
be indicative of a BPA-induced alteration of Sertoli cell functionality.
The effects on seminiferous epithelium morphology are relatively mild
which may be due to a compensatory effect by DHT, a metabolite of
testosterone that binds with a substantially higher afnity to the
androgen receptor than testosterone (Carson and Rittmaster, 2003).
Moreover, in line with the increased Kiss-1 expression in the hypotha-
lamic, GnRH gene expression in the pituitary increased, which is similar
to a study by Oride et al. who showed that clomiphene citrate induced
Kiss-1 expression in the presence of estradiol in mHypoA-50 cells (Oride
et al., 2020). These results suggest that BPA exposure disrupted the
imbalance of hormones, further leading to a suboptimal maturation of
the spermatids and being responsible for the observed increased sperm
malformation.
As another concerned item, the process of spermatogenesis was
regulated by histone modication accurately, and the histone ubiquiti-
nation process is the master prerequisite of nucleosome removal during
the sperm elongating period (Zhao et al., 2022). As the rst step in
histone-to-protamine exchange, histone ubiquitination can promote
histone removal by loosening the compact nucleosome, subsequently,
promoting the replacement of transition protein in pachytene sper-
matocyte (Li et al., 2020). In our study, the protein expression of H2A
and H3 were signicantly increased in medium and high doses of
BPA-treated groups, while the ubiquitinated histone H2A and ubiquiti-
nated H2B were signicantly diminished. Therefore, these data indi-
cated BPA exposure affected spermatogenesis by altering the
ubiquitination.
Testicular cells contain a large amount of unsaturated fatty acids and
divide at a high speed, which makes spermatogenic cells highly sus-
ceptible to oxidative damage, which is not conducive to sperm pro-
duction (Sharma et al., 2019). Reactive oxygen species (ROS) are
involved in DNA damage, resulting in the status of oxidative stress and
possibly modulating the apoptotic pathway. SOD can catalyze the
overproduced O
2
−
into H
2
O
2
, next H
2
O
2
is catalyzed into H
2
O and O
2
by
CAT, which protected the body from harmful substances-induced
oxidative stress. GSH is a crucial non-protein antioxidant and can
scavenge the lipid peroxide radicals. When an exogenous substance
enters the body, it will be slowly released into the blood, and then reach
organs through the blood. Therefore, the oxidation indicators in the
blood are the rst to be observed when the body is oxidized and injured.
That is the reason that the SOD and CAT activities were signicantly
increased in the blood compared to the control group in this study.
While the lipid peroxidative products exceed the scavenging efciency
of GSH, it will accumulate in the blood and tissues, and there is a sig-
nicant increase in GSH. Histones can migrate from the nucleus into the
cytoplasm as a response to DNA double-strand breakage and then can
indirectly activate BAK at the mitochondrial outer membrane, resulting
in the promotion of cytochrome C release and activation of a cell pro-
grammed apoptosis. In our study, we found that the protein levels of
Cleaved-PARP/PARP and FAS were signicantly increased in the BPA-H
group, as well as the percentage of TUNEL-positive cells in rat testes
expoto sed BPA. Cleaved-caspase3, which is the main nal executor of
apoptosis, is responsible for the cleavage of key cellular proteins, leading
Fig. 7. Correlations between the intestinal microbiota and hormone parameters. (A) Cladograms based on LEfSe analysis representing featuring bacterial taxa. (B)
LDA score, each taxon with a threshold score larger than 3 is shown in the histogram, the bar length of LDA represents the impact of signicantly different species in
each group. (C) Correlation analysis between intestinal ora and hormones in rats. Spearman’s correlation coefcients are represented by color ranging from blue,
negative correlation (−0.5), to red, positive correlation (0.5). Signicant correlations are noted by * P<0.05, ** P<0.01, and *** P<0.001.
R. Liu et al.
Ecotoxicology and Environmental Safety 239 (2022) 113623
11
to apoptosis (Budihardjoetal.,1999). Increased activities of
Cleaved-caspase3 in this study proved that caspase cascades are
involved in BPA-induced spermatogenic cell apoptosis. However, there
was no signicant change in Bcl-2 and Bax. We speculated that the
apoptosis of testis tissue induced by BPA may be mainly affecting the
FAS pathway rather than the Bax pathway.
The process of germ cell development is under the tight control of
various signaling pathways, including the PI3K/Akt/mTOR pathway. A
previous study has conrmed that PI3K/AKT/mTOR signaling pathway
is one of the classical pathways to inhibit apoptosis (Wu et al., 2020).
Moreover, FSH can regulate Sertoli cell proliferation through the
pathway (Riera et al., 2012). The germ cells in the testis are highly
proliferative and metabolically active. It is therefore not surprising that
the PI3K/AKT/mTOR pathway plays a central role in the self-renewal of
spermatogonial stem cells and the proliferation and differentiation of
spermatogonia (Moreira et al., 2019; Cao et al., 2020; Zhang et al.,
2020). Therefore, we next evaluated the PI3K/AKT pathway. The cur-
rent data show that BPA exposure leads to activation of the PI3K/AKT
pathway in testes of male SD rats. Meanwhile, the inhibition of mTOR
may interfere with Sertoli cell functionality, leading to the premature
release of sperm cells (Boyer et al., 2016). Therefore, we speculate it is
probably a protective compensation reaction, that is the activation of
AKT can protect cells from damage under oxidative stress.
Gut microbiota plays a role in metabolic disorders and participates in
the regulation of hormonal levels, estrous cycle, and reproductive
functions (Hussain et al., 2021). A previous study showed that gut mi-
crobes can involve in estrogen and androgen cycling and inuence sex
steroid hormone levels, as well as androgen production from glucocor-
ticoids (Cross et al., 2018). Sexual maturation was a major determinant
of the cecal microbiome community structure, and microbial coloniza-
tion status was correlated with testosterone levels. The removal of the
gut microbiota decreases testosterone levels in male mice, indicative of
bidirectional interaction between the amount of male sex hormone and
the microbiota (Markle et al., 2013). In addition, a previous study
indicated that testosterone may be one of the indirect factors leading to
the development of amphoteric colon adenoma (Amos-Landgraf et al.,
2014). In turn, the gut microbiota itself also inuences estrogen levels
(Rizzetto et al., 2018). The present study showed that BPA exposure
caused gut microbial dysbiosis, with lower diversity in
α
-diversity and
altered relative abundance for certain bacterial taxa. Bacteroidetes, and
Firmicutes, which accounted for up to 90% of the total sequences, were
the dominant phylum in BPA-treated groups. The relative abundances of
the class Gammaproteobacteria and the order Betaproteobacteriales were
elevated after exposure to the high dose of BPA. Ni et al. (2021) have
found that BPA exposure increases the abundance of Firmicutes and de-
creases the abundance of Bacteroidetes in C57BL/6 male mice. Proteus is
anaerobic or facultative anaerobic bacillus in the gastrointestinal tract
and hydrolyzes urea into ammonia and carbon dioxide via urease (Fan
et al., 2020). Gammaproteobacteria are involved in the synthesis of
vitamin B12 and have multiple benecial functions in the intestine
including the synthesis and uptake of amino acids (Paris et al., 2020).
Therefore, we speculate that BPA may increase the permeability of the
intestinal barrier by altering the gut microbiome. This pathological
change may induce the likelihood that bacterial pathogens will enter the
systemic circulation, which may affect the secretion of hormones in the
body (Ait-Belgnaoui et al., 2012).
In future research, the contents of different bacteria and multi-omic
techniques such as proteomics, and metabolomics are needed to reveal
novel interactions between gut microbiota and sex hormones.
5. Conclusion
In summary, BPA-induced gut microora disorder is closely related
to male reproductive toxicity. Disorder of sex hormone levels is strongly
associated with the imbalance of intestinal ora. BPA exposure affected
spermatogenesis by increasing oxidative stress and leading to
mitochondria apoptosis. In addition, the histone modication was per-
turbed, and the PI3K/AKT pathway was activated in rat testicular after
exposure to BPA. Further research is needed to investigate the mecha-
nisms of those identied key microbiota as a biomarker for certain
reproduction-related diseases.
Funding
This work was supported by the Youth Science and Technology
Innovation Talent of Guangdong TeZhi Plan (No. 2019TQ05N770);
Guangdong Basic and Applied Basic Research Foundation (No.
2020A1515111045); Guangdong Key Area Research and Development
Program (No. 2019B020210003); Construction Plan of Guangdong
Province High-level Universities and the Research Start-up Funds for the
High-level Talent Introduction Project of South China Agricultural
University (No. 20173326).
CRediT authorship contribution statement
Ruijing Liu: Investigation, Formal analysis, Methodology, Writing –
original draft. Dongbao Cai: Methodology, Data curation. Xusheng Li:
Data curation, Validation. Writing – review & editing. Boping Liu:
Funding acquisition, Project administration, Writing – review & editing.
Jiali Chen: Methodology. Xinwei Jiang: Methodology. Haiwei Li:
Methodology, Visualization. Zhenhua Li: Methodology. Katja Teerds:
Writing – review & editing. Jianxia Sun: Data curation. Weibin Bai:
Conceptualization, Funding acquisition, Project administration, Re-
sources, Supervision. Yulong Jin: Data curation, Funding acquisition,
Writing – review & editing, Supervision.
Declaration of Competing Interest
The authors declare that they have no known competing nancial
interests or personal relationships that could have appeared to inuence
the work reported in this paper.
References
Adegoke, E.O., Rahman, M.S., Amjad, S., Pang, W.K., Ryu, D.Y., Park, Y.J., Pang, M.G.,
2022. Bisphenol A damages testicular junctional proteins transgenerationally in
mice. Environ. Pollut. 302, 119067 https://doi.org/10.1016/j.envpol.2022.119067.
Ait-Belgnaoui, A., Durand, H., Cartier, C., Chaumaz, G., Eutamene, H., Ferrier, L.,
Houdeau, E., Fioramonti, J., Bueno, L., Theodorou, V., 2012. Prevention of gut
leakiness by a probiotic treatment leads to attenuated HPA response to an acute
psychological stress in rats. Psychoneuroendocrinology 37, 1885–1895. https://doi.
org/10.1016/j.psyneuen.2012.03.024.
Amos-Landgraf, J.M., Heijmans, J., Wielenga, M.C., Dunkin, E., Krentz, K.J., Clipson, L.,
Ederveen, A.G., Groothuis, P.G., Mosselman, S., Muncan, V., Hommes, D.W.,
Shedlovsky, A., Dove, W.F., van den Brink, G.R., 2014. Sex disparity in colonic
adenomagenesis involves promotion by male hormones, not protection by female
hormones. Proc. Natl. Acad. Sci. USA 111, 16514–16519. https://doi.org/10.1073/
pnas.1323064111.
Boyer, A., Girard, M., Thimmanahalli, D.S., Levasseur, A., C´
eleste, C., Paquet, M.,
Duggavathi, R., Boerboom, D., 2016. mTOR regulates gap junction Alpha-1 protein
trafcking in sertoli cells and is required for the maintenance of spermatogenesis in
mice. Biol. Reprod. 95, 13. https://doi.org/10.1095/biolreprod.115.138016.
Buckley, J.P., Kim, H., Wong, E., Rebholz, C.M., 2019. Ultra-processed food consumption
and exposure to phthalates and bisphenols in the US National Health and Nutrition
Examination Survey, 2013-2014. Environ. Int. 131, 105057 https://doi.org/
10.1016/j.envint.2019.105057.
Calafat, A.M., Ye, X., Wong, L., Reidy, J.A., Needham, L.L., 2008. Exposure of the U.S.
population to bisphenol A and 4-tertiary-octylphenol: 2003-2004. Environ. Health
Perspect. 116, 39–44. https://doi.org/10.1289/ehp.10753.
Cao, J., Lin, Z., Tong, M., Zhang, Y., Li, Y., Zhou, Y., 2020. Mechanistic target of
rapamycin kinase (Mtor) is required for spermatogonial proliferation and
differentiation in mice. Asian J. Androl. 22, 169–176. https://doi.org/10.4103/aja.
aja_14_19.
Cariati, F., D’Uonno, N., Borrillo, F., Iervolino, S., Galdiero, G., Tomaiuolo, R., 2019.
Bisphenol a: an emerging threat to male fertility. Reprod. Biol. Endocrinol. 17, 6.
https://doi.org/10.1186/s12958-018-0447-6.
Carson, C., Rittmaster, R., 2003. The role of dihydrotestosterone in benign prostatic
hyperplasia. Urology 61, 2–7. https://doi.org/10.1016/s0090-4295(03)00045-1.
R. Liu et al.
Ecotoxicology and Environmental Safety 239 (2022) 113623
12
Cho, S., Choi, Y.S., Luu, H.M., Guo, J., 2012. Determination of total leachable bisphenol
A from polysulfone membranes based on multiple consecutive extractions. Talanta
101, 537–540. https://doi.org/10.1016/j.talanta.2012.09.033.
Corradi, P.F., Corradi, R.B., Greene, L.W., 2016. Physiology of the hypothalamic
pituitary gonadal axis in the male. Urol. Clin. N. Am. 43, 151–162. https://doi.org/
10.1016/j.ucl.2016.01.001.
Cross, T.L., Kasahara, K., Rey, F.E., 2018. Sexual dimorphism of cardiometabolic
dysfunction: gut microbiome in the play? Mol. Metab. 15, 70–81.
Demierre, A., Peter, R., Oberli, A., Bourqui-Pittet, M., 2012. Dermal penetration of
bisphenol A in human skin contributes marginally to total exposure. Toxicol. Lett.
213, 305–308. https://doi.org/10.1016/j.toxlet.2012.07.001.
Diamante, G., Cely, I., Zamora, Z., Ding, J., Blencowe, M., Lang, J., Bline, A., Singh, M.,
Lusis, A.J., Yang, X., 2021. Systems toxicogenomics of prenatal low-dose BPA
exposure on liver metabolic pathways, gut microbiota, and metabolic health in mice.
Environ. Int. 146, 106260 https://doi.org/10.1016/j.envint.2020.106260.
Ehrlich, S., Calafat, A.M., Humblet, O., Smith, T., Hauser, R., 2014. Handling of thermal
receipts as a source of exposure to bisphenol A. JAMA 311, 859–860. https://doi.
org/10.1001/jama.2013.283735.
Fan, S., Li, H., Zhao, R., 2020. Effects of normoxic and hypoxic conditions on the immune
response and gut microbiota of Bostrichthys sinensis. Aquaculture 525, 735336.
https://doi.org/10.1016/j.aquaculture.2020.735336.
Fu, G., Dai, J., Li, Z., Chen, F., Liu, L., Yi, L., Teng, Z., Quan, C., Zhang, L., Zhou, T.,
Donkersley, P., Song, S., Shi, Y., 2020. The role of STAT3/p53 and PI3K-Akt-mTOR
signaling pathway on DEHP-induced reproductive toxicity in pubertal male rat.
Toxicol. Appl. Pharmacol. 404, 115151 https://doi.org/10.1016/j.
taap.2020.115151.
Gao, L., Dong, Y., Lin, R., Meng, Y., Wu, F., Jia, L., 2020. The imbalance of Treg/Th17
cells induced by perinatal bisphenol A exposure is associated with activation of the
PI3K/Akt/mTOR signaling pathway in male offspring mice. Food Chem. Toxicol.
137, 111177 https://doi.org/10.1016/j.fct.2020.111177.
Gou, L., Kang, J., Dai, P., Wang, X., Li, F., Zhao, S., Zhang, M., Hua, M., Lu, Y., Zhu, Y.,
Li, Z., Chen, H., Wu, L., Li, D., Fu, X., Li, J., Shi, H., Liu, M., 2017. Ubiquitination-
decient mutations in human piwi cause male infertility by impairing histone-to
protamine exchange during spermiogenesis. Cell 169, 1090–1104. https://doi.org/
10.1016/j.cell.2017.04.034.
Govin, J., Lestrat, C., Caron, C., Pivot-Pajot, C., Rousseaux, S., Khochbin, S., 2006.
Histone acetylation-mediated chromatin compaction during mouse spermatogenesis.
Ernst Schering Res. Found. Workshop 57, 155–172. https://doi.org/10.1007/3-540-
37633-x_9.
Health Canada, 2015. Third Report on Human Biomonitoring of Environmental
Chemicals in Canada: Results of the Canadian Health Measures Survey Cycle 3
(2012–2013). Available online: 〈https://www.canada.ca/en/health-canada/services
/environmental-workplace-health/reports-publications/environmental-contamina
nts/third-report-human-biomonitoring-environmental-chemicals-canada.html〉.
Hu, J., Raikhel, V., Gopalakrishnan, K., Fernandez-Hernandez, H., Lambertini, L.,
Manservisi, F., Falcioni, L., Bua, L., Belpoggi, F., L. Teitelbaum, S., Chen, J., 2016.
Effect of postnatal low-dose exposure to environmental chemicals on the gut
microbiome in a rodent model. Microbiome 4, 26. https://doi.org/10.1186/s40168-
016-0173-2.
Hussain, T., Murtaza, G., Kalhoro, D.H., Kalhoro, M.S., Metwally, E., Chughtai, M.I.,
Mazhar, M.U., Khan, S.A., 2021. Relationship between gut microbiota and host-
metabolism: emphasis on hormones related to reproductive function. Anim. Nutr. 7,
1–10. https://doi.org/10.1016/j.aninu.2020.11.005.
Javurek, A.B., Spollen, W.G., Johnson, S.A., Bivens, N.J., Bromert, K.H., Givan, S.A.,
Rosenfeld, C.S., 2016. Effects of exposure to bisphenol A and ethinyl estradiol on the
gut microbiota of parents and their offspring in a rodent model. Gut Microbes 7,
471–485. https://doi.org/10.1080/19490976.2016.1234657.
Jiang, X., Zhu, C., Li, X., Sun, J., Tian, L., Bai, W., 2018. Cyanidin-3-O-glucoside at low
doses protected against 3-Chloro-1,2-propanediol induced testis injury and improved
spermatogenesis in male rats. J. Agric. Food Chem. 66, 12675–12684. https://doi.
org/10.1021/acs.jafc.8b04229.
Kong, L., Wu, Y., Hu, W., Liu, L., Xue, Y., Liang, G., 2021. Mechanisms underlying
reproductive toxicity induced by nickel nanoparticles identied by comprehensive
gene expression analysis in GC-1 spg cells. Environ. Pollut. 275, 116556 https://doi.
org/10.1016/j.envpol.2021.116556.
Lai, K., Chung, Y., Li, R., Wan, H., Wong, C.K., 2016. Bisphenol A alters gut microbiome:
comparative metagenomics analysis. Environ. Pollut. 218, 923–930. https://doi.org/
10.1016/j.envpol.2016.08.039.
Li, X., Yao, Z., Yang, D., Jiang, X., Sun, J., Tian, L., Hu, J., Wu, B., Bai, W., 2020.
Cyanidin-3-O-glucoside restores spermatogenic dysfunction in cadmium-exposed
pubertal mice via histone ubiquitination and mitigating oxidative damage.
J. Hazard. Mater. 387, 121706 https://doi.org/10.1016/j.jhazmat.2019.121706.
Liu, J., Li, X., Zhou, G., Zhang, Y., Sang, Y., Wang, J., Li, Y., Ge, W., Sun, Z., Zhou, X.,
2021a. Silica nanoparticles inhibiting the differentiation of round spermatid and
chromatin remodeling of haploid period via MIWI in mice. Environ. Pollut. 284,
117446 https://doi.org/10.1016/j.envpol.2021.117446.
Liu, X., Wang, Z., Liu, F., 2021b. Chronic exposure of BPA impairs male germ cell
proliferation and induces lower sperm quality in male mice. Chemosphere 262,
127880. https://doi.org/10.1016/j.chemosphere.2020.127880.
Markle, J.G.M., Frank, D.N., Mortin-Toth, S., Robertson, C.E., Feazel, L.M., Rolle-
Kampczyk, U., von Bergen, M., McCoy, K.D., Macpherson, A.J., Danska, J.S., 2013.
Sex differences in the gut microbiome drive hormone-dependent regulation of
autoimmunity. Science 339, 1084–1088. https://doi.org/10.1126/science.1233521.
McLachlan, R.I., Rajpert-De, M.E., Hoei-Hansen, C.E., de Kretser, D.M., Skakkebaek, N.E.,
2007. Histological evaluation of the human testis–approaches to optimizing the
clinical value of the assessment: mini review. Hum. Reprod. 22, 2–16. https://doi.
org/10.1093/humrep/del279.
Molina, A., Abril, N., Morales-Prieto, N., Monterde, J., Ayala, N., Lora, A., Moyano, R.,
2018. Hypothalamic-pituitary-ovarian axis perturbation in the basis of bisphenol A
(BPA) reproductive toxicity in female zebrash (Danio rerio). Ecotoxicol. Environ.
Saf. 156, 116–124. https://doi.org/10.1016/j.ecoenv.2018.03.029.
Moreira, B.P., Oliveira, P.F., Alves, M.G., 2019. Molecular mechanisms controlled by
mTOR in male reproductive system. Int. J. Mol. Sci. 20, 1633. https://doi.org/
10.3390/ijms20071633.
Murata, M., Kang, J., 2018. Bisphenol A (BPA) and cell signaling pathways. Biotechnol.
Adv. 36, 311–327. https://doi.org/10.1016/j.biotechadv.2017.12.002.
Ni, Z., Sun, W., Li, R., Yang, M., Zhang, F., Chang, X., Li, W., Zhou, Z., 2021.
Fluorochloridone induces autophagy in TM4 Sertoli cells: involvement of ROS-
mediated AKT-mTOR signaling pathway. Reprod. Biol. Endocrinol. 19, 64. https://
doi.org/10.1186/s12958-021-00739-8.
Oride, A., Kanasaki, H., Tumurbaatar, T., Zolzaya, T., Okada, H., Hara, T., Kyo, S., 2020.
Effects of the fertility drugs clomiphene citrate and letrozole on kiss-1 expression in
hypothalamic kiss-1 expressing cell models. Reprod. Sci. 27, 806–814. https://doi.
org/10.1007/s43032-020-00154-1.
O’Shaughnessy, P.J., Monteiro, A., Verhoeven, G., De Gendt, K., Abel, M.H., 2010. Effect
of FSH on testicular morphology and spermatogenesis in gonadotrophin-decient
hypogonadal mice lacking androgen receptors. Reproduction 139, 177–184. https://
doi.org/10.1530/REP-09-0377.
Paris, L., Peghaire, E., Mon´
e, A., Diogon, M., Debroas, D., Delbac, F., El Alaoui, H., 2020.
Honeybee gut microbiota dysbiosis in pesticide/parasite co-exposures is mainly
induced by Nosema ceranae. J. Invertebr. Pathol. 172, 107348 https://doi.org/
10.1016/j.jip.2020.107348.
Peretz, J., Vrooman, L., Ricke, W.A., Hunt, P.A., Ehrlich, S., Hauser, R.,
Padmanabhan, V., Taylor, H.S., Swan, S.H., VandeVoort, C.A., Flaws, J.A., 2014.
Bisphenol a and reproductive health: update of experimental and human evidence,
2007-2013. Environ. Health Perspect. 122, 775–786. https://doi.org/10.1289/
ehp.1307728.
Poling, M.C., Kauffman, A.S., 2013. Organizational and activational effects of sex
steroids on kisspeptin neuron development. Front. Neuroendocrin. 34, 3–17. https://
doi.org/10.1016/j.yfrne.2012.06.001.
Qiu, L., Chen, M., Wang, X., Qin, X., Chen, S., Qian, Y., Liu, Z., Cao, Q., Ying, Z., 2018.
Exposure to concentrated ambient PM2.5 compromises spermatogenesis in a mouse
model: Role of suppression of hypothalamus-pituitary-gonads axis. Toxicol. Sci. 162,
318–326. https://doi.org/10.1093/toxsci/kfx261.
Rahman, M.S., Pang, M., 2019. Understanding the molecular mechanisms of bisphenol A
action in spermatozoa. Clin. Exp. Reprod. Med. 46, 99–106. https://doi.org/
10.5653/cerm.2019.00276.
Riera, M.F., Regueira, M., Galardo, M.N., Pellizzari, E.H., Meroni, S.B., Cigorraga, S.B.,
2012R. Signal transduction pathways in FSH regulation of rat Sertoli cell
proliferation. Am. J. Physiol. Endocrinol. Metab. 302, E914–E923. https://doi.org/
10.1152/ajpendo.00477.2011.
Rizzetto, L., Fava, F., Tuohy, K.M., Selmi, C., 2018. Connecting the immune system,
systemic chronic inammation and the gut microbiome: the role of sex.
J. Autoimmun. 92, 12–34. https://doi.org/10.1016/j.jaut.2018.05.008.
Sharma, P., Ghanghas, P., Kaushal, N., Kaur, J., Kaur, P., 2019. Epigenetics and oxidative
stress: a twin-edged sword in spermatogenesis. Andrologia 51, e13432. https://doi.
org/10.1111/and.13432.
Singh, R.P., Shafeeque, C.M., Sharma, S.K., Pandey, N.K., Singh, R., Mohan, J.,
Kolluri, G., Saxena, M., Sharma, B., Sastry, K.V.H., Kataria, J.M., Azeez, P.A., 2015.
Bisphenol A reduces fertilizing ability and motility by compromising mitochondrial
function of sperm. Environ. Toxicol. Chem. 34, 1617–1622. https://doi.org/
10.1002/etc.2957.
Spaziani, M., Tarantino, C., Tahani, N., Gianfrilli, D., Sbardella, E., Lenzi, A.,
Radicioni, A.F., 2021. Hypothalamo-Pituitary axis and puberty. Mol. Cell.
Endocrinol. 520, 111094 https://doi.org/10.1016/j.mce.2020.111094.
Vandenberg, L.N., Mafni, M.V., Sonnenschein, C., Rubin, B.S., Soto, A.M., 2009.
Bisphenol-A and the great divide: a review of controversies in the eld of endocrine
disruption. Endocr. Rev. 30, 75–95. https://doi.org/10.1210/er.2008-0021.
Wang, P., Luo, C., Li, Q., Chen, S., Hu, Y., 2014. Mitochondrion-mediated apoptosis is
involved in reproductive damage caused by BPA in male rats. Environ. Toxicol.
Pharmacol. 38, 1025–1033. https://doi.org/10.1016/j.etap.2014.10.018.
Wang, Y., Rui, M., Nie, Y., Lu, G., 2018. Inuence of gastrointestinal tract on metabolism
of bisphenol A as determined by in vitro simulated system. J. Hazard. Mater. 355,
111–118. https://doi.org/10.1016/j.jhazmat.2018.05.011.
Wu, Y., Ma, J., Sun, Y., Tang, M., Kong, L., 2020. Effect and mechanism of PI3K/AKT/
mTOR signaling pathway in the apoptosis of GC-1 cells induced by nickel
nanoparticles. Chemosphere 255, 126913. https://doi.org/10.1016/j.
chemosphere.2020.126913.
Xi, W., Lee, C.K., Yeung, W.S., Giesy, J.P., Wong, M.H., Zhang, X., Hecker, M., Wong, C.
K., 2011. Effect of perinatal and postnatal bisphenol A exposure to the regulatory
circuits at the hypothalamus-pituitary-gonadal axis of CD-1 mice. Reprod. Toxicol.
31, 409–417. https://doi.org/10.1016/j.reprotox.2010.12.002.
Xie, M., Bu, P., Li, F., Lan, S., Wu, H., Yuan, L., Wang, Y., 2016. Neonatal bisphenol A
exposure induces meiotic arrest and apoptosis of spermatogenic cells. Oncotarget 7,
10606–10615. https://doi.org/10.18632/oncotarget.7218.
Xu, H., Shen, L., Chen, X., Ding, Y., He, J., Zhu, J., Wang, Y., Liu, X., 2016. mTOR/
P70S6K promotes spermatogonia proliferation and spermatogenesis in Sprague
Dawley rats. Reprod. Biomed. Online 32, 207–217. https://doi.org/10.1016/j.
rbmo.2015.11.007.
Zhan, J., Ma, X., Liu, D., Liang, Y., Li, P., Cui, J., Zhou, Z., Wang, P., 2020. Gut
microbiome alterations induced by tributyltin exposure are associated with
R. Liu et al.
Ecotoxicology and Environmental Safety 239 (2022) 113623
13
increased body weight, impaired glucose and insulin homeostasis and endocrine
disruption in mice. Environ. Pollut. 266, 115276 https://doi.org/10.1016/j.
envpol.2020.115276.
Zhang, J., Yao, Y., Pan, J., Guo, X., Han, X., Zhou, J., Meng, X., 2020. Maternal exposure
to di-(2-ethylhexyl) phthalate (DEHP) activates the PI3K/Akt/mTOR signaling
pathway in F1 and F2 generation adult mouse testis. Exp. Cell Res. 394, 112151
https://doi.org/10.1016/j.yexcr.2020.112151.
Zhang, M., Jiang, M., Bi, Y., Zhu, H., Zhou, Z., Sha, J., 2012. Autophagy and apoptosis act
as partners to induce germ cell death after heat stress in mice. PLoS One 7, e41412.
https://doi.org/10.1371/journal.pone.0041412.
Zhao, T., Wei, Y., Wang, J., Han, L., Sun, M., Wu, Y., Shen, L., Long, C., Wu, S., Wei, G.,
2020. The gut-microbiota-testis axis mediated by the activation of the Nrf2
antioxidant pathway is related to prepuberal steroidogenesis disorders induced by
di-(2-ethylhexyl) phthalate. Environ. Sci. Pollut. Res. Int. 27, 35261–35271. https://
doi.org/10.1007/s11356-020-09854-2.
Zhao, T., Tang, X., Li, D., Zhao, J., Zhou, R., Shu, F., Jia, W., Fu, W., Xia, H., Liu, G.,
2022. Prenatal exposure to environmentally relevant levels of PBDE-99 leads to
testicular dysgenesis with steroidogenesis disorders. J. Hazard. Mater. 424, 127547
https://doi.org/10.1016/j.jhazmat.2021.127547.
Abbara, A, Clarke, S.A., Dhillo, W.S, 2021. Clinical Potential of Kisspeptin in
Reproductive Health. Trends. Mol. Med. 27, 807–823. https://doi.org/10.1016/j.
molmed.2021.05.008.
R. Liu et al.
