A Multi-Step Process of Viral Adaptation to a Mutagenic Nucleoside Analogue by Modulation of Transition Types Leads to Extinction-Escape

Abstract

Resistance of viruses to mutagenic agents is an important problem for the development of lethal mutagenesis as an antiviral strategy. Previous studies with RNA viruses have documented that resistance to the mutagenic nucleoside analogue ribavirin (1-β-D-ribofuranosyl-1-H-1,2,4-triazole-3-carboxamide) is mediated by amino acid substitutions in the viral polymerase that either increase the general template copying fidelity of the enzyme or decrease the incorporation of ribavirin into RNA. Here we describe experiments that show that replication of the important picornavirus pathogen foot-and-mouth disease virus (FMDV) in the presence of increasing concentrations of ribavirin results in the sequential incorporation of three amino acid substitutions (M296I, P44S and P169S) in the viral polymerase (3D). The main biological effect of these substitutions is to attenuate the consequences of the mutagenic activity of ribavirin -by avoiding the biased repertoire of transition mutations produced by this purine analogue-and to maintain the replicative fitness of the virus which is able to escape extinction by ribavirin. This is achieved through alteration of the pairing behavior of ribavirin-triphosphate (RTP), as evidenced by in vitro polymerization assays with purified mutant 3Ds. Comparison of the three-dimensional structure of wild type and mutant polymerases suggests that the amino acid substitutions alter the position of the template RNA in the entry channel of the enzyme, thereby affecting nucleotide recognition. The results provide evidence of a new mechanism of resistance to a mutagenic nucleoside analogue which allows the virus to maintain a balance among mutation types introduced into progeny genomes during replication under strong mutagenic pressure.

Full text

A Multi-Step Process of Viral Adaptation to a Mutagenic
Nucleoside Analogue by Modulation of Transition Types
Leads to Extinction-Escape
Rube
´n Agudo
1
, Cristina Ferrer-Orta
2
, Armando Arias
1¤
, Ignacio de la Higuera
1
, Celia Perales
1,3
, Rosa
Pe
´rez-Luque
2
, Nuria Verdaguer
2
, Esteban Domingo
1,3
*
1Centro de Biologia Molecular ‘‘Severo Ochoa’’ (CSIC-UAM), Cantoblanco, Madrid, Spain, 2Institut de Biologia Molecular de Barcelona (CSIC), Parc Cientı
´fic de Barcelona,
Barcelona, Spain, 3Centro de Investigacio
´n Biome
´dica en Red de Enfermedades Hepa
´ticas y Digestivas (CIBERehd), Barcelona, Spain
Abstract
Resistance of viruses to mutagenic agents is an important problem for the development of lethal mutagenesis as an
antiviral strategy. Previous studies with RNA viruses have documented that resistance to the mutagenic nucleoside
analogue ribavirin (1-b-D-ribofuranosyl-1-H-1,2,4-triazole-3-carboxamide) is mediated by amino acid substitutions in the
viral polymerase that either increase the general template copying fidelity of the enzyme or decrease the incorporation of
ribavirin into RNA. Here we describe experiments that show that replication of the important picornavirus pathogen foot-
and-mouth disease virus (FMDV) in the presence of increasing concentrations of ribavirin results in the sequential
incorporation of three amino acid substitutions (M296I, P44S and P169S) in the viral polymerase (3D). The main biological
effect of these substitutions is to attenuate the consequences of the mutagenic activity of ribavirin —by avoiding the biased
repertoire of transition mutations produced by this purine analogue—and to maintain the replicative fitness of the virus
which is able to escape extinction by ribavirin. This is achieved through alteration of the pairing behavior of ribavirin-
triphosphate (RTP), as evidenced by in vitro polymerization assays with purified mutant 3Ds. Comparison of the three-
dimensional structure of wild type and mutant polymerases suggests that the amino acid substitutions alter the position of
the template RNA in the entry channel of the enzyme, thereby affecting nucleotide recognition. The results provide
evidence of a new mechanism of resistance to a mutagenic nucleoside analogue which allows the virus to maintain a
balance among mutation types introduced into progeny genomes during replication under strong mutagenic pressure.
Citation: Agudo R, Ferrer-Orta C, Arias A, de la Higuera I, Perales C, et al. (2010) A Multi-Step Process of Viral Adaptation to a Mutagenic Nucleoside Analogue by
Modulation of Transition Types Leads to Extinction-Escape. PLoS Pathog 6(8): e1001072. doi:10.1371/journal.ppat.1001072
Editor: Bruno Canard, CNRS, France
Received February 25, 2010; Accepted July 26, 2010; Published August 26, 2010
Copyright: ß2010 Agudo et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: Work in Madrid was supported by grants BFU2008-02816/BMC from MICINN, and Fundacion R. Areces. CIBERehd (Centro de Investigacion Biomedica
en Red de Enfermedades Hepaticas y Digestivas) is funded by Instituto de Salud Carlos III. Work in Barcelona was supported by grant BIO2008-02556 from MICINN.
Work in Barcelona and Madrid was further supported by Proyecto Intramural de Frontera 2000820FO191 (CSIC). X-ray data were collected at the ESRF beam lines
ID14.1 and ID14.2 (Grenoble, France) within a Block Allocation Group (BAG Barcelona). Financial support was provided by the ESRF. AA and CFO are recipients of
I3P and Juan de la Cierva postdoctoral contracts, respectively. The funders had no role in study design, data collection and analysis, decision to publish, or
preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: edomingo@cbm.uam.es
¤ Current address: Department of Virology, Imperial College London, London, United Kingdom
Introduction
The biology of RNA viruses is heavily marked by high mutation
rates and quasispecies dynamics, relevant not only for virus
evolution but also for viral pathogenesis (review in [1]). The
adaptive potential of viral populations as they replicate in the
infected hosts represents a formidable problem for the control of
viral disease by treatment with antiviral agents. Indeed, selection
of viral mutants with decreased sensitivity to one or multiple
antiviral inhibitors is an almost systematic occurrence, mainly for
riboviruses and retroviruses [2–7]. The understanding of patho-
genic RNA viruses as quasispecies opened the way to the
exploration of a new antiviral approach termed virus entry into
error catastrophe or lethal mutagenesis. This strategy was inspired
in one of the corollaries of quasispecies theory that asserted that for
any replicating system there must be a limit to the average error
rate during template copying above which the information
conveyed by the system cannot be maintained [8–13]. Applied
to viruses, this concept implies that an increase of the viral
mutation rate by mutagenic agents should result in virus
extinction. This prediction has been amply confirmed experimen-
tally with several virus-host systems in cell culture and in vivo, using
different mutagens, notably nucleoside analogues [14–27].
One of the problems for a successful application of lethal
mutagenesis to virus extinction is the selection of mutant viruses
resistant to mutagenic agents. This problem has been manifested
with the selection of picornavirus mutants with decreased
sensitivity to the mutagenic base analogue ribavirin (1-b-D-
ribofuranosyl-1-H-1,2,4-triazole-3-carboxamide) (R) [27–31]. R
is a licensed antiviral agent that has been used over several decades
to treat some human viral infections, notably hepatitis C virus
(HCV) infections, in combination with interferon (IFN) aor IFN a
derivatives [32–35]. Since the important discovery that R is
mutagenic for poliovirus (PV) [36], R has been used as mutagenic
PLoS Pathogens | www.plospathogens.org 1 August 2010 | Volume 6 | Issue 8 | e1001072

agent in experimental studies of lethal mutagenesis of several RNA
viruses [21,27,36–42]. However, R has several mechanisms of
action [43,44] and whether R mutagenesis participates in the
elimination of HCV during treatment of chronic HCV infections
is still an open question [45–49].
Picornaviruses have contributed to the understanding of the
molecular basis of resistance to R. A poliovirus (PV) mutant with
decreased sensitivity to R included substitution G64S in its RNA-
dependent RNA polymerase (termed 3D). This substitution
confers resistance to R through a general increase in template
copying fidelity, at the cost of producing mutant spectra of lower
complexity than wt PV. Limited mutant spectrum complexity
resulted in PV populations which were less adaptable to a complex
environment, a direct proof of the essential contribution of high
mutation rates to RNA virus adaptability [29,31]. In the case of
foot-and-mouth disease virus (FMDV), resistance to R was
associated with substitution M296I in 3D. Contrary to substitution
G64S in PV, M296I did not result in increased template-copying
fidelity of the 3D of FMDV. Rather, the mutant FMDV restricted
the incorporation of RTP into RNA through an alteration of
residues in the neighborhood of the active site of 3D that did not
have a significant effect on the rate of misincorporation of the
standard nucleotides [27,50,51].
Replacement M296I was sufficient to prevent extinction of
FMDV by high concentrations of R, but the virus was
extinguished by an alternative mutagenic treatment that included
5-fluorouracil (FU) [52]. Since R-resistance mutations can
jeopardize viral extinction by lethal mutagenesis, it is of upmost
importance to understand the molecular mechanisms of R-
resistance, with the objective of designing adequate protocols for
virus extinction. FMDV with replacement M296I was selected
upon passage of the virus in the presence of increasing R
concentrations in the range of 200 mM to 800 mM included in the
cell culture medium [27]. Since R reduces the viability for BHK-
21 cells in 40% after two days of treatment [42,52,53] (see
Materials and Methods), and allowed virus replication, we tested
the response of FMDV to replication in the presence of high
concentration of R. Here we report that FMDV populations
replicated in the presence of concentrations of R in the range of
800 mM to 5000 mM, accumulated two additional amino acid
substitutions in 3D in a step-wise fashion. The substituted
polymerase displays a new molecular mechanism of R-resistance
based on modulation of the types of R-induced misincorporations
during RNA synthesis, based on an alteration of the pairing
preference of R opposite C and U. In this manner, the mutant
FMDV, but not the wild type FMDV, produces progeny RNA
that shows a balanced distribution of transition types despite
replicating in the presence of R. Studies of polymerization activity
by the purified polymerases suggest that a single amino acid
substitution in a loop of the fingers domain is the alteration chiefly
responsible of the altered mutational pattern. The crystal
structures of the substituted polymerases in complex with RNA
show a conformational change in the template entry channel of the
polymerase, that may affect the binding of the ssRNA template to
3D, mainly at the base of the template which is immediately
downstream of the position that receives the incoming nucleotide.
Alteration of the position of the template RNA at the active site of
the enzyme may affect nucleotide recognition and modify the
transition mutation pattern in the presence of R. The findings
establish a new mechanism of lethal mutagenesis-escape in viruses
which rests on regulation of the mutational spectrum in progeny
viral genomes.
Results
Adaptation of FMDV to high ribavirin concentrations
A biological clone of FMDV termed C-S8c1 is the standard
virus used in our studies of molecular evolution and lethal
mutagenesis of FMDV [54]. FMDV C-S8c1 was serially passaged
in BHK-21 cells, and a monoclonal antibody (MAb)-escape
mutant termed MARLS was isolated from the population at
passage 213 [55]. FMDV MARLS was then subjected to passages
in the presence of 200 mM to 800 mM R in the culture medium,
resulting in selection of population R-Ap35 which included amino
acid substitution M296I in 3D [27] (Figure 1). Population R-Ap35
displayed higher fitness than wild type FMDV in the presence of R
but not in its absence [27]. Although M296I was the only
replacement that became dominant in FMDV populations
passaged in the presence of R (the diagnostic nucleotide band in
the consensus sequence did not indicate any detectable amount of
an alternative nucleotide), other substitutions in 3D that did not
reach dominance were also observed [56]. To study the response
of FMDV to replication in the presence of higher concentrations
of R, population R-Ap35 was subjected to 10 additional passages
in the presence of 800 mM R, and then to 15 passages in the
presence of increasing concentration of R (from 1000 to
5000 mM), to obtain population R-Ap60 (Figure 1). Populations
R-Ap60 and R-Ap35 displayed a similar mutation frequency in
their mutant spectra (Table 1), but the specific infectivity [plaque-
forming-units (PFU)/amount of viral RNA] of R-Ap60 was 10-
fold lower than that of R-Ap35 (Table 1). These results suggest
that virus replication under increased R concentrations led to loss
of virus viability, not necessarily correlated with a significant
increase of average mutation frequency.
To test whether population of R-Ap60 was better adapted to R
than population R-Ap35, the relative fitness of the two populations
was determined in growth-competition experiments in the
presence and absence of R, using as reference the virus population
Ap35 (which is FMDV MARLS passaged 35 times in the absence
of R, as described in Materials and Methods and in [27]). The
results (Table 2) indicate that R-Ap60 is better adapted than R-
Ap35 to replicate in the presence of R. The adaptation of R-Ap60
Author Summary
Viruses that have RNA as genetic material include many
important human, animal and plant pathogens. A new
strategy against RNA viruses consists in using mutagenic
nucleotides. The objective is to provoke an excessive
number of mutations, to deteriorate the viral functions to
the point that the virus can not survive. One of the
mutagens used in research on lethal mutagenesis is
ribavirin, extensively employed in clinical practice. Unfor-
tunately, viral mutants that are resistant to ribavirin have
been selected, thus facilitating escape from lethal muta-
genesis. Here we describe a new mechanism by which
foot-and-mouth disease virus (FMDV) can become resis-
tant to ribavirin. Amino acid changes in the viral
polymerase, selected by ribavirin, are able to modify the
types of mutations produced in the presence of ribavirin.
Biochemical data indicate that the alteration of the
enzyme changes the pairing behavior of ribavirin, avoiding
the production of an excess of some types of mutations,
supporting the hypothesis that an unbalanced mutation
repertoire is detrimental to the virus. Thus, this new
mechanism of resistance to ribavirin is based not as much
in limiting the number of mutations in the virus genetic
material but in ensuring an equilibrium among different
types of mutations that favors viral survival.
Adaptation through Transition Types
PLoS Pathogens | www.plospathogens.org 2 August 2010 | Volume 6 | Issue 8 | e1001072

resulted from a specific response of FMDV to R, since the fitness
of R-Ap60 relative to R-Ap35 in the presence of FU and
guanidine hydrochloride (GuH) (an alternative mutagenic combi-
nation used in lethal mutagenesis of FMDV [52]) was 0.7 (Table 2).
Thus, FMDV underwent a progressive adaptation to replicate
efficiently under high R concentration.
Adaptation of FMDV to high ribavirin concentrations
entails additional substitutions in 3D
To study whether adaptation of FMDV to increased concen-
trations of R was associated with additional substitutions in 3D,
the consensus nucleotide sequence of the 3D-coding region of R-
Ap35 and R-Ap60 was analyzed (Table 3). Two new mutations
were found as dominant in R-Ap60: C6739U (that gives rise to
amino acid substitution P44S in 3D), and C7114U (that gives rise
to P169S in 3D). In addition, 3D maintained as dominant
substitution M296I which was already dominant in R-Ap35
[27,50]. P44S but not P169S was detected in a 70% proportion in
R-Ap35, as evidenced by analysis of both the consensus sequences
and their corresponding mutant spectra (Table 3). These results
suggest that the three substitutions in 3D were selected sequentially
during replication in the presence of increasing concentrations of
R: first M296I, then P44S and finally P169S.
The replacements in 3D increase FMDV fitness in the
presence of ribavirin
To investigate the effect of the 3D substitutions in the sequence
context of pMT28 (the plasmid from which C-S8c1 is expressed
[57]) without possible confounding effects of other mutations in
the viral genome, plasmids pMT28-3D(M296I), pMT28-
3D(P44S), pMT28-3D(P169S), pMT28-3D(P44S, M296I) and
pMT28-3D(SSI) (SSI means the presence of the triple replacement
P44S, P169S and M296I in 3D) were constructed as described in
Materials and Methods. These plasmids encode the genome of C-
S8c1 with the mutations that give rise to the indicated substitutions
in 3D, as the only difference with respect to the wild type sequence
(pMT28 or C-S8c1 [57]). BHK-21 cells were transfected with the
corresponding RNA transcripts and the rescued viruses [termed
FMDV 3D(M296I), FMDV 3D(P44S), FMDV 3D(P169S),
FMDV 3D(P44S, M296I) and FMDV 3D(SSI), respectively] were
tested regarding infectious progeny production (Figure 2). FMDV
3D(M296I), FMDV 3D(P44S, M296I), and FMDV 3D(SSI), but
Figure 1. Passage history of FMDV in the presence of increasing cencentrations of ribavirin. Biological clone C-S8c1of FMDV was
subjected to up to 460 serial passages in BHK-21 cells [70,92]. Al passage 213, biological clone MARLS was selected by its resistance to neutralization
by monoclonal antibody (MAb) SD6 [55], and the population derived from the clone was subjected to serial passages either in the absence (white
circles) or presence (grey circles) of increasing concentrations of ribavirin (R) [60]. In this scheme biological clones (virus derived from a single plaque
developed on a BHK-21 cell monolayer) are indicated as black squares, and uncloned populations as circles; ‘‘p’’ indicates passage number. The
concentrations of R included in the culture medium are indicated below the corresponding passages. The procedures involved in the isolation of the
initial FMDV C-S8c1 clone and in infections of BHK-21 cells have been described in our previous studies [55,60,70,92] and are detailed in Materials and
Methods.
doi:10.1371/journal.ppat.1001072.g001
Table 1. Specific infectivity of mutant FMDV populations.
Population Mutation Frequency
a
Virus titer (PFU/ml)
b
RNA (molecules/ml)
b
Specific infectivity
b
R-Ap35 4.2610
23
1.460.1610
7
0.860.1610
11
18610
25
R-Ap60 3.2610
23
0.260.0610
7
1.060.0610
11
2610
25
a
Mutation frequencies are based on the analysis of 18,620 nucleotides of the mutant spectrum of R-Ap35 (14 molecular clones) and 19,950 nucleotides for R-Ap60 (15
molecular clones). For each clone the genomic region analysed comprised residues 6610 to 8020 (residue numbering is according to [93]).
b
Values of virus titer and RNA molecules are the average of three determinations, and standard deviations are given. The specific infectivity was calculated as PFU/RNA
molecules (ratio of values in the third to the fourth column). Procedures are detailed in Materials and Methods.
doi:10.1371/journal.ppat.1001072.t001
Adaptation through Transition Types
PLoS Pathogens | www.plospathogens.org 3 August 2010 | Volume 6 | Issue 8 | e1001072

not FMDV 3D(P44S) and FMDV 3D(P169S), showed lower
progeny production in the absence of R. Fitness measurements in
the absence and presence of R (Table 4) indicate that the triple
replacement P44S, P169S and M296I conferred on the virus a
selective advantage in the presence of R. The addition of P169S to
a virus harboring P44S and M296I provided an advantage during
replication in the presence of 5000 mM but not 800 mMR.A
direct competition showed a selective advantage of FMDV(SSI)
over FMDV 3D(M296I) in the presence of 5000 mM R. P44S and
P169S individually did not inflict a fitness cost upon the virus in
the absence of R, whereas M296I and the triple combination did
(Table 4).
The three dominant substitutions in the polymerase of the
clonal FMDV 3D(SSI) failed to reproduce the fitness difference
between populations R-Ap60 and R-Ap35 in the presence of R
(compare Tables 2 and 4). This means that factors other than the
Table 2. Fitness of mutant FMDV populations.
Population Fitness Value
a
Absence of R 800
m
M R 5000
m
M R FU (300
m
g/ml)
+
GuH (4 mM)
R-Ap35 0.5
R
2
= 0.87
4
R
2
= 0.95
n.d. n.d.
R-Ap60 0.6
R
2
= 0.75
11
R
2
= 0.98
15
R
2
= 0.99
0.7
R
2
= 0.82
a
Relative fitness values were determined by growth competition experiments between Ap35 (reference virus) and either population R-Ap35 or R-Ap60 in the absence or
presence of the indicated drug concentrations (R, ribavirin; FU, 5-fluorouracil; GuH, guanidine hydrochloride). n.d., not determined. R
2
values of the fitness vector (linear
regression) are given the corresponding box. Procedures are detailed in Materials and Methods.
doi:10.1371/journal.ppat.1001072.t002
Table 3. Consensus sequence and mutant spectrum composition of the 3D-coding region of FMDV R-Ap35 and R-Ap60, and
deduced amino acid substitutions.
Mutations in the consensus sequence
a
Amino acid substitution
b
Frequency of amino acid substitutions in mutant spectra
c
R-Ap35 R-Ap60 R-Ap35 R-Ap60
C6739C/U C6739U P44S 0.71 1
A6741G =
C6744U =
C6975U =
A7003A/U I132V 0.50 0.13
G7098G/A G7098A =
C7114U P169S 01
C7350C/U =
C7374A =
C7404C/U C7404U =
C7413U =
U7419C =
G7453G/A E282K 0.43 0
G7497A G7497A M296I 11
C7506C/A C7506A =
C7548C/U C7548U =
G7554U =
U7569C =
C7935C/U C7935U =
C7947U =
a
Mutations found in the consensus sequence at the 3D-coding region of populations R-Ap35 and R-Ap60, relative to the genomic sequence of the parental FMDV
MARLS (Figure 1). Two nucleotides separated by a dash indicate the presence of a mixture, as judged from the nucleotide sequence chromatogram. FMDV genomic
residues are numbered as previously described [93]. Procedures for nucleotide sequencing are described in Materials and Methods.
b
Amino acid substitutions in 3D that result from the mutations found in R-Ap35 or R-Ap60 populations indicated in the first two columns. Replacements that are totally
imposed in R-Ap35 or R-Ap60 are underlined. ‘‘ = ’’means a synonymous mutation.
c
Frequency of the amino acid that results form each mutation, as indicated in the third column (S44, V132, S169, K282, I296) found in two or more molecular clones from
the corresponding mutant spectrum. Mutations and deduced amino acid substitutions are based on the analysis of 18,620 nucleotides of the mutant spectrum of the
3D-coding region from population R-Ap35 (14 clones), and 19,950 nucleotides in the case of R-Ap60 (15 clones). Procedures for mutant spectrum analysis are described
in Materials and Methods.
doi:10.1371/journal.ppat.1001072.t003
Adaptation through Transition Types
PLoS Pathogens | www.plospathogens.org 4 August 2010 | Volume 6 | Issue 8 | e1001072

three dominant replacement in 3D must intervene to confer the
growth advantage of R-Ap60 in the presence of R (see Discussion).
These additional factors are presently under investigation.
The mutant spectrum of pMT28-3D(SSI) passaged in the
presence of ribavirin reveals an unexpected repertoire of
mutations
The mutant spectra of FMDV populations passaged in the
absence of drugs display a balance among the four types of
transition mutations with a slight dominance of URC and ARG
versus CRU and GRA [27,58–60]. However, FMDV replication
in the presence of R inverted this trend, and resulted in a clear
dominance of CRU and GRA transitions [27,42], as also
observed with poliovirus (PV) replicating in the presence of R
[21,36]. It was suggested that the bias in favor of CRU and GRA
observed in FMDV could reflect a preference for ribavirin-59-
monophosphate (RMP) to be incorporated by 3D polymerase
more efficiently opposite to C than U in the template, but this was
not supported by the biochemical data on the incorporation of
RMP by purified FMDV 3D using heteropolymeric template-
primers [27]. The biased mutation types during intracellular viral
replication could be influenced by the decrease in intracellular
GTP levels due to the inhibition of inosine monophosphate
dehydrogenase (IMPDH) by ribavirin-monophosphate (RMP)
[42,43,61], although previous studies suggested a minor effect of
decreased intracellular concentration of GTP on the mutagenic
activity of R on FMDV [42].
To explore possible variations in mutation frequency and in the
types of mutations as a result of R treatment, FMDV wild type
(Wt) (rescued from plasmid pMT28) and FMDV 3D(SSI) were
subjected either to five passages in the absence of R (that gave rise
to populations abbreviated as Wt-5 and SSI-5, respectively) or to
four passages in the presence of 5000 mM R (that gave rise to
populations abbreviated as R-Wt-4 and R-SSI-4, respectively).
The comparison of mutation frequencies in the mutant spectrum
of the different populations showed a 3.5-fold increase in both
viruses after passage in the presence of R, as expected [27,42,52],
but no significant difference in mutation frequency between Wt-5
and SSI-5 (t = 0.45, P.0.1; t Student’s test) or between R-Wt-4
and R-SSI-4 (t = 1.16, P.0.1; t Student’s test) was seen (Table 5).
The mutant spectra of Wt-5 and SSI-5 showed a similar
Figure 2. Progeny production in BHK-21 cells infected with viruses encoding mutant polymerases. Kinetics of progeny production of
infectious virus in BHK-21 infected cells infected at a MOI of 0.5 PFU/cell by the indicated FMDVs. Data have been divided in two separate graphs for
clarity. Results are the average of three determinations and standard deviations are given. Procedures are described in Materials and Methods.
doi:10.1371/journal.ppat.1001072.g002
Adaptation through Transition Types
PLoS Pathogens | www.plospathogens.org 5 August 2010 | Volume 6 | Issue 8 | e1001072

distribution of mutation types (x
2
= 0.02, P.0.1; x
2
test), with a
slight dominance of URC and ARG, as previously found in
FMDV populations that had replicated in the absence of R
[27,58–60]. However, the mutation pattern of R-SSI-4 was
unexpected for a virus passaged in the presence of a high
concentration of R. While in the mutant spectrum of R-Wt-4 the
bias in favor of CRU and GRA transitions reached 80%, in R-
SSI-4 these transition types amounted to 34% of the total number
of mutations. Thus, the repertoire of transition types remained
balanced in FMDV 3D(SSI) despite replication in the presence of
R, in sharp contrast with FMDV Wt which presented a gross
imbalance in favor of CRU and GRA transitions. The ratio
(CRU)+(GRA)/(URC)+(ARG) in the mutant spectra of R-SSI-4
and SSI-5 was virtually identical (x
2
= 0.49, P.0.1) (Table 5). This
result indicates a remarkable insensitivity to the presence of R
regarding the mutations represented in progeny RNA when
replacements P44S, P169S and M296I were present in 3D. The
insensitivity to R could not be attributed to the absence of
replication of FMDV 3D(SSI) in the presence of R since in fact this
virus replicates more efficiently than wild type in the presence of R
(Table 4). Thus, R-Wt-4 and R-SSI-4 displayed a highly
significant difference regarding mutation types in their mutant
spectra (x
2
= 13.3, P,0.001). These results suggest that adaptation
of FMDV to high R concentrations was related to modulation of
the types of transitions imposed by the pairing behavior of RMP,
preventing a highly biased mutation pattern in progeny genomes.
FMDV 3D(SSI) is resistant to extinction by ribavirin
To investigate whether FMDV 3D(SSI) was resistant to extinction
by R, FMDV Wt and FMDV 3D(SSI) were subjected to serial
cytolytic passages in BHK-21 cells in the presence or absence of
5000 mM R. The wild type population was extinguished by passage 7,
as expected [52] (Figure 3A). In contrast, FMDV 3D(SSI) was not
extinguished and, interestingly, the virus titer decreased until passage
6, and then it increased (Figure. 3B). While the specific infectivity of
FMDV Wt decreased in the presence of R, the specific infectivity of
FMDV 3D(SSI) was very similar in the R-treated and untreated
populations (Figure. 3C,D). The consensus nucleotide sequence of the
genome of FMDV 3D(SSI) at passage 10 in the presence of R
indicated that only one additional mutation (in the non-structural
protein 2C-coding region) became dominant in the entire genome
(data not shown). The biological significance of this mutation in the
2C-coding region is under investigation. Substitutions P44S, P169S
and M296I in 3D were maintained as dominant in the population
that escaped extinction and gained replication capacity.
To further substantiate the hypothesis that substitutions P44S,
P169S and M296I confer a selective advantage in the presence of R
but not in the presence of another mutagen that induces a different
mutational repertoire, growth-competition experiments between
FMDV Wt and FMDV 3D(SSI) were carried out in the presence of
either R or FU (a mutagen which induces mainly URCandARG
transition in FMDV [58,60]) or a mixture of R and FU. The results
(Table 6) show that a selective advantage of FMDV 3D(SSI) was
manifested in the competitions carried out in the presence of R, but
not in the presence of FU or of a mixture of R and FU.
Substitution P44S decreases 3D activity
To investigate the effects of substitutions P44S, P169S and
M296I on 3D activity, the wild type polymerase (termed 3DWt),
the polymerases that include the individual substitutions [termed
3D(P44S), 3D(P169S) and 3D(M296I)] and the polymerase with
the three substitutions [termed 3D(SSI)] were purified as detailed
in Materials and Methods and compared in RNA polymerization,
VPg-uridylylation and RNA-binding assays (Table 7). 3D(P44S)
and 3D(SSI) showed lower activity than the other enzymes in
Table 4. Fitness value of mutant FMDV populations.
FMDV in the competition Fitness Value
a
Absence of R 800
m
M R 5000
m
MR
P44S/Wt 1.1
R
2
= 0.93
1.2
R
2
= 0.62
n.d.
P169S/Wt 1.2
R
2
= 0.90
2
R
2
= 1.00
3
R
2
= 0.96
M296I/Wt 0.6
R
2
= 0.83
4
R
2
= 0.97
n.d.
SSI/Wt 0.7
R
2
= 0.91
4
R
2
= 1.00
2
R
2
= 0.93
SSI/(M296I) 0.5
R
2
= 0.96
0.6
R
2
= 0.73
6
R
2
= 0.93
SSI/(P44S, M296I) 0.2
R
2
= 0.92
0.3
R
2
= 0.95
2
R
2
= 0.80
a
Relative fitness values obtained in the competitions between the clonal FMDV
population depicted in bold letters (that indicate the amino acid substitution
in 3D; SSI means the triple mutant FMDV 3D(P44S, P169S, M296I) relative to the
population depicted in regular letters [wild type, wt, mutant FMDV (M296I) or
the double mutant FMDV 3D(P44S, M296I)]. Fitness was determined in the
absence or in the presence of the indicated concentration of R. n.d., not
determined. R
2
values of the fitness vector (linear regression) are given in each
case. Procedures are detailed in Materials and Methods.
doi:10.1371/journal.ppat.1001072.t004
Table 5. Frequency and types of transition mutations in the mutant spectra of FMDV populations passaged in the presence or
absence of 5000 mMR
a
.
FMDV
population
Mutation frequency (substitutions/
nucleotide) (CRU)
+
(GRA) (% of total)
b
(URC)
+
(ARG) (% of total)
b
Ratio C?UðÞ+G?AðÞ
U?CðÞ+A?GðÞ
Wt-5 6610
24
22 78 0.28
SSI-5 4610
24
27 55 0.49
R-Wt-4 19610
24
80 20 4.00
R-SSI-4 13610
24
34 63 0.53
a
Mutation frequencies and mutation types are based on the analysis of 31,770 nucleotides of the mutant spectrum of Wt-5 (23 molecular clones), 23,780 nucleotides for
SSI-5 (17 molecular clones), 32,664 nucleotides for R-Wt-4 (24 molecular clones) and 26,332 nucleotides for R-SSI-4 (19 molecular clones). For each clone the genomic
region analysed comprised residues 6610 to 8020.
b
Percentage of CRUplusGRA transitions or URCplusARG transitions relative to the total number of mutations found in the mutant spectra of the indicated
populations.
doi:10.1371/journal.ppat.1001072.t005
Adaptation through Transition Types
PLoS Pathogens | www.plospathogens.org 6 August 2010 | Volume 6 | Issue 8 | e1001072

poly(rU) synthesis and in binding to heteropolymeric RNA. In
addition, 3D(P44S) displayed a modest decrease in VPg-uridylyla-
tion activity. The comparison of activity values in vitro suggests that
amino acid P44S inflicted a cost upon 3D function.
Mutant polymerase 3D(SSI) is deficient in the
incorporation of ribavirin-59-triphosphate and shows a
bias to favor misincorporation of RMP opposite U
Previous studies documented that 3D(M296I) displayed a defect
in the incorporation of RTP opposite either U and C, in
comparison with 3D Wt [27,50]. The capacity of 3DWt,
3D(P44S), 3D(P169S), 3D(M296I) and 3D(SSI) to use RTP as
substrate, and to incorporate RMP opposite U and C was
investigated using two symmetrical/subtrate template-primer
RNAs [62], termed sym/sub-AC and sym/sub-AU (AC and AU
indicate the two template residues that direct the elongation of the
primer RNA in two positions, and that allow quantification of the
incorporation of R at position +2, opposite C and U, respectively)
(Figures 4 and 5). No significant differences in the incorporation
GTP of and ATP by 3DWt and 3D(SSI) were observed.
Additional experiments were carried out using 1 mM GTP or
Figure 3. Effect of ribavirin on progeny infectivity and viral RNA in serial infections with FMDV Wt or FMDV 3D(SSI). (A) BHK-21 cells
(2610
6
) were infected with wild type FMDV (Wt) (progeny of infectious clone pMT28 [57,70]) at a multiplicity of infection of 0.3 PFU/cell. In successive
passages, the same number of cells was infected with 1:10 of the volume of the supernatant from the previous passage in the absence (2R) or in the
presence of 5000 mMR(+R). The discontinuous line indicates the limit of detection of viral infectivity. (B) Same as (A), using mutant FMDV 3D(SSI). (C)
and (D) FMDV RNA levels in the supernatants of BHK-21 cells infected with FMDV Wt or FMDV 3D(SSI) in the absence (2R) or presence (+R) of
5000 mM R. The discontinuous line indicates the limit of detection of viral RNA. (E) and (F) Specific infectivity (PFUs/RNA molecules) calculated from
the data in panels (A) to (D). The specific infectivity from passage 7 of FMDV Wt in the presence of R was not calculated due to undetectable virus titer
(,5 PFU/ml). Procedures are described in Materials and Methods.
doi:10.1371/journal.ppat.1001072.g003
Adaptation through Transition Types
PLoS Pathogens | www.plospathogens.org 7 August 2010 | Volume 6 | Issue 8 | e1001072

ATP at 37uCor33uC, with sym/sub-AC, sym/sub-AU, sym/sub-
C and sym/sub-U; again, no differences in the incorporation by
3DWt and 3D(SSI) were observed (Supplementary material,
Figures S1, S2, S3). In all cases, the mutant 3Ds were less efficient
in RMP incorporation than 3DWt. Interestingly, the incorpora-
tion of RMP opposite C was 3-fold lower for 3D(SSI) than for
3D(M296I), but no such difference was observed when the
incorporation of RMP was measured opposite U (Figure 5).
3D(P44S) displayed undetectable incorporation of RMP opposite
C in the template (,0.5% of elongated sym/sub-AC), and only a
modest incorporation opposite U (561% of elongated sym/sub-
AU). Thus, the incorporation of RMP by 3D(P44S) is at least 10-
fold more efficient opposite U than opposite C, suggesting that
P44S is the substitution responsible for the biased repertoire of
transition mutations during replication of FMDV 3D(SSI) in the
presence of R. Comparison of the results of 3D activity (Table 7)
and of RMP incorporation (Figures 4 and 5) suggests that
substitutions P169S and M296I could exert some compensatory
effect to confer 3D with P44S a sufficient polymerization activity
while maintaining a limited and biased RMP incorporation. The
specific bias displayed by 3D(SSI) against incorporation of RMP
opposite C determined in vitro, is consistent with the proportion of
transition types observed during replication of FMDV 3D(SSI) in
the presence of R during infections of BHK-21 cells (compare
Figures 4, 5 and Table 5). FMDV 3D(SSI) populations did not
display a significantly lower mutant spectrum complexity than
FMDV Wt (Table 5), suggesting that the biased incorporation of R
is not directly linked to a significant change in the average
template copying fidelity as regards the misincorporation of
standard nucleotides. However, this point is under further
investigation.
The structure of the 3D mutant polymerases and their
complexes with RNA
To identify possible structural modifications of the viral
polymerase associated with the important alterations of the
mutational spectrum in progeny RNA, and to investigate how these
modifications can affect RNA binding and polymerase activity, the
different mutant 3Ds were incubated with the heteropolymeric sym/
sub-U RNA of sequence 59GCAUGGGCCC39, crystallized, and
analyzed by X-ray diffraction. Sym/sub- U indicates that U is the
template residue which directs the incorporation of A to produce a
+1 elongation product. This is the same RNA used in our previous
structural studies with FMDV 3D [63–65] (see Materials and
Methods). For the structural comparisons RNA residues are
numbered starting at the 59terminal nucleotide.
Two different crystal forms were obtained (Table 8); the single
mutants 3D(P44S) and 3D(P169S) incubated with sym/sub-U
RNA crystallized in the tetragonal P4
2
2
1
2 space group. The RNA
molecule appeared mostly disordered in the two structures. In
contrast, 3D(SSI) crystallized in the trigonal P3
2
21 space group
with the sym/sub-U RNA incorporated in the structure. Since the
biochemical results indicate that P44S plays a critical role in the
misincorporation of RMP into RNA by 3D, and a 3D(P44S)-RNA
complex was not obtained, we attempted the crystallization of the
double mutant 3D(P44S, M296I) in complex with RNA. 3D(P44S,
M296I) also crystallized in the space group P3
2
21 space group,
with the sym/sub-U RNA incorporated in the structure.
Further attempts to obtain the structures of ternary complexes,
using ATP or RTP were unsuccessful, despite using different
substrate concentrations and incubation times. The X-ray
structures were determined to 2.2 A
˚and 2.6 A
˚resolution for
3D(P44S) and 3D(P169S), respectively, and to 2.6 A
˚and 2.5 A
˚for
3D(P44S, M296I) and 3D(SSI), respectively (Table 8). The quality
Table 6. Fitness of FMDV 3D(SSI) relative to FMDV Wt in the
presence of R, FU, or a mixture of R and FU.
Drug Fitness value SSI/Wt
a
Absence of drug 0.960.1
R
2
= 0.64; R
2
= 0.07; R
2
= 0.44
Ribavirin 2.960.3
R
2
= 1.00; R
2
= 0.99; R
2
= 0.98
5-Fluorouracil 1.060.1
R
2
= 0.99; R
2
= 0.69; R
2
= 0.03
Ribavirin
+
5-Fluorouracil 1.460.5
R
2
= 0.97; R
2
= 0.98; R
2
= 0.27
a
Growth-competition experiments were initiated by infecting 2610
6
BHK-21
cells with 7610
5
PFU of FMDV Wt and FMDV 3D(SSI) in the absence of drugs or
in the presence either of 5000 mM R, 2000 mM FU or a mixture of 5000 mMR
and 2000 mM FU, as indicated in the first column. Progeny virus was used to
infect fresh BHK-21 cells monolayers under the same conditions. A total of 3
passages were carried out. The initial population and the populations at
passages 1, 2 and 3 were sequenced and the proportion of the two competing
genomes were determined by nucleotide sequencing and measurement of the
areas of the relevant bands. The three R
2
values given correspond to each of
the three determinations. The average fitness value and standard deviation are
given. Drug treatment of cells and calculation of relative fitness are described
in Materials and Methods.
doi:10.1371/journal.ppat.1001072.t006
Table 7. Activity of mutant FMDV polymerases (3D)
a
.
3D
Poly(rU) synthesis
b
(pmol UTP
m
g
21
min
21
) VPg uridylylation
c
(pmol UTP
m
g
21
min
21
) RNA binding
d
(% RNA retarded)
wt 16169 0.4360.02 62611
P44S 89618 0.2660.07 33611
P169S 182629 0.4160.06 58612
M296I 182620 0.4960.04 6368
SSI 104615 0.4660.10 34610
a
Procedures for the expression and purification of wild type and mutant 3Ds and the assays used have been previously described [27,50,63,65,67], and are detailed in
Materials and Methods.
b
Poly(rU) synthesis is calculated as pmol UTP incorporated per mg of enzyme per min.
c
VPg uridylylation activity is calculated as pmol UTP incorporated into VPg per mg of enzyme per min.
d
RNA binding is calculated as % of RNA template-primer retarded by 1.8 mM enzyme at 10 min reaction time, by dividing the labelled bound (retarded) product by the
total labelled RNA and multiplying by 100. The relative amount of labeled RNA was visualized and quantitated with a Phosphorimager (BAS-1500; Fuji).
doi:10.1371/journal.ppat.1001072.t007
Adaptation through Transition Types
PLoS Pathogens | www.plospathogens.org 8 August 2010 | Volume 6 | Issue 8 | e1001072

of the resulting difference electron density maps allowed the
unequivocal tracing of the mutated and surrounding residues that
were omitted from the initial models to eliminate model bias
(Figure 6). The analysis of the electron density showed also the
presence of the duplex portion of the template-primer RNA in the
central channel of the polymerase of the trigonal 3D(P44S, M296I)
and 3D(SSI) crystals. In addition, two of the four nucleotides of the
59overhang moiety (A3 and U4) were reasonably well defined,
occupying the template channel, in both structures.
No major structural changes were observed in the polymerase
active site when the structures of the different polymerases (either
unbound or bound to RNA) were compared. The structural
superimpositions of all 476 amino acids residues of 3D(P44S) and
3D(P169S) and of 3D(P44S, M296I) onto the 3D(SSI) showed root
mean square deviation (rmsd) values of 0.46A
˚, 0.35A
˚and 0.22A
˚,
respectively.
Subtle domain movements, in particular a ,1urotation of the
thumb domains relative to the fingers, were observed between the
unbound, tetragonal, and the RNA-bound, trigonal structures
when the individual domains were superimposed. When the
unbound and RNA-bound structures were compared for 3DWt a
similar small rotation (,2u) was also observed. As a consequence
of this rotation, the active site appeared more closed in the
unbound state. Thus, the changes observed seem to be a
consequence of either RNA-binding, or of the different packing
constraints in the tetragonal and trigonal space groups or both, but
they do not seem to be related to the presence of substitutions
P44S or P169S.
Figure 4. Incorporation of nucleotides into sym/sub-AC by mutant FMDV polymerases. (A) Kinetics of incorporation of GMP into sym/sub-
AC (sequence shown at the top) by the indicated FMDV polymerases. The reactions were initiated by addition of 50 mM GTP after the formation of
3D-RNA(n+1) complex, as described in Materials and Methods. At different time points the reaction was quenched by addition of EDTA. (B) Same as
(A), except that the reaction was started by addition of 50 mM RTP after the formation of the 3D-RNA (n+1) complex. (C) Percentage of primer
elongated to position +2 (12 mer or larger RNAs synthesized), calculated from the densitometric analysis of the electrophoreses shown in A. The
results are the average of three independent experiments, and standard deviations are given. (D) Same as (C) for the incorporation of RMP at position
+2 (12 mer) calculated from the densitometric analysis of the electrophoreses shown in (B). Procedures are detailed in Materials and Methods.
doi:10.1371/journal.ppat.1001072.g004
Adaptation through Transition Types
PLoS Pathogens | www.plospathogens.org 9 August 2010 | Volume 6 | Issue 8 | e1001072

The 3D(P44S, M296I)-RNA and 3D(SSI)-RNA structures are
almost identical (rmsd of the superimposition of all polymerase
residues of 0.22A
˚). These structures are also similar to the structure
of 3D(M296I)-RNA mutant complex determined previously (PDB
3KOA; [51]), and to the wild type 3D-RNA complex (PDB
1WNE; [63]), with rmsds of 0.33A
˚and 0.38A
˚, respectively.
Compared to the wild type 3D, two significant changes are
observed in the substituted 3Ds: a conformational change in loop
b9-a11 (where substitution M296I lies) and a structural rear-
rangement of the N-terminus of the polymerase. The conforma-
tion and interactions of loop b9-a11 are identical in the 3D(P44S,
M296I) and 3D(SSI) complexes, retaining the same structure that
was previously observed in 3D (M296I) in complex with RNA
[51]. All mutants that contain the substitution M296I show a
rearreagement in the loop b9-a11, consisting in a rotation of the
peptide bonds Ser298-Gly299 and Cys300-Ser301 (Figure 7).
These residues were found hydrogen bonded to the incoming RTP
molecule in the structure of the ternary complex between the wild
type 3D-RNA-RTP [65], and also interacting with the template
acceptor nucleotide in all structures analyzed [51,65,66] (Figure 7).
Interestingly, the amino acid residues from M16 to K18, at the
N-terminus of the enzyme, appear totally re-organized (Figure 8).
This region, together with residues T115 to A122 of motif G and
amino acids Q160, F162 and T181 of motif F, form the template
channel that binds the 59overhang region of the template, driving
the ssRNA to the active site cavity [64]. The structures of the wild
type 3D-RNA elongation complexes as well as the structure of the
mutant 3D(M296I)-RNA complex show that R17 interacts with
the sugar-phosphate backbone of template nucleotide A3 that is
oriented towards the active site cavity (Figure 9; [64,65]). In
3D(P44S, M296I)-RNA and 3D(SSI)-RNA complexes the re-
oriented residue R17 points to the polymerase interior, interacting
with the side chain of residues N41 (which lies in the same loop of
the substituted amino acid S44), and with Y285. Nucleotide A3
appears also reoriented, flipped-out towards a pocket formed by
amino acids M16, P117, G118, Q160, F162, V181 and V183
Figure 5. Incorporation of nucleotides into sym/sub-AC by mutant FMDV polymerases. Kinetics of incorporation of AMP into sym/sub-AU
(sequence shown at the top) by the indicated polymerases. The reactions were initiated by addition of 50 mM ATP after the formation of 3D-RNA
(n+1) complex. At different time points the reaction was quenched by addition of EDTA. (B) Same as (A), except that the reaction was started by
addition of 50 mM RTP after the formation of 3D-RNA (n+1) after formation of the 3D-RNA (n+1) complex. (C) Percentage of primer elongated (12 mer
or larger RNAs synthesized) calculated from the densitometric analysis of the electrophoreses shown in (A). The results are the average of three
independent experiments, and standard deviations are given. (D) Same as (C) for the incorporation of RMP at position +2 (12 mer) calculated from the
densitometric analysis of the electrophoreses shown in (B). Procedures are detailed in Materials and Methods.
doi:10.1371/journal.ppat.1001072.g005
Adaptation through Transition Types
PLoS Pathogens | www.plospathogens.org 10 August 2010 | Volume 6 | Issue 8 | e1001072

(Figure 8). These structural results indicate that the small
movements in the loop, that contains the substituted residue
S44, facilitate the large conformation changes of the 3D N-
terminal residues M16-K18, and the reorientation of the template
nucleotide A3. The rearrangements in M16-K18 were also
observed in the uncomplexed 3D(P44S), but with a weak electron
density and higher temperature factors than the average, reflecting
some degree of flexibility of this region in the absence of RNA.
Finally, no significant structural changes were observed
associated with substitution P169S. Thus, the structural results
point at P44S as the key substitution related to reorientation of
template residues that might be associated with altered RMP
recognition and incorporation.
Discussion
The great adaptive capacity of RNA viruses to adverse
environmental conditions has been fully manifested in the present
study with the selection of mutant polymerases capable of biasing
the incorporation of RMP so as to modulate the overall mutation
types in progeny genomes. The adaptation of FMDV to high R
concentrations was mediated by the sequential selection of M296I,
P44S and P169S in 3D, with P44S being the main responsible for
maintaining a balance of transition types in progeny RNA
synthesized in the presence of R. The three amino acid substitutions
in 3D were the result of mutation types that are favored during
replication of FMDV in the presence of R: a GRA transition in the
case of M296I, and a CRU transition in the case of P44S and
P169S. Except for P44S and P169S when present individually in
3D, the substitutions in 3D had as consequence a modest but
consistent decrease in viral fitness when measured in the absence of
R. None of the three replacements in 3D has been previously
observed in FMDV C-S8c1 populations (or their mutant spectra)
passaged in the absence of R or in the presence of FU or 5-
azacytidine [16,27,42,53,58–60,67–71]. Thus, they were selected as
a specific response to R and, as expected, the combination of the
three substitutions increased FMDV fitness during virus replication
in the presence of R (Table 4). Remarkably, the selective advantage
of FMDV expressing 3D with the triple combination P44S, P169S,
M296I over virus expressing 3D with P44S and M296I was
manifested in growth-competition experiments carried out in the
presence of 5000 mM R but not in the presence of 800 mM R. Thus,
P169S appears to have been selected to contribute a fitness increase
in the presence of high R concentrations to a virus that had already
acquired the capacity to modulate the mutational spectrum through
substitution P44S in 3D. Additional growth-competition experi-
ments between wild type and the triple mutant FMDV indicated
that the substituted polymerase conferred a selective advantage
when the virus replicated in the presence of R but not of FU or a
mixture of R and FU, supporting a specific adaptative response in
front of ribavirin (Table 6). The result is consistent with the fitness
advantage of R-Ap60 over Ap35 in the presence of R but not of
FU+GuH (Table 2). Since FU tends to evoke the opposite transition
types than R [58,60], the outcome of the competitions reinforces
modulation of transition types as a major factor for the survival of
FMDV 3D(SSI) in the presence of ribavirin.
It may be argued that selection of the multi-substituted
polymerase occurred as a result of subjecting the virus to
Table 8. Data collection and refinement statistics
a
.
3D(P44S) 3D(P169S) 3D (P44S,M296I) 3D(SSI)
Resolution (A
˚)30- 2.28 30- 2.6 30- 2.6 30- 2.5
Space group P4
1
2
1
2P4
1
2
1
2P3
2
21 P3
2
21
Unit cell dimensions (A
˚)a = b = 93.53
c = 121.010
a = b = 93.834
c = 121.687
a = b = 93.713
c = 99.723
a = b = 93.836
c = 99.867
Total data 160380 110453 83589 129958
Unique data 24188 14688 15946 18935
Completeness(%) 96.6 99.8 99.6 99.6
Mean I/s(Di) 16.6 18.4 14.8 16.2
Rmerge (%) 7.6 10.3 11.0 9.3
R
work
23.4 22.5 22.6 22.2
R
free
26.5 26.0 27.4 25.4
Number of residues
Protein 476 476 476 476
Solvent atoms -454441
Ions -22 0
Ribonucleotides - 5 12 12
R.m.s. deviation from ideal geometry
Bond lengths (A
˚)0.006 0.006 0.006 0.006
Bond angles (u)0.85 0.84 0.86 0.84
Avg. Temp. Factors (A
˚)
Protein 31.5 34.0 26.0 27.7
Solvent and ions 23.9 26.3 31.179 33.6
Ribonucleotides - - 69.0 66.2
a
Crystallographic procedures are described in Materials and Methods.
doi:10.1371/journal.ppat.1001072.t008
Adaptation through Transition Types
PLoS Pathogens | www.plospathogens.org 11 August 2010 | Volume 6 | Issue 8 | e1001072

extremely large ribavirin concentrations, unlikely to be reached
during any standard antiviral treatment with R. Certainly, the
concentrations used were not intended to reproduce actual R
concentrations in the course of treatments with R in clinical
practice. In the case of direct aerosol application of R to the upper
respiratory tract the drug may reach intracellular concentrations of
around 800 mM [72,73]. Other modes of administration are
unlikely to achieve such high concentrations. For example,
intravenous administration of R results in peak concentrations in
the range of 20 mM to 150 mM [74,75] while oral administration
resulted in concentrations between 10 mM and 20 mM in serum
and cerebrospinal fluid [74,76–78]. Thus, unless procedures for
targetted delivery of R to specific cells or tissues are developed, it is
unlikely that concentrations equivalent to those used in our
experiments would be encountered in vivo. Do the high
concentrations of R used in our experiments weaken the relevance
of the conclusions? We think not for two reasons: (i) the actual
concentration of RTP in the replication complexes of viruses is
unknown, and it cannot be excluded that methods of targetted
delivery could be developed that result in high local RTP
concentrations; (ii) extreme environmental conditions (a prolonged
plaque-to-plaque passage regime, passages in the presence of
monoclonal antibodies, etc.) have previously been used to unveil
either evolutionary responses or the sensitivity of biochemical
Figure 6. FMDV 3D residues around the substituted sites. Stereoviews of s
A
-weighted |F
o
|-|F
c
| electron density maps at 2.5 A
˚resolution
(contoured at 3 s) around the mutated amino acids (A) S44, (B) S169 and (C) I296. The substituted residues and surrounding amino acids were
omitted from the phasing model. The model is placed inside in ball and stick representation and colored in atom type code. The names of the
mutated residues are labeled.
doi:10.1371/journal.ppat.1001072.g006
Adaptation through Transition Types
PLoS Pathogens | www.plospathogens.org 12 August 2010 | Volume 6 | Issue 8 | e1001072

processes to subtle genetic change [1,69,79]. Thus, our model
studies must be regarded as designs to disclose potential mutagen-
resistance mechanisms that are informative of the potential of the
polymerase to adapt its catalytic machinery to extraneous
substrates, despite using conditions unlikely to be encountered in
vivo.
The virological and biochemical evidence presented here
support the hypothesis that the polymerase substitutions, whose
effect was to avoid a highly biased distribution of mutation types
normally induced by a mutagenic agent, contributed to viral
survival and escape from extinction (Figure 3), implying a new
mechanism of virus resistance to lethal mutagenesis. This new
mechanism does not require significant reductions of mutant
spectrum complexity thereby preserving an amplitude of the
mutant cloud adequate for virus adaptability to complex
environments or following a bottleneck event [1,28–30]. The
balanced mutational spectrum produced by FMDV 3D(SSI) was
maintained in the absence or presence of 5000 mM R, while
FMDV Wt produced a mutant spectrum with 80% (CRU)+
(GRA) only after 4 passages in the presence of 5000 mMR
(Table 5). A deleterious effect of biased substitution types is likely
because they can affect codon usage and specific RNA structures
needed during viral replication [80–85]. Examination of the
repertoire of mutations (and corresponding amino acid substitu-
tions) present in the mutant spectra of FMDV Wt and FMDV SSI
passaged in the presence of 5000 mM R is highly illustrative of the
deleterious effects of the incapacity of the polymerase to modulate
transition types (Table 9). First, the proportion of non-synonymous
mutations relative to the number of nucleotides sequenced is 1.5-
fold higher for R-Wt-4 than for R-SSI-4. Second, in the R-Wt-4
population a stop codon was generated as a result of a GRA
transition at genomic position 7319, and 74% of the 27 amino acid
substitutions scored were the result of CRUorGRA transitions.
In contrast, of the 15 amino acid substitutions in R-SSI-4 only
20% were the result of CRUorGRA transitions. The most
salient amino acid substitutions found in population R-Wt-4 are
G125R, C300Y and G435E, each originated from a GRA
transition (Table 9). These residues are conserved among
picornaviruses and the substitutions observed might have relevant
structural effects. G125R is an infrequent substitution that
introduces a bulky residue that was tolerated probably because it
lies in an exposed region at the entrance of the template channel
[63,64]. C300 is located in loop b9-a11, and its main chain
interacts with the rNTP and the acceptor base of the template
RNA. In the complex with RTP, the G299-C300 peptide bond is
rotated in a way that favors the interaction with the pseudobase
[65] (Figure 7). Replacement of C by Y is likely to affect the
flexibility of this region and, as a result, the interactions with RNA
and the rNTP. G435 is located in a short turn between helices a14
and a15 in the thumb domain, a region which is rich in small and
flexible amino acids [63]. The introduction of an E residue in this
region is not expected, and it might affect the stability of this 3D
region. In contrast to R-Wt-4, among the amino acid replace-
ments found in the R-SSI-4 populations, the most noticeable is
K164E located in motif F of 3D. K164 is not among the basic
amino acids that interact with the incoming rNTP, but it is
hydrogen bonded to template base A3 [63]. An E residue could
participate in the same interaction, as also observed between 3D
residue D165 and base U4 in the same complex [63]. Thus, the
comparison of the mutant repertoire in R-Wt-4 and R-SSI-4
reinforces the likely adverse effects of an abundance of CRU and
GRA transitions for FMDV fitness. It is not clear whether the
most detrimental factor is the imbalance of mutation types by
itself, or the increased frequency of U and A residues in genomic
RNA, or a combination of both factors. Whatever the mechanism,
the results suggest that the maintenance of a suitable transition
pattern during RNA synthesis in an environment of high
mutational pressure can be beneficial for the virus under increased
average mutation rates.
Despite the clear virological and biochemical effects of substitu-
tions P44S, P169S and M296I in 3D, the comparison of fitness
values for clones and populations indicates that it is unlikely that the
Figure 7. The structure and interactions of the FMDV 3D active site in two different complexes. (A) 3D(SSI)-RNA template/primer and (B)
3D(wild type)-RNA-ribavirin-triphosphate (RTP) (PDB: 2E9R). The polymerase residues in the active site are shown in grey with the loop b9-a11
highlighted in green. The first base pairs of the template/primer RNA are shown in yellow with the incoming RTP molecule in orange (in B). When the
RTP molecule is located at the active site of the wild type 3D, the b9-a11 loop changes its conformation to accommodate the nucleoside analogue
into the cavity, and the ribavirin pseudo-base appears hydrogen bonded to residues S298 and G299 within the loop. The side chains of residues
Asp245 of motif A and Asn307 of motif B have also changed their rotamer conformations to facilitate the interactions with the ribose moiety of the
mutagenic nucleotide. Substitution M296I seems to prevent the mentioned conformational changes in the loop b9-a11 as well as the side chain
rearrangements in residues Asp245 and Asn307 required to interact with ribavirin.
doi:10.1371/journal.ppat.1001072.g007
Adaptation through Transition Types
PLoS Pathogens | www.plospathogens.org 13 August 2010 | Volume 6 | Issue 8 | e1001072

Figure 8. Structure and interactions in the template channel of the FMDV 3D polymerase. (A) the 3D(SSI)RNA mutant complex and (B) the
3DWt-RNA complex (PDB 1WNE). The molecular surface of the polymerase is shown in grey with the acidic residues of the active site in red and the
RNA depicted as a ribbon in yellow. Only the 59overhang moiety and the first base pair in the active site is shown for clarity. Residues of the b2-a2
loop (containing S44), the amino acid interacting with b2-a2 loop and, those contacting the RNA template are shown as sticks in atom type colour.
The left side insets in A and B show close-ups of the interactions involving the loop b2-a2 (top) and template nucleotides A3 and U4 (bottom).
doi:10.1371/journal.ppat.1001072.g008
Adaptation through Transition Types
PLoS Pathogens | www.plospathogens.org 14 August 2010 | Volume 6 | Issue 8 | e1001072

replacements in 3D are the only determinants of high level resistance
to R. Indeed, the fitness of the uncloned FMDV population R-Ap60
was 15-fold higher than the fitness of control population Ap35, when
measured in the presence of 5000 mM R, while the fitness of the
cloned FMDV 3D(SSI) was 2-fold higher than the fitness of the
cloned FMDV Wt, measured under the same conditions (Tables 2
and 4). There are two main possibilities to account for the larger
difference of fitness between FMDV R-Ap60 and Ap35 than
between FMDV 3D(SSI) and FMDV Wt. One is that the complexity
or composition of the mutant spectrum of R-Ap60 conferred a
selective advantage to the mutant ensemble that could enhance R
resistance, even in the absence of additional dominant mutations (or
mutations in their way to dominance). Recent observations on the
selective value of mutant spectrum complexity and composition
[1,29,53,71,86,87] do not permit excluding this possibility. An
alternative, not mutually exclusive possibility, is that mutations in
genomic regions of FMDV other than 3D contribute also to R
resistance in RAp60. Current evidence suggests that non-structural
protein 2C may also contribute to FMDV escaping extinction
(Agudo et al., manuscript in preparation).
P44 is conserved among known picornaviral polymerases, and it
lies in a loop that connects strand b2 and helix a2 in the fingers
domain (Figure 9). This loop contains a number of residues that
establish tight contacts with amino acids V173 to G176 of motif F
and with the N-terminal residues M16, R17 and K18 of 3D. Amino
acids M16 and R17 form part of the template channel that drives
the ssRNA template towards the active site. Thus, substitutions at
the conserved amino acid P44 might disturb both the shape and
interactions of the template channel, and the interactions with the
incoming rNTP that are mediated by residues of motif F.
The structures of the mutant polymerases determined in the
present study do not show large domain movements. However, the
crystal structures of 3D(P44S, M296I) and 3D(SSI) in complex
with the RNA template-primer reveal a rearrangement in the
template channel with important effects in template binding, in
particular, at position n+1 (nucleotide A3). The conformational
changes in the main and side chains of residues M16 and R17
allow the opening of a hydrophobic pocket formed by residues of
motifs G and F and by M16 that facilitates the entrance of
nucleotide A3 (Figure 8). The polymerase with substitution M296I
that acquired substitution P44S maintained the alteration of loop
b9-a11 previously described for 3D (M296I) [51] (Figure 8). Thus,
the catalytic domain and template interactions may be affected by
additive effects of substitutions M296I and P44S. The different
interactions established between the modified template channel of
the substituted polymerases and nucleotide A3 could facilitate a
different alignment of the template strand, thus altering the
nucleotide incorporation activity. However, this possibility has not
been substantiated because of the inability of nucleotide substrates
to be incorporated into the mutant 3D-RNA complexes.
Finally, P169 is a non-conserved residue located in motif F of
3D (Figure 9) that has been implicated in the recognition of the
triphosphate moiety of the incoming nucleotide. P169 is close to
3D residues that directly contact with either the triphosphate or
ribose moieties of the incoming nucleotide [63,88]. The structural
comparisons do not reveal any conspicuous change in the
polymerase induced by substitution P169S. However, we can
not exclude that a change at this position could also affect the
recognition of an incoming nucleotide, modulating its incorpora-
tion rate, and thus altering the replication fidelity or replicative
fitness. Thus, subtle structural modifications that affect the
template channel of 3D mediate alterations in substrate recogni-
tion that may modify recognition of RTP and the repertoire of R-
mediated mutations.
Figure 9. Ribbon diagram of the structure of FMDV 3D polymerase, SSI mutant, in complex with the RNA template-primer. The
polymerase is depicted in blue and the RNA in yellow. The substituted amino acids, S44, S169 and I296, are shown as red balls and explicitly labelled.
doi:10.1371/journal.ppat.1001072.g009
Adaptation through Transition Types
PLoS Pathogens | www.plospathogens.org 15 August 2010 | Volume 6 | Issue 8 | e1001072

Materials and Methods
Cells, viruses, infections, and cytotoxicity of ribavirin
The origin of BHK-21 cells, procedures for cell growth and for
infection with FMDV in the presence or absence of ribavirin (R;
Sigma), 5-fluorouracil (FU; Sigma), or guanidine hydrochloride
(GuH; Sigma) have been previously described [27,53,54,59].
Briefly, for each infection the first passage was carried out at moi
0.3 PFU/cell. For the following passages, 2610
6
BHK-21 cells
were passaged with supernatant of virus from the previous
passage (0.2 ml), and the infection allowed to proceed for about
24h. Values of PFU for each passage can be estimated from
infectivities given in Figure 3. FMDV C-S8c1 is a plaque-purified
derivative of natural isolate C1 Santa-Pau Spain 70 [54], a
representative of European serotype C FMDV. FMDV MARLS
is a monoclonal antibody-escape mutant selected from the C-
S8c1 population passaged 213 times in BHK-21 cells [69]. Ap35
and R-Ap35 are FMDV MARLS passaged 35 times in the
absence or in the presence, respectively, of increasing concen-
trations of R as previously described [27]; FMDV MARLS
populations passaged 45 and 60 times in the presence of
increasing concentrations of R have been termed R-Ap45 and
R-Ap60 (see Figure 1). R exerted a cytostatic effect in BHK-21
cell monolayers (measured as cell viability using trypan blue
staining). The cytotoxicities as a result of treatment of BHK-21
cell monolayers with R, FU and GuH have been previously
described [53,58,59]. The maximum reduction of cell viability of
confluent BHK-21 cell monolayers in the presence of 5000 mMR
was around 40% at 48 h post-treatment, in agreement with our
previous results [53]. Evidence that cytotoxicity by R does not
contribute significantly to FMDV extinction includes the
observation that FMDV mutant with amino acid replacements
in 3D that confer resistance to R can replicate and survive after
multiple passages in the presence of 5000 mM R (Figure 3, and
unpublished observations).
Extraction of RNA, cDNA synthesis, PCR amplification,
and nucleotide sequencing
RNA was extracted from the supernatants of infected cells using
described procedures [27,67]. Reverse transcription (RT) was
Table 9. Mutations and corresponding amino acid
substitutions in the mutant spectra FMDV R-Wt-4 and R-SSI-4
passaged in the presence of ribavirin
a
.
R-Wt-4 R-SSI-4
Mutation
b
Amino acid
b
Mutation
b
Amino acid
b
C6680T - C6765T -
G6696A -T6683C V25A
C6719T A37V G6836A R76H
C6720T -A6858G -
C6722T A38V T6888C -
T6727C S40P T6888C -
G6760A V51I A6912G -
C6763T L52F T7010C F134S
T6773C V55A A7076C K156T
T6923C V105A A7099G K164E
C6975T -A7100G K164R
G6982A G125R T7110C -
G6989A R127H C7134T -
T7083C -G7140A -
G7120A E171K G7165A V186I
T7193C M195T T7206C -
G7202A R198K A7212G -
C7230T -T7241C I211T
G7236A -T7344C -
G7319A STOP T7367C M253T
C7353T -G7416A -
A7375G M256V A7417G N270D
G7420A A271T C7432T -
C7431T -C7479T -
C7443T -C7506T -
A7448G N280S A7515G -
G7473A -A7522G I305V
G7508A C300Y C7665T -
C7548T -C7697T T363I
C7562T A318V T7757C V383A
G7633A V341M T7868C I420T
G7654A D349N T7904C V432A
G7663A A352T A7917G -
C7664T A352V C7986T -
C7755T -A7980G -
T7841C I411T
G7856A R416H
G7862A G418E
G7863A -
G7872A -
G7891A A428T
G7913A G435E
C7926T -
C7933T L442P
Total mutations
c
44 Total mutations 35
GRA
+
CRT
d
21 GRA
+
CRT3
Synonymous (%)
e
16 (36) Synonymous (%) 20 (57)
R-Wt-4 R-SSI-4
Mutation
b
Amino acid
b
Mutation
b
Amino acid
b
Non-synonymous
(%)
e
28 (64) Non-
synonymous (%)
15 (43)
a
The sequence of the 3D-coding region was determined for R-Wt-4 and R-SSI-4
(wild type and triple mutant FMDV) after 4 passages in the presence of
5000 mM ribavirin. The populations are those described in Figure 3 and Table 5.
b
Mutation and deduced amino acid substitutions are relative to the sequence
of the parental clone C-S8c1 [57]. Amino acid residues (single-letter code) are
numbered from the N- to the C-terminus of 3D. Boldface type indicates a
change in the amino acid residue. Procedures for nucleotide sequencing and
identification of FMDV genomic regions are described in Materials and
Methods.
c
Number of different mutations found comparing the sequence of each
individual clone with the corresponding sequence of FMDV C-S8c1 [57].
d
Number of GRAplusCRT substitutions found comparing the sequence of
each individual clone with the corresponding sequence of FMDV C-S8c1 [57].
e
The percentage of synonymous and non-synonymous mutations is indicated
in parenthesis.
doi:10.1371/journal.ppat.1001072.t009
Table 9. Cont.
Adaptation through Transition Types
PLoS Pathogens | www.plospathogens.org 16 August 2010 | Volume 6 | Issue 8 | e1001072

carried out using AMV reverse transcriptase (Promega), and PCR
amplification was performed using EHF DNA polymerase (Roche)
as specified by the manufacturer. RT-PCR amplification intended
for the cloning of individual cDNA molecules was carried out
using Pfu ultra DNA polymerase (Stratagene). Amplification
protocols, nucleotide sequencing and primers used for amplifica-
tion and sequencing have been previously described [27,42,67].
Quantification of viral RNA
FMDV RNA was quantified by real-time RT-PCR amplifica-
tion using the Light Cycler instrument (Roche) and the RNA
Master SYBR green I kit (Roche) as previously described [27].
Preparation of FMDV C-S8c1 with substitutions in 3D
Plasmid pMT28 encodes an infectious transcript of FMDV C-
S8c1 [57,70]. The construction of plasmid pMT28-3D(M296I) (an
infectious clone expressing 3D with substitution M296I in the
context of the C-S8c1 genome) has been previously reported [27].
The rest of chimeric plasmids encoding mutant 3Ds were
constructed by replacing part of the 3D-coding region of
pMT28 with the corresponding mutant 3D-coding region of
interest. To construct pMT28-3D(P169S) (an infectious clone
encoding 3D with amino acid substitution P169S in the context of
the C-S8c1 genome), two DNA amplifications were carried out
using Pfu ultra DNA polymerase and pMT28 DNA as template.
A first amplification with 3AR3 (GATGACGTGAACTCT-
GAGCCCGC; sense, 59position 5710) and 393DP169S (CT-
TTCTCCATGCTGCGAATTTCGTCCTTCAGGAAGG; an-
tisense, 59position 7126); and a second amplification with
593DP169S (CGAAATTCGCAGCATGGAGAAAGTACGTG-
CCGG; sense, 59position 7104) and 3D1 (CTTGTTG-
CGGAACAGCCAGATG; antisense, 59position 7520) were
performed (bold-face letters indicate modifications of the genomic
sequence introduced to express 3D with substitution P169S).
(Nucleotide positions correspond to the numbering of FMDV
genomic residues described in [69]). The two amplicons were
shuffled and digested with RsrII (position 5839) and ClaI (position
7004) (New England Biolabs) and ligated to pMT28 DNA
linearized with the same enzymes. A similar procedure was used
to construct pMT28-3D(P44S) and pMT28-3D(P44S, M296I). To
prepare pMT28-3D(P44S,M296I) (an infectious clone expressing
3D harboring substitution P44S and M296I in the context of the C-
S8c1 genome), pMT28-3D(M296I) was subjected to the same
procedure described above for pMT28, except that the two pairs of
primers used for the PCR amplification were 3AR3 (described
above) with 393DP44S (CGTTCAGACGGCTGTCCTTGTT-
AGACAAGGCGG; antisense, 59position 6751), and 593DP44S
(CTAACAAGGACAGCCGTCTGAACGAAGGTG; sense, 59
position 6728) with A3 (CGTCGACAATGCGAGTCTTGC-
CG; antisense, 59position 7156; bold-face letters indicate modifica-
tions of the genomic sequence introduced to express 3D with
substitution P44S). The two amplicons were shuffled, digested with
RsrII and ClaI, and ligated to pMT28 or pMT28-3D(M296I) DNAs
linearized with the same enzymes, rendering pMT28-3D(P44S)
and pMT28-3D(P44S, M296I), respectively. Finally, to construct
pMT28-3D(P44S, P169S, M296I) (an infectious clone expressing 3D
with amino acid substitution P44S, P169S and M296I in the context
of the C-S8c1 genome), procedures were carried out as those
described for pMT28-3D(P169S) except that the parental plasmid
used both as template for DNA amplifications and for cloning was
pMT28-3D(P44S, M296I) instead of pMT28. For simplicity, the
plasmid that includes the three amino acid substitutions in 3D has
been termed pMT28-3D(SSI) and the rescued virus FMDV 3D(SSI).
Ligation, transformation of E. coli DH5a, colony screening,
nucleotide sequencing, preparation of infectious RNA transcripts,
and RNA transfections were carried out as previously described
[27,67].
Quasispecies analysis
To determine the complexity of mutant spectra, FMDV RNA
was extracted as described above and subjected to RT-PCR using
primers PolC-KpnI (GTTGGTACCCACTCTGCTGGAGGC;
sense, 59position 6502) and Pol1-XbaI (AATCTAGATG-
TTTGGGGGATTATGCG; antisense, 59position 8060; the
letters underlined indicate the sequences recognized by restriction
enzymes KpnI and XbaI, respectively). cDNA was digested by KpnI
and XbaI enzymes (New England Biolabs), and ligated to plasmid
pGEM-3Z Vector (Promega) previously digested with the same
enzymes. Transformation, colony screening and nucleotide
sequencing were carried out as previously described [27,67].
The region sequenced spans residues 6508 to 8036 and includes
the entire 3D-coding region (residues 6610 to 8020). The number
of clones analyzed and the total number of nucleotides sequenced
are given in the appropriate section of Results. The complexity of
mutant spectra was expressed as the mutation frequency,
calculated by dividing the number of different mutations by the
total number of nucleotides sequenced.
Fitness assays
Relative fitness was measured by growth-competition experi-
ments in the presence or absence of R. The logarithm of the ratio
of the two competing viruses was plotted against passage number,
and the fitness vector was adjusted to an exponential equation
y=a6e
bx
. The antilogarithm of the vector slope is the fitness of
the virus tested, relative to that of the reference virus [27,68]. The
proportion of the two competing genomes at different passages was
determined by real-time RT-PCR, employing primers specifically
designed to discriminate accurately the two RNAs in the
competition (Table 10). For each fitness determination, the R
2
value of the corresponding linear regressions is also given (Tables 2
and 4).
Fitness assays in the presence of ribavirin, 5-fluorouracil
and a mixture of both drugs
A solution of ribavirin (R) in PBS was prepared at a
concentration of 100 mM, sterilized by filtration, and stored at
270uC. Prior to use, the stock solution was diluted in DMEM to
reach the desired R concentration. To prepare culture medium
containing 5-fluorouracil (FU) (Sigma), the analogue was dissolved
in DMEM to yield a 5 mg/ml solution, and diluted in DMEM, as
needed for the experiments. For infections in the presence of R
(5000 mM) and FU (2000 mM), cell monolayers were treated
during 7 h and 10 h, respectively, prior to infection. The relative
fitness of FMDV SSI was determined by growth competition with
the Wt virus in BHK-21 cells in the presence of R, FU or a
mixture of both drugs. Briefly, the viral population to be assayed
was mixed with the same number of PFU of FMDV Wt, used as
reference. For each determination, four serial infections were
carried out at moi 0.3 PFU/cell. The proportion of the two
competing genomes at each passage was determined by measuring
the area of the three peaks corresponding to the residues that
distinguish 3D Wt from 3D(SSI). Each mutation was confirmed by
two independent sequencing assays using primers of different
orientation. The average of triplicate measurements and standard
deviations are given.
Adaptation through Transition Types
PLoS Pathogens | www.plospathogens.org 17 August 2010 | Volume 6 | Issue 8 | e1001072

Molecular cloning, expression, and purification of FMDV
3D
FMDV 3D with substitutions M296I [termed 3D(M296I)],
P169S [termed 3D(P169S)], P44S [termed 3D(P44S)], with P44S
and M296I [termed 3D(P44S, M296I)], or with the three of them
[3D(P44S, P169S, M296I) which is abbreviated as 3D(SSI)] were
obtained from plasmid pET-28a 3Dpol [expression vector pET-
28a (Novagen) containing the FMDV polymerase 3D-coding
region [67]] by site-directed mutagenesis with oligonucleotides
containing the corresponding mutated nucleotides, using the
QuickChange site-directed mutagenesis kit (Stratagene). Muta-
genesis, 3D expression, and 3D purification by affinity chroma-
tography, were carried out as previously described [63,67]. The
enzymes were .95% pure, as judged by SDS-PAGE electropho-
resis and Coomassie brilliant blue staining.
3D-polymerization assays using heteropolymeric
template-primers
Incorporation of standard nucleoside-59-triphosphates or ribavi-
rin-59-triphosphate (RTP) by wild type and mutant 3Ds was
measured in self-complementary RNAs that form double stranded
RNA in which each strand can act both as template and primer
[62]. RNAs 59-CGUAGGGCCC-39(termed sym/sub-AU), 59-
UGCAGGGCCC-39(termed sym/sub-AC), 59-GUACGGGCCC-
39(termed sym/sub-C) and 59-GCAUGGGCCC-39(termed sym/
sub-U) (Dharmacon Research) were used. The oligonucleotides
were purified, end-labeled with [c-
32
P] ATP and polynucleotide
kinase (New England biolabs), and annealed using standard
protocols [27,89]. For the reaction with sym/sub-AU and sym/
sub-U, 0.5 mM of RNA-duplex and 2 mM 3D were incubated in
30 mM MOPS (pH 7.0), 33 mM NaCl, 5 mM Mg(CH
3
COO)
2
,
and 50 mM UTP (Amersham) in the case of sym/sub-AU, for either
10 min [for 3D wt, 3D(P169S) and 3D(M296I)] or 30 min [for
3D(P44S) and 3D(SSI)] at 37uC, or 33uC when mentioned; 3D(SSI)
and 3D(P44S) were incubated for longer periods of time because
they display a defect in RNA binding (see Results). After formation
of a binary complex of 3D-RNA, [elongated in one nucleotide in the
case of sym/sub-AU (3D-sym/sub-AU, n+1 complexes)], an excess
of unlabeled sym/sub-AU (5 mM) was added to trap the unbound
3D, and to avoid the recycling of labelled sym/sub-AU. The
reaction was initiated by adding either 50 mM ATP (Amersham) or
50 mM (RTP) (Moraveck), or 1mM ATP when mentioned. The
reaction was stopped at different times by the addition of EDTA
(83 mM final concentration). Identical procedure was followed with
sym/sub-AC, except that GTP and RTP were used as substrates.
Reaction products were analyzed by electrophoresis on a
denaturing 23% polyacrylamide, 7 M urea gel in 90 mM Tris-
base, 90 mM boric acid, 2 mM EDTA. The 11 mer (sym/sub
elongated in one nucleotide by addition of UMP) and $12-mer
(sym/sub elongated in two or more nucleotides by addition of the
required nucleotides) were visualized and quantitated with a
Phosphorimager (BAS-1500; Fuji).
Other assays with 3D
Poly(rU) synthesis using poly(A)-oligo(dT)
15
as template-primer
molecule, VPg uridylylation with poly(A) as template and Mn
++
as
ion, and RNA binding assays were carried out as previously
described [67,89].
Co-crystallization experiments
Purified FMDV mutant polymerases 3D(P44S), 3D(P169S),
3D(P44, M296I) and 3D(SSI) were stored in a buffer containing
Tris-HCl (40mM, pH 7.5), NaCl (0.5M), DTT (0.8mM), EDTA
(0.8mM), and glycerol (8%), at a concentration of ,4.6 mg/ml.
The oligonucleotide 59GCAUGGGCCC 39(NWG-Biotech)
(sym/sub-U) was annealed following the described procedure
[62]. Then the 3D was added slowly to an equimolar proportion in
the presence of 2mM MgCl
2
. The mutant 3Ds and their
complexes were crystallized as previously described [63].
Data collection, structure determination and refinement
Four different data sets were collected at 100 K: 3D(P44S) (2.2 A
˚),
3D(P169S) (2.6 A
˚), 3D(P44, M296I)-RNA (2.6 A
˚) and 3D(SSI)-
RNA (2.5 A
˚), using synchrotron radiation at the ESRF beamlines
ID14 EH1 and EH2 (l=0.93 A
˚). All data were processed and
reduced using DENZO/SCALEPACK package [90] (Table 8).
Table 10. Primers used to determine the relative fitness of FMDV populations.
Primer Population
a
Sequence
b
Sense
c
Cu
d
Position
e
Primer pair
f
Mk Wt pMT28
Ap35
GGAACAGCCAGATGGCAT R 72 7512 3DR4
Mk Res pMT28-3D(M296I)
R-Ap35
R-Ap60
GGAACAGCCAGATGGTAT R 68 7512 3DR4
P169 pMT28
pMT28-3D(M296I)
pMT28-3D(2M)
CCTGAAGGACGAAATTCGCCCG F 63 7095 AV3
S169 pMT28-3D(3M) CCTGAAGGACGAAATTCGCAGC F 63 7095 AV3
3DR4 All populations ACTCGCATTGTCGACGTTTT F -- 7141 --
AV3 All populations TTCATGGCATCGCTGCAGTGG R -- 7370 --
a
Viral populations which are specifically discriminated by the primer indicated in b.
b
Nucleotide sequence of the primers used. Letters in bold are nucleotides that have been modified with respect to the genomic sequence of the FMDV C-S8c1, and that
serve to discriminate among different populations.
c
Genomic orientation of primer: forward (F) or reverse (R).
d
Hybridization temperature used in the real time RT-PCR assays to discriminate the competing RNAs. ‘‘--’’ indicates that this primer does not discriminate specifically
among mutant genomes.
e
Position of the 59-nucleotide of the primer; numbering is that described in [93].
f
Complementary primer used in each case during RT-PCR amplification. ‘‘--’’ indicates that this primer does not discriminate specifically among any mutant genomes
and is used as the complementary for the RT-PCR reaction.
doi:10.1371/journal.ppat.1001072.t010
Adaptation through Transition Types
PLoS Pathogens | www.plospathogens.org 18 August 2010 | Volume 6 | Issue 8 | e1001072

The initial maps for the 3D(P44S) and 3D(P169S) (tetragonal
crystals) were obtained after a rigid body fitting of the coordinates
of isolated 3D protein that was crystallized in the tetragonal
p4
2
2
1
2 space group (PDB:1U09) [63] to the new unit cells, using
the program REFMAC (CCP4). Initial maps for the 3D(P44,
M296I)-RNA and 3D(SSI)-RNA complexes (P3
2
21 crystals) were
obtained following the same procedure but using the trigonal
P3
2
21 coordinates of 3D (PDB:1WNE) [63] as starting model
(Table 1). In the four structures the 2|Fo|-|Fc| and |Fo|-|Fc|
difference maps clearly allowed the re-positioning of the mutated
residues and surrounding regions and, in the trigonal structures,
these maps showed the presence of extra densities corresponding
to the RNA template-primers. However, the tetragonal crystals,
3D(P44S) and 3D(P169S), did not contain RNA despite using the
same incubation and co-crystallization conditions as in 3D(P44,
M296I)-RNA and 3D(SSI)-RNA complexes that crystallized in the
P3
2
21 space group. Several cycles of automatic refinement,
performed with program REFMAC, were alternated with manual
model rebuilding using the graphic programs TURBO and Coot
[91]. The statistics of the refinement for the four complexes are
summarized in Table 7.
Supporting Information
Figure S1 Incorporation of nucleotides into sym/sub-AC by
mutant FMDV polymerases. (A) Kinetics of incorporation of GMP
into sym/sub-AC (sequence shown at the top) by the indicated
FMDV polymerases [3DWt and 3D(SSI)], performed at 37uC.
The reactions were initiated by addition of 1 mM GTP after the
formation of 3D-RNA(n+1) complex, as described in Materials
and Methods of the main text. At different time points the reaction
was quenched by addition of EDTA. (B) Same as (A), except that
the reaction was performed at 33uC. (C) Percentage of primer
elongated to position +2, (12 mer or larger RNAs synthesized),
calculated from the densitometric analysis of the electrophoreses
shown in A. The results are the average of three independent
experiments, and standard deviations are given. (D) Same as (C)
for the incorporation of GMP at position +2 (12 mer) calculated
from the densitometric analysis of the electrophoreses shown in
(B). Procedures are detailed in Materials and Methods of the main
text.
Found at: doi:10.1371/journal.ppat.1001072.s001 (7.49 MB TIF)
Figure S2 Incorporation of nucleotides into sym/sub-AU by
mutant FMDV polymerases. (A) Kinetics of incorporation of AMP
into sym/sub-AU (sequence shown at the top) by the indicated
FMDV polymerases [3DWt and 3D(SSI)], performed at 37uC.
The reactions were initiated by addition of 1 mM ATP after the
formation of 3D-RNA(n+1) complex, as described in Materials
and Methods of the main text. At different time points the reaction
was quenched by addition of EDTA. (B) Same as (A), except that
the reaction was performed at 33uC. (C) Percentage of primer
elongated to position +2, (12 mer or larger RNAs synthesized),
calculated from the densitometric analysis of the electrophoreses
shown in A. The results are the average of three independent
experiments, and standard deviations are given. (D) Same as (C)
for the incorporation of AMP at position +2 (12 mer) calculated
from the densitometric analysis of the electrophoreses shown in
(B). Procedures are detailed in Materials and Methods of the main
text.
Found at: doi:10.1371/journal.ppat.1001072.s002 (7.46 MB TIF)
Figure S3 Incorporation of nucleotides into sym/sub-C and
sym/sub-U by mutant FMDV polymerases. (A) Kinetics of
incorporation of GMP into sym/sub-C (sequence shown at the
top) by the indicated FMDV polymerases [3DWt and 3D(SSI)],
performed at 37uC. The reactions were initiated by addition of
1mM GTP after the formation of 3D-RNA complex, as described
in Materials and Methods of the main text. At different time points
the reaction was quenched by addition of EDTA. (B) Kinetics of
incorporation of AMP into sym/sub-U (sequence shown at the
top) by the indicated FMDV polymerases, performed at 37uC.
The reactions were initiated by addition of 1 mM ATP after the
formation of 3D-RNA complex, as described in Materials and
Methods of the main text. At different time points the reaction was
quenched by addition of EDTA. (C) Percentage of primer
elongated to position +1 (11 mer or larger RNAs synthesized),
calculated from the densitometric analysis of the electrophoreses
shown in A. The results are the average of three independent
experiments, and standard deviations are given. (D) Same as (C)
for the incorporation of AMP at position +1 (11 mer) calculated
from the densitometric analysis of the electrophoreses shown in
(B). Procedures are detailed in Materials and Methods of the main
text.
Found at: doi:10.1371/journal.ppat.1001072.s003 (6.37 MB TIF)
Acknowledgments
We thank Ana I. de Avila and Eva Garcı
´a-Cueto for technical assistance.
Author Contributions
Conceived and designed the experiments: NV ED. Performed the
experiments: RA CFO IdlH CP RPL. Analyzed the data: RA CFO AA
IdlH CP NV ED. Contributed reagents/materials/analysis tools: AA.
Wrote the paper: NV ED.
References
1. Domingo E (2006) Quasispecies: Concepts and Implications for Virology. In
Curr Top Microbiol Immunol Vol, 299.
2. Scheidel LM, Durbin RK, Stollar V (1987) Sindbis vir us mutants resistant to
mycophenolic acid and ribavirin. Virology 158: 1–7.
3. Richman DD, ed. Antiviral Drug Resistance. New York: John Wiley and Sons
Inc.
4. Domingo E (1989) RNA virus evolution and the control of viral disease. Prog
Drug Res 33: 93–133.
5. Domingo E (2003) Quasispecies and the development of new antiviral strategies.
Progress in Drug Res 60: 133–158.
6. Domingo E, Parrish C, Holland JJE (2008) Origin and Evolution of Viruses. 2nd
edition. Oxford: Elsevier.
7. Mas A, Lo´pez-Galı
´ndez C, Cacho I, Go´ mez J, Martinez MA (2010) Unfinished
stories on viral quasispecies and Darwinian views of evolution. J Mol Biol 397:
865–877.
8. Swetina J, Schuster P (1982) Self-replication with errors. A model for
polynucleotide replication. Biophys Chem 16: 329–345.
9. Eigen M (2002) Error catastrophe and antiviral strategy. Proc Natl Acad Sci
USA 99: 13374–13376.
10. Biebricher CK, Eigen M (2005) The error threshold. Virus Res 107: 117–127.
11. Eigen M, Biebricher CK (1988) Sequence space and quasispec ies distribution.
In: Domingo E, Ahlquist P, Holland JJ, eds. RNA Genetics. Boca Raton, FL:
CRC Press. pp 211–245.
12. Schuster P, Stadler PF (2008) Early Replicons: Origin and Evolution. Origin and
Evolution of Viruses 2
nd
edition. In: Domingo E, Parrish CR, Holland JJ, eds.
Oxford: Elsevier. pp 1–42.
13. Ochoa G (2006) Error thresholds in genetic algorithms. Evol Comput 14:
157–182.
14. Harris KS, Brabant W, Styrchak S, Gall A, Daifuku R (2005) KP-1212/1461, a
nucleoside designed for the treatment of HIV by viral mutagenesis. Antiviral Res
67: 1–9.
15. Anderson JP, Daifuku R, Loeb LA (2004) Viral error catastrophe by mutagenic
nucleosides. Annu Rev Microbiol 58: 183–205.
16. Domingo E, Pariente N, Airaksinen A, Gonzalez-Lopez C, Sierra S, et al. (2005)
Foot-and-mouth disease virus evolution: exploring pathways towards virus
extinction. Curr Top Microbiol Immunol 288: 149–173.
17. Graci JD, Cameron CE (2002) Quasispecies, error catastrophe, and the antiviral
activity of ribavirin. Virology 298: 175–180.
Adaptation through Transition Types
PLoS Pathogens | www.plospathogens.org 19 August 2010 | Volume 6 | Issue 8 | e1001072

18. Harki DA, Graci JD, Edathil JP, Castro C, Cameron CE, et al. (2007) Synthesis
of a universal 5-nitroindole ribonucleotide and incorporation into RNA by a
viral RNA-dependent RNA polymerase. Chembiochem 8: 1359–1362.
19. Graci JD, Too K, Smidansky ED, Edathil JP, Barr EW, et al. (2008) Lethal
mutagenesis of picornaviruses with N-6-modified purine nucleoside analogues.
Antimicrob Agents Chemother 52: 971–979.
20. Ruiz-Jarabo CM, Ly C, Domingo E, de la Torre JC (2003) Lethal mutagenesis
of the prototypic arenavirus lymphocytic choriomeningitis virus (LCMV).
Virology 308: 37–47.
21. Crotty S, Cameron CE, Andino R (2001) RNA virus error catastrophe: direct
molecular test by using ribavirin. Proc Natl Acad Sci USA 98: 6895–6900.
22. Holland JJ, Domingo E, de la Torre JC, Steinhauer DA (1990) Mutation
frequencies at defined single codon sites in vesicular stomatitis virus and
poliovirus can be increased only slightly by chemical mutagenesis. J Virol 64:
3960–3962.
23. Hofmann WP, Polta A, Herrmann E, Mihm U, Kronenberger B, et al. (2007)
Mutagenic effect of ribavirin on hepatitis C nonstructural 5B quasispecies in
vitro and during antiviral therapy. Gastroenterology 132: 921–930.
24. Loeb LA, Essigmann JM, Kazazi F, Zhang J, Rose KD, et al. (1999) Lethal
mutagenesis of HIV with mutagenic nucleoside analogs. Proc Natl Acad Sci
USA 96: 1492–1497.
25. Loeb LA, Mullins JI (2000) Lethal mutagenesi s of HIV by mutageni c
ribonucleoside analogs. AIDS Res Hum Retroviruses 13: 1–3.
26. Tapia N, Fernandez G, Parera M, Gomez-Mariano G, Clotet B, et al. (2005)
Combination of a mutagenic agent with a reverse transcriptase inhibitor results
in systematic inhibition of HIV-1 infection. Virology 338: 1–8.
27. Sierra M, Airaksinen A, Gonza´ lez-Lo´ pez C, Agudo R, Arias A, et al. (2007)
Foot-and-mouth disease virus mutant with decreased sensitivity to ribavirin:
implications for error catastrophe. J Virol 81: 2012–2024.
28. Vignuzzi M, Stone JK, Andino R (2005) Ribavirin and lethal mutagenesis of
poliovirus: molecular mechanisms, resistance and biological implications. Virus
Res 107: 173–181.
29. Vignuzzi M, Stone JK, Arnold JJ, Cameron CE, Andino R (2006) Quasispecies
diversity determines pathogenesis through cooperative interactions in a viral
population. Nature 439: 344–348.
30. Pfeiffer JK, Kirkegaard K (2003) A single mutation in poliovirus RNA-
dependent RNA polymerase confers resistance to mutagenic nucleotide analogs
via increased fidelity. Proc Natl Acad Sci USA 100: 7289–7294.
31. Pfeiffer JK, Kirkegaard K (2005) Increased fidelity reduces poliovirus fitness
under selective pressure in mice. PLoS Pathogens 1: 102–110.
32. Davis GL, Esteban-Mur R, Rustgi V, Hoefs J, Gordon SC, et al. (1998)
Interferon alfa-2b alone or in combination with ribavirin for the treatment of
relapse of chronic hepatitis C. International Hepatitis Interventional Therapy
Group. N Engl J Med 339: 1493–1499.
33. McHutchison JG, Gordon SC, Schiff ER, Shiffman ML, Lee WM, et al. (1998)
Interferon alfa-2b alone or in combination with ribavirin as initial treatment for
chronic hepatitis C. Hepatitis Interventional Therapy Group. N Engl J Med
339: 1485–1492.
34. Cummings KJ, Lee SM, West ES, Cid-Ruzafa J, Fein SG, et al. (2001)
Interferon and ribavirin vs interferon alone in the re-treatment of chronic
hepatitis C previously nonresponsive to interferon: A meta-analysis of
randomized trials. Jama 285: 193–199.
35. Di Bisceglie AM, Thompson J, Smith-Wilkaitis N, Brunt EM, Bacon BR (2001)
Combination of interferon and ribavirin in chronic hepatitis C: re-treatment of
nonresponders to interferon. Hepatology 33: 704–707.
36. Crotty S, Maag D, Arnold JJ, Zhong W, Lau JYN, et al. (2000) The broad-
spectrum antiviral ribonucleotide, ribavirin, is an RNA virus mutagen. Nature
Medicine 6: 1375–1379.
37. Day CW, Smee DF, Julander JG, Yamshchikov VF, Sidwell RW, et al. (2005)
Error-prone replication of West Nile virus caused by ribavirin. Antiviral Res 67:
38–45.
38. Severson WE, Schmaljohn CS, Javadian A, Jonsson CB (2003) Ribavirin causes
error catastrophe during Hantaan virus replication. J Virol 77: 481–488.
39. Maag D, Castro C, Hong Z, Cameron CE (2001) Hepatitis C virus RNA-
dependent RNA polymerase (NS5B) as a mediator of the antiviral activity of
ribavirin. J Biol Chem 276: 46094–46098.
40. Lanford RE, Chavez D, Guerra B, Lau JY, Hong Z, et al. (2001) Ribavirin
induces error-prone replication of GB virus B in primary tamarin hepatocytes.
J Virol 75: 8074–8081.
41. Freistadt MS, Meades GD, Cameron CE (2004) Lethal mutagens: broad-
spectrum antivirals with limited potential for development of resistance? Drug
Resist Updat 7: 19–24.
42. Airaksinen A, Pariente N, Menendez-Arias L, Domingo E (2003) Curing of foot-
and-mouth disease virus from persistently infected cells by ribavirin involves
enhanced mutagenesis. Virology 311: 339–349.
43. Parker WB (2005) Metabolism and antiviral activity of ribavirin. Virus Res 107:
165–171.
44. Graci JD, Cameron CE (2006) Mechanisms of action of ribavirin against distinct
viruses. Rev Med Virol 16: 37–48.
45. Asahina Y, Izumi N, Enomoto N, Uchihara M, Kurosaki M, et al. (2005)
Mutagenic effects of ribavirin and response to interferon/ribavirin combination
therapy in chronic hepatitis C. J Hepatol 43: 623–629.
46. Chevaliez S, Brillet R, Lazaro E, Hezode C, Pawlotsky JM (2007) Analysis of
ribavirin mutagenicity in human hepatitis C virus infection. J Virol 81:
7732–7741.
47. Perelson AS, Layden TJ (2007) Ribavirin: is it a mutagen for hepatitis C virus?
Gastroenterology 132: 2050–2052.
48. Hong Z (2003) The role of ribavirin-induced mutagenesis in HCV therapy: a
concept or a fact? Hepatology 38: 807–810.
49. Cuevas JM, Gonzalez-Candelas F, Moya A, Sanjuan R (2009) Effect of ribavirin
on the mutation rate and spectrum of hepatitis C virus in vivo. J Virol 83:
5760–5764.
50. Arias A, Arnold JJ, Sierra M, Smidansky ED, Domingo E, et al. (2008)
Determinants of RNA-dependent RNA polymerase (in)fidelity revealed by
kinetic analysis of the polymerase encoded by a foot-and-mouth disease virus
mutant with reduced sensitivity to ribavirin. J Virol 82: 12346–12355.
51. Ferrer-Orta C, Sierra M, Agudo R, de la Higuera I, Arias A, et al. (2010)
Structure of foot-and-mouth disease virus mutant polymerases with reduced
sensitivity to ribavirin. J Virol 84: 6188–6199.
52. Perales C, Agudo R, Domingo E (2009) Counteracting quasispecies adaptability:
extinction of a ribavirin-resistant virus mutant by an alternative mutagenic
treatment. PLoS ONE 4: e5554.
53. Perales C, Agudo R, Tejero H, Manrubia SC, Domingo E (2009) Potential
benefits of sequential inhibitor-mutagen treatments of RNA virus infections.
PLoS Pathog 5: e1000658.
54. Sobrino F, Da´vila M, Ortı
´n J, Domingo E (1983) Multiple genetic variants arise
in the course of replication of foot-and-mouth disease virus in cell culture.
Virology 128: 310–318.
55. Charpentier N, Davila M, Domingo E, Escarmis C (1996) Long-term, large-
population passage of aphthovirus can generate and amplify defective
noninterfering particles deleted in the leader protease gene. Virology 223:
10–18.
56. Sierra M (2007) Bases moleculares de la resistencia a ribavirina en el virus de la
fiebre aftosa. Implicaciones para la mutage´nesis letal de virus. [Ph. D. Thesis].
Madrid (Spain): Universidad Auto´noma de Madrid.
57. Toja M, Escarmis C, Domingo E (1999) Genomic nucleotide sequence of a foot-
and-mouth disease virus clone and its persistent derivatives. Implications for the
evolution of viral quasispecies during a persistent infection. Virus Res 64:
161–171.
58. Sierra S, Da´vila M, Lowenste in PR, Domingo E (2000) Response of foot-and-
mouth disease virus to increased mutagenesis. Influence of viral load and fitness
in loss of infectivity. J Virol 74: 8316–8323.
59. Pariente N, Sierra S, Lowenstein PR, Domingo E (2001) Efficient virus
extinction by combinations of a mutagen and antiviral inhibitors. J Virol 75:
9723–9730.
60. Ojosnegros S, Agudo R, Sierra M, Briones C, Sierra S, et al. (2008) Topology of
evolving, mutagenized viral populations: quasispecies expansion, compression,
and operation of negative selection. BMC Evol Biol 8: 207.
61. Snell NJ (2001) Ribavirin–current status of a broad spectrum antiviral agent.
Expert Opin Pharmacother 2: 1317–1324.
62. Arnold JJ, Cameron CE (2000) Poliovirus RNA-dependent RNA polymerase
(3D
pol
). Assembly of stable, elongation-competent complexes by us ing a
symmetrical primer-template substrate (sym/sub). J Biol Chem 275: 5329–5336.
63. Ferrer-Orta C, Arias A, Perez-Luque R, Escarmis C, Domingo E, et al. (2004)
Structure of foot-and-mouth disease virus RNA-dependent RNA polymerase
and its complex with a template-primer RNA. J Biol Chem 279: 47212–47221.
64. Ferrer-Orta C, Agudo R, Domingo E, Verdaguer N (2009) Structural insights
into replication initiation and elongation processes by the FMDV RNA-
dependent RNA polymerase. Current Opinion in Structural Biology 19:
752–758.
65. Ferrer-Orta C, Arias A, Perez-Luque R, Escarmis C, Domingo E, et al. (2007)
Sequential structures provide insights into the fidelity of RNA replication. Proc
Natl Acad Sci U S A 104: 9463–9468.
66. Ferrer-Orta C, Agudo R, Domingo E, Verdaguer N (2009) Structural insights
into replication initiation and elongation processes by the FMDV RNA-
dependent RNA polymerase. Curr Opin Struct Biol 19: 752–758.
67. Arias A, Agudo R, Ferrer-Orta C, Perez-Luque R, Airaksinen A, et al. (2005)
Mutant viral polymerase in the transition of virus to error catastrophe identifies a
critical site for RNA binding. J Mol Biol 353: 1021–1032.
68. Arias A, Ruiz-Jarabo CM, Escarmis C, Domingo E (2004) Fitness increase of
memory genomes in a viral quasispecies. J Mol Biol 339: 405–412.
69. Escarmı
´sC,Da´ vila M, Charpentier N, Bracho A, Moya A, et al. (199 6) Genetic
lesions associated with Muller’s ratchet in an RNA virus. J Mol Biol 264:
255–267.
70. Garcı
´a-Arriaza J, Manrubia SC, Toja M, Domingo E, Escarmı
´s C (2004)
Evolutionary transition toward defective RNAs that are infectious by
complementation. J Virol 78: 11678–11685.
71. Perales C, Mateo R, Mateu MG, Domingo E (2007) Insights into RNA virus
mutant spectrum and lethal mutagenesis events: replicative interference and
complementation by multiple point mutants. J Mol Biol 369: 985–1000.
72. Smith RA, Kirkpatrick W (1980) Ribavirin: a broad spectrum antiviral agent.
New York: Academic Press, Inc.
73. Sidwell OW, Simon LN, Witkowski JT, Robins RK (1974) Antiviral activity of
virazole: review and structure-activity relationships. Prog Chemotherapy 2:
889–903.
Adaptation through Transition Types
PLoS Pathogens | www.plospathogens.org 20 August 2010 | Volume 6 | Issue 8 | e1001072

74. Connor E, Morrison S, Lane J, Oleske J, Sonke RL, et al. (1993) Safety,
tolerance, and pharmacokinetics of systemic ribavirin in children with human
immunodeficiency virus infection. Antimicrob Agents Chemother 37: 532–539.
75. Jordan I, Briese T, Fischer N, Lau JY, Lipkin WI (2000) Ribavirin inhibits West
Nile virus replication and cytopathic effect in neural cells. J Infect Dis 182:
1214–1217.
76. Ogle JW, Toltzis P, Parker WD, Alvarez N, McIntosh K, et al. (1989) Oral
ribavirin therapy for subacute sclerosing panencephalitis. J Infect Dis 159:
748–750.
77. Anderson JF, Rahal JJ (2002) Efficacy of interferon alpha-2b and ribavirin
against West Nile virus in vitro. Emerg Infect Dis 8: 107–108.
78. Crumpacker C, Bubley G, Lucey D, Hussey S, Connor J (1986) Ribavirin enters
cerebrospinal fluid. Lancet 2: 45–46.
79. Escarmı
´s C, Perales C, Domingo E (2009) Biological effect of Muller’s Ratchet:
distant capsid site can affect picornavirus protein processing. J Virol 83:
6748–6756.
80. Coleman JR, Papamichail D, Skiena S, Futcher B, Wimmer E, et al. (2008)
Virus attenuation by genome-scale changes in codon pair bias. Science 320:
1784–1787.
81. Aragones L, Bosch A, Pinto RM (2008) Hepatitis A virus mutant spectra under
the selective pressure of monoclonal antibodies: codon usage constraints limit
capsid variability. J Virol 82: 1688–1700.
82. Frank AC, Lobry JR (1999) Asymmetric substitution patterns: a review of
possible underlying mutational or selective mechanisms. Gene 238: 65–77.
83. Galtier N, Lobry JR (1997) Relationships between genomic G+C content, RNA
secondary structures, and optimal growth temperature in prokaryotes. J Mol
Evol 44: 632–636.
84. Wang HC, Hickey DA (2002) Evidence for strong selective constrain t acting on
the nucleotide composition of 16S ribosomal RNA genes. Nucleic Acids Res 30:
2501–2507.
85. Pinto RM, Aragones L, Costafreda MI, Ribes E, Bosch A (2007) Codon usage
and replicative strategies of hepatitis A virus. Virus Res 127: 158–163.
86. Ojosnegros S, Beerenwinkel N, Antal T, Nowak MA, Escarmı
´s C, et al. (2010)
Competition-colonization dynamics in an RNA virus. Proc Natl Acad Sci USA
107: 2108–2112.
87. Sanz-Ramos M, Diaz-San Segundo F, Escarmis C, Domingo E, Sevilla N (2008)
Hidden virulence determinants in a viral quasispecies in vivo. J Virol 82:
10465–10476.
88. Ferrer-Orta C, Arias A, Escarmis C, Verdaguer N (2006) A comparison of viral
RNA-dependent RNA polymerases. Curr Opin Struct Biol 16: 27–34.
89. Agudo R, Arias A, Pariente N, Perales C, Escarmis C, et al. (2008) Molecular
characterization of a dual inhibitory and mutagenic activity of 5-fluorouridine
triphosphate on viral RNA synthesis. Implications for lethal mutagenesis. J Mol
Biol 382: 652–666.
90. Otwinowski Z, Minor W (1997) Processing X-ray diffraction data collected in
oscillation model. Methods Enzymol 276: 307–326.
91. Roussel A, Cambillau C (1989) Turbo-Frodo. Silicon Graph ics Geometry
Partners Directory. Mountain View, Ca: Silicon Graphics. pp 77–79.
92. Garcı
´a-Arriaza J, Ojosnegros S, Da´ vila M, Domingo E, Escarmis C (2006)
Dynamics of mutation and recombination in a replicating population of
complementing, defective viral genomes. J Mol Biol 360: 558–572.
93. Escarmı
´sC,Da´vila M, Domingo E (1999) Multiple molecular pathways for
fitness recovery of an RNA virus debilitated by operation of Muller’s ratchet.
J Mol Biol 285: 495–505.
Adaptation through Transition Types
PLoS Pathogens | www.plospathogens.org 21 August 2010 | Volume 6 | Issue 8 | e1001072