Content uploaded by Rita G W Pires
Author content
All content in this area was uploaded by Rita G W Pires on Feb 25, 2019
Content may be subject to copyright.
R E S E A R C H Open Access
Neuronal scaffolding protein spinophilin is
integral for cocaine-induced behavioral
sensitization and ERK1/2 activation
Lorena Bianchine Areal
1,2
, Alison Hamilton
1
, Cristina Martins-Silva
3
, Rita Gomes Wanderley Pires
2,3
and
Stephen S. G. Ferguson
1*
Abstract
Spinophilin is a scaffolding protein enriched in dendritic spines with integral roles in the regulation of spine density
and morphology, and the modulation of synaptic plasticity. The ability of spinophilin to alter synaptic strength
appears to involve its scaffolding of key synaptic proteins, including the important structural element F-actin,
AMPA/NMDA modulator protein phosphatase 1, and neuromodulatory G-protein coupled receptors, including
dopamine receptor D2 and metabotropic glutamate receptor 5. Additionally, spinophilin is highly expressed in
the striatum, a brain region that is fundamentally involved in reward-processing and locomotor activity which
receives both glutamatergic and dopaminergic inputs. Therefore, we aimed to investigate the role of spinophilin
in behavioral responses to cocaine, evaluating wild-type and spinophilin knockout mice followed by the examination
of underlying molecular alterations. Although acute locomotor response was not affected, deletion of spinophilin
blocked the development and expression of behavioral sensitization to cocaine while maintaining normal conditioned
place preference. This behavioral alteration in spinophilin knockout mice was accompanied by attenuated c-Fos and
ΔFosB expression following cocaine administration and blunted cocaine-induced phosphorylation of ERK1/2 in the
striatum, with no change in other relevant signaling molecules. Therefore, we suggest spinophilin fulfills an essential
role in cocaine-induced behavioral sensitization, likely via ERK1/2 phosphorylation and induction of c-Fos and ΔFosB in
the striatum, a mechanism that may underlie specific processes in cocaine addiction.
Keywords: Drug addiction, Spinophilin, Cocaine, Behavioral sensitization
Introduction
Drug addiction represents a socioeconomic and
worldwide public health problem, with cocaine addic-
tion known as one of the most prevalent drug abuse
disorders [55]. Cocaine is a psychostimulant drug that
blocks the reuptake of dopamine and other mono-
amines which primarily activates the mesocorticolim-
bic dopaminergic system: a key component in the
reward circuitry [44]. Dopaminergic neurons from the
ventral tegmental area (VTA) project to the nucleus
accumbens (NAc) and dorsal striatum, as well as
prefrontal cortex (PFC), hippocampus and amygdala
[36,54]. Notably, the NAc also receives glutamatergic
inputs from cortical and limbic regions, such as pre-
frontal cortex (PFC), amygdala and hippocampus [7],
thereby establishing the NAc as a converging region
for dopamine and glutamate neurotransmission. While
the NAc is the main region responsible for the initial
rewarding effects of cocaine, the transition from vol-
untary to compulsive drug-use seems to involve a pro-
gressive shift towards dorsal striatum in controlling
cocaine seeking behavior [10,57,59]. Together, corti-
costriatal glutamatergic and mesencephalic-striatal
dopaminergic projections provide contextual informa-
tion, control impulsiveness and goal-directed behavior,
and regulate motivational and emotional responses to
drug stimuli [13,40].
Our laboratory has recently described the neuronal
scaffold protein spinophilin as a novel Group I mGluR-
* Correspondence: sferguso@uottawa.ca
1
Department of Cellular and Molecular Medicine and University of Ottawa
Brain and Mind Institute, University of Ottawa, 451 Smyth Road, Ottawa, ON
K1H 8M5, Canada
Full list of author information is available at the end of the article
© The Author(s). 2019 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0
International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and
reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to
the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver
(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Areal et al. Molecular Brain (2019) 12:15
https://doi.org/10.1186/s13041-019-0434-7
interacting protein involved in the regulation of mGluR5: a
prominent G protein-coupled receptor highly expressed in
limbic and cortical areas [48]. Our group demonstrated that
spinophilin interacts with the C-terminal tail and second
intracellular loop of mGluR5, and that this interaction ap-
pears to attenuate receptor endocytosis and subsequent
intracellular mGluR5-mediated ERK1/2, Akt, and Ca
2+
sig-
naling in primary cortical neurons [48]. Previous studies
have suggested mGluR5 to have an important role in co-
caine addiction, as deletion and antagonism of this receptor
have been shown to decrease cocaine self-administration,
cocaine-seeking after extinction, and conditioned place
preference [8,26,28,30]. Spinophilin has also been shown
to interact with dopamine D2 receptor (D2R) via the third
intracellular loop of both short and long isoforms of this re-
ceptor [51]. This receptor has also been implicated in pro-
cesses underlying cocaine addiction. Altered D2R
availability have been associated with high cocaine intake
and compulsive use in humans and monkeys [34,60]and
conditional knockout of D2 autoreceptors in mice enhances
acquisition of cocaine taking and reactivity to drug -paired
cues [20].
Spinophilin is a multifunctional scaffold protein that is
enriched in the dendritic spines and was first known for
its interaction with phosphatase 1 (PP1αand PP1γ) and
F-actin [1,47]. Spinophilin has a role in modulating the
morphology and density of dendritic spines [9,11]. Add-
itionally, it regulates synaptic strength by anchoring PP1
in close proximity to ionotropic glutamate receptors
AMPA and NMDA and directing its substrate specificity
[11,22,42]. Noteworthy, D1-mediated regulation of
AMPA receptor activity is deficient in striatal neurons of
spinophilin-KO mice [2]. Along with a PP1 binding domain
and a F-actin binding site, spinophilin contains a PDZ
domain, a receptor-interacting domain and a coiled-coil re-
gion [46]. Furthermore, spinophilin exhibit phosphorylation
sites for several protein kinases, such as PKA, CaMKII,
Cdk5 and ERK [14,16,21,46,53]. Moreover, the loss of
spinophilin expression leads to impaired dopamine- and
glutamate-dependent LTD, but not LTP [2,11,48].
Considering spinophilin’s roles in dopaminergic and glu-
tamatergic signaling, its involvement in neuronal plasti-
city, and the contribution of these systems to cocaine
addiction, it is foreseeable that spinophilin could play a
neuromodulatory role in the mechanisms underlying
cocaine addiction. Moreover, increased spinophilin ex-
pression in the prefrontal cortex of rhesus monkeys fol-
lowing extended cocaine self-administration has been
reported, suggesting that spinophilin may be involved
in the development of cocaine addiction [31]. Thus, we
sought to investigate the effects of spinophilin deletion
in behavioral responses to cocaine and to identify
potential molecular mechanisms that may underlie its
involvement.
Materials and methods
Material
Western blots materials and reagents were purchased from
Bio-Rad. Rabbit anti–phospho-p44/42 ERK1/2 (Thr202/
Tyr204), ERK1/2, phospho-GSK3β(Ser9), NMDA receptor
2A, NMDA receptor 2B, PSD95, spinophilin, tyrosine
hydroxylase, phospho-Akt, mTOR, phospho mTOR, and
mouse anti-GSK3β, Akt antibodies were purchased from
Cell Signaling Technology. Rabbit anti-phospho tyrosine
hydroxylase Ser40 was purchased from Phosphosolutions.
Rabbit anti-Dopamine receptor 1, Dopamine receptor 2,
c-Fos were obtained from Abcam. Rabbit anti–GAPDH
(glyceraldehyde- 3-phosphate dehydrogenase) was pur-
chased from Santa Cruz Biotechnology and rabbit anti--
mGluR5 was obtained from Milipore Sigma. Antibodies
validation data are available from their respective compan-
ies. For RNA extraction and qPCR Sigma-Aldrich DNase
I, TRIzol reagent from ThermoFisher Scientific, iScript™
cDNA synthesis kit from Bio-Rad and Luna Universal
qPCR Master Mix from New England Biolabs were used.
Vector Elite ABC HRP kit (rabbit) used in immunohisto-
chemistry was purchased from Vector Laboratories.
Animals and drugs
Spinophilin knockout mice were generously provided by
Dr. Paul Greengard (Rockefeller University, New York)
and bred to a C57BL/6 background. Details on the
generation of the mutant mice can be found at Feng et
al., 2006. Male spinophilin knockout and wild type
littermate controls (C57BL6) ageing between 8 and 12
weeks (weighing 25–32 g) were used in this study.
Animals were housed in the animal care facility at the
University of Ottawa on a 12-h light/12-h dark cycle,
with food and water ad libitum,and were housed in ven-
tilated racks with a maximum of 5 mice per cage. Exper-
iments were conducted between 8 AM and 6 PM at the
behavioural core. The order in which groups were tested
was balanced between the 3 different biological repli-
cates. All animal experiments were performed following
the Canadian Council of Animal Care guidelines and ap-
proved by the University of Ottawa animal care commit-
tee (protocol no. CMM2519). Physical and behavioral
well-being of animals were monitored by the Animal
Care and Veterinary Service and by the experimenter.
Wild-type (WT) and spinophilin knockout (KO) mice
were submitted intraperitonially to 4 different treat-
ments: saline, cocaine (15 mg/Kg), CTEP (1.5 mg/Kg) or
cocaine (15 mg/Kg) + CTEP (1.5 mg/Kg) simultaneously,
providing a total of 8 experimental groups. Mice were
allocated to groups by simple randomization in a Micro-
soft Excel file and experimenters were not blinded.
Sample size was based on previous studies. The drug
concentrations used in this study were based on a dose
response curve for locomotor activity (data not shown)
Areal et al. Molecular Brain (2019) 12:15 Page 2 of 16
and the selected doses were over the half maximum
response. Although CTEP is orally bioavailable, intraper-
itoneal administration was chosen in order to allow for
co-treatment controlling the kinetics of the drugs and to
limit the potential distress of further procedures. Co-
caine hydrochloride (Toronto Research Chemicals) was
dissolved in sterile saline solution (NaCl 0.9%) and
CTEP (Axon Biochem) was initially dissolved in sterile
DMSO then diluted in saline (final DMSO concentration
was 5%).
Behavioural sensitization
Mice were tested in a square open field apparatus fol-
lowing a protocol described in [45]. From day 1 to 3,
mice from all groups (n=10–13 per group) received a
saline injection and were placed in the open field arena
for 30 min for habituation (Fig. 1). On days 4–8, mice
from each group were injected with their respective
drugs (cocaine, CTEP, cocaine+CTEP) or saline and
tested in the open field for 30 min. All sessions were
recorded and analyzed using the software EthoVision
XT 13.0 (Noldus) for locomotor activity. After 5 days of
drug administration, mice underwent a withdrawal
period of 5 days followed by a challenge, where they were
tested with the same drugs previously administered.
Stereotypy was additionally analyzed on the challenge day.
Visual analysis of stereotypic behaviors including groom-
ing, sniffing, rearing and head bobbing was performed by
a blind experimenter in 60-s observation periods every 5
min starting 10min after injection and continuing until
the end of the test as previously described [32]. In
addition, stereotypic rotation behavior has been automat-
ically analyzed through Ethovision software throughout
the duration of the test (30 min).
Conditioned place preference
CPP was assessed using a two-chamber box equipped
with infrared beams (Med Associates) as previously de-
scribed with modifications [38,45]. The two compart-
ments exhibited different patterns on the walls and floor,
and were separated by a removable guillotine door. On
the first day, mice were allowed to freely explore both
chambers for 20 min. For the conditioning phase, mice
received a saline injection and were confined to one
chamber or a drug injection (cocaine, CTEP or cocaine
+CTEP) and were confined to the opposite chamber for
20 min. Mice were submitted to 3 saline-paired injec-
tions and 3 drug-paired injections in alternate days,
resulting in 6 days of conditioning. Conditioning was
counterbalanced so that half of the mice received co-
caine injections paired to side A and for the other half
cocaine was paired to side B. The CPP test was per-
formed 24 h after the last conditioning session and con-
sisted of a drug free session where mice were allowed to
freely explore both compartments for 20 min as in the
habituation session. Time spent in each compartment
WT and Spinophilin-KO
mice
Conditioned Place Preference
Behavioral sensitization
habituation
drug
administration withdrawal challenge
1 2 3 4 5 6 7 8 9 10 11 12 13 14*
Pre-test
(habituation) SD/SS SD/S Test
12345678*
D/S
Days
Days
Molecular and
biochemical
analysis
Molecular and
biochemical
analysis
Conditioning
phase
Fig. 1 Experimental design. Wild-type and spinophilin-KO mice were submitted to either the behavioral sensitization or the condition place
preference paradigm. After behavioral testing, mice had their brains dissected for biochemical assays or collected for immunostaining
Areal et al. Molecular Brain (2019) 12:15 Page 3 of 16
was assessed and the data were expressed as the differ-
ence between the time spent on the drug-paired side
and the saline-paired side. Ten to thirteen mice per
group were tested.
Western blotting
Mice submitted to the CPP protocol received one last in-
jection after the test and were euthanized and dissected 10
min later for western blot analysis. This interval was chosen
based on the peak of cocaine locomotor effects exhibited
by these mice, potentially reflecting an optimal signalling
time point. Striatum samples(from6to8animalsper
group) were homogenized in RIPA buffer containing prote-
ase and phosphatase inhibitors and rotated for 30 min
at 4 °C. The homogenate was centrifuged at 12.000×g
for 20 min and supernatant was collected for protein
quantification. The lysates were diluted in SDS buffer
containing 2-mercaptoethanol and 30μgofproteinwas
separated by SDS-PAGE and transferred to a 0.45um
nitrocellulose membrane. Membranes were blocked in
10% milk-TSBT solution, incubated overnight at 4 °C
with primary antibodies diluted in 3% milk-TBST solution,
washed, and incubated for 2 h at room temperature with
secondary HRP-conjugated antibodies. For the phosphoryl-
ation assays, membranes were first blotted for phospho-
protein, stripped, and then blotted for total protein. Phos-
phorylation levels were normalized to the total levels of the
protein in interest. All antibodies used and their respective
catalog numbers are listed on section 2.1 (Materials). Blots
were developed with the Clarity Western ELC substrate
(Bio-Rad), imaged in a Chemidoc system (Bio-Rad) and an-
alyzed using ImageLab software (Bio-Rad).
Gene expression analysis
qPCR was performed as previously described [3]. Striatum
samples from 6 to 8 animals per group previously submit-
ted to the CPP protocol were frozen in dry-ice immediately
after dissection and stored at −80 °C until RNA extrac-
tion. Total RNA was extracted using TRIzol Reagent
(Invitrogen) as per manufacturer’sinstructions.RNA
samples were treated with DNase I (Sigma-Aldrich) and
reverse transcribed to cDNA using iScript™cDNA syn-
thesis kit (Bio-rad). CFX96 Real Time PCR (Bio-rad)
system and Luna® Universal qPCR Master Mix (New
England BioLabs®) were used for qPCR. Relative gene
mRNA expression was analyzed by 2
−ΔΔ
Ct method,
using Gapdh as reference gene. All primers were vali-
dated by serial dilution and presented reaction effi-
ciency superior than 80%. The sequences of the primers
used for qPCR are presented in Table 1.
Immunostaining
Brain samples for immunostaining were obtained from
mice submitted to the behavioral sensitization protocol
that were euthanized right after the challenge test (ap-
proximately 45 min after the last drug injection). This
cohort was selected for c-Fos analysis because c-Fos ex-
pression is highly detectable 30 min after stimulation in
rodents [15,65], as opposed to signalling proteins such as
pERK. Briefly, 40 μm coronal sections through the stri-
atum were performed and free-floating sections were sub-
mitted to a peroxidase-based immunostaining protocol.
Sections were incubated in primary antibody for c-Fos
(1:400, Abcam) overnight at 4 °C, washed, incubated in bi-
otinylated antibody [1:400; biotinylated goat anti-rabbit
IgG (Vector Elite ABC HRP kit (rabbit), Vector Laborator-
ies], and then incubated in an avidin/biotin enzyme re-
agent [Vector Elite ABC HRP kit (rabbit), Vector
Laboratories]. Immunostaining was visualized by reaction
with a chromogen (Vector SG substrate). Sections were
mounted on slides and imaged on a Zeiss LSM880
AxioObserver Z1 microscope, using representative 900
μm
2
areas of the striatum. 3 to 5 slices from 3 brains per
group were analysed.
Table 1 Primers used for qPCR
Gene NCBI Refseq Sequence (5′-3′) Amplicon lenght (bp)
D1R NM_010076.3 F: CCAAGAACGTGAGGGCTAAG
R: TGAGGATGCGAAAGGAGAAG
120
D2R NM_010077.2 F: CCACTCAAGGGCAACTGTACC
R: TGACAGCATCTCCATTTCCAG
143
mGluR5 NM_001143834.1 F: AGTCATTTACCTAAAGCCCGG
R: CTTCTCGCTGATACCCATCTG
166
NR2A NM_008170.2 F: ATGACTATTCTCCGCCTTTCC
R: AGTTTACAGCCTTCATCCCTC
220
NR2B NM_008171.3 F: GAACGAGACTGACCCAAAGAG
R: CAGAAGCTTGCTGTTCAATGG
248
DeltaFosB NM_001347586.1 F: TGCAGCTAAGTGCAGGAACCGT
R: GAGGACTTGAACTTCACTCGGCCA
224
GAPDH NM_001289726.1 F: CCTCGTCCCGTAGACAAAATG
R: TTGACTGTGCCGTTGAATTTG
194
Areal et al. Molecular Brain (2019) 12:15 Page 4 of 16
1
2
3
4
5
6-10
challenge
0
5000
10000
15000
20000
25000
30000
Sessions
Distance Travelled (cm)
WT-saline (n=11)
KO-saline (n=10)
WT-cocaine (n=13)
KO-cocaine (n=11)
****
Behavioral sensitization
A
BC
WT KO
0
5000
10000
15000
20000
25000
Day 1
Distancetrave
lled (cm)
saline
cocaine
*** ***
WT KO
-200
0
200
400
600
800
Diference between saline- and
cocaine-paired side (s)
saline
cocaine
***
Conditioned Place Preference
***
DE
WT KO
0
20
40
60
80
100
Rotation (frequency)
saline
cocaine
**
WT KO
0
10
20
30
Stereotypy (% of time)
saline
cocaine
**
F
spinophilin
130 kDa
GAPDH
37 kDa
WT KO WT KO
saline cocaine
G
WT KO
-5000
0
5000
10000
15000
Diferencebetween day1
and challenge(
cm)
saline
cocaine
** **
Fig. 2 (See legend on next page.)
Areal et al. Molecular Brain (2019) 12:15 Page 5 of 16
Statistical analysis
Statistical comparisons wereperformedusingGraphPad
Prism 7 software. Data was analyzed by two-way ANOVA
followed by Tukey post-hoc. For the behavioral sensitization
exclusively, two-way ANOVA with repeated measures was
performed. Normality was calculated by Shapiro-Wilk
test to determine the appropriate use of parametric or
non-parametric tests. Grubbs’test was performed to
detect outliers. Data were expressed as mean ± SEM
and considered significant when p<0.05.
Results
Spinophilin is required for cocaine-induced behavioral
sensitization but not conditioned place preference
A classic behavioral effect of cocaine is hyperlocomotion.
Consecutive drug administrations produced different
responses between WT and spinophilin-KO mice (re-
peated measures two-way ANOVA - interaction: F (15,
185) = 3.137 p= 0.0001; time effect: F (5, 185)= 4.94 p=
0.0003; group effect: F (3, 37) = 37.3 p< 0.0001) (Fig. 2a).
In terms of acute locomotor responses, assessed on the
first session of the behavioral sensitization protocol, there
was no difference in the cocaine induced hyperlocomotion
between genotypes [F (1, 40) = 44.45 p< 0.0001 for treat-
ment, F (1, 40) = 0.0003448 p= 0.9853 for genotype,
WT-cocaine vs. KO-cocaine p> 0.9999] (Fig. 2b). Basal
locomotor activity is also not affected by deletion of spino-
philin (p> 0.9999 for WT-saline vs. KO-saline) (Fig. 2b).
While WT mice progressively increases the locomotor
response to cocaine during the development phase of the
behavior sensitization protocol, spinophilin-KO loco-
motion remained the same throughout the sessions, with
significant differences between genotypes being ob-
served on days 4 (p= 0.0350) and 5 (p= 0.0006) (Fig.
2a). In addition, Tukey’s multiple comparisons test
shows a significant difference for locomotor activity be-
tween WT-cocaine and KO-cocaine on the challenge day
(p= 0.0475). The indication of a lack of behavioral
sensitization in spinophilin-KO mice is reinforced by ana-
lysis of the variation of locomotor activity on challenge
day versus the first cocaine administration, with significant
increase being observed only for WT mice (WT-saline vs.
WT-cocaine p= 0.0013, KO-saline vs. KO-cocaine p=
0.5746, WT-cocaine vs. KO-cocaine p= 0.0037) (Fig. 2c).
In order to verify if the lower locomotor activity observed
in KO mice was possibly due to increased stereotypy
induced by cocaine in this group, stereotypic behavior was
analyzed on the challenge day and no difference was ob-
served between cocaine-WT and cocaine-KO on the auto-
mated or visual analysis (WT-cocaine vs. KO-cocaine p=
0.9935 for stereotypies on visual analysis and p=0.9621
for rotation behavior analyzed through Ethovision soft-
ware). Possible differences in the rewarding effects of
cocaine were also investigated, using the conditioned place
preference (CPP) paradigm. However, both WT and
spinophilin-KO mice developed CPP to cocaine (WT-sa-
line vs. WT-cocaine p= 0.0018, KO-saline vs. KO-cocaine
p= 0.0005) with no differences observed between geno-
types (WT-cocaine vs. KO-cocaine p= 0.9900) (Fig. 2d).
mGluR5 antagonism enhances locomotor activity in
spinophilin-KO mice without rescuing deficits in
behavioral sensitization
Since spinophilin-KO mice present increased intracellu-
lar mGluR5 signalling [48] and this receptor has been
implicated in the development of cocaine addiction [8,
28,30,66–68], we sought to investigate if a negative
allosteric modulator for mGluR5 would interfere on co-
caine effects in spinophilin-KO mice. Considering that
there were no significant behavioral effects induced by
CTEP alone (saline-WT versus CTEP-WT: p= 0.9988
for acute effects on first session, p> 0.9999 for the ex-
pression of behavioral sensitization and p> 0.9999 for
the CPP), the data sets were separated in order to sim-
plify results for presentation and facilitate the identifica-
tion of mGluR5 involvement in the cocaine response
versus spinophilin-KO effects on cocaine response. Since
the first drug administration, it was observed that CTEP
co-treatment potentiates cocaine-induced hyperlocomo-
tion on spinophilin-KO mice (WT-Cocaine+CTEP vs.
KO-Cocaine+CTEP p< 0.0001) while no difference was
observed between WT and spinophilin-KO on the saline
+CTEP condition (p= 0.4128) (Fig. 3a and b). This
hyperlocomotion was sustained throughout the behav-
ioral sensitization protocol with no further increase
along the sessions (Fig. 3a). Wild-type mice that received
co-administration of cocaine and CTEP exhibited nor-
mal cocaine-induced locomotor sensitization, as evi-
denced by an increase in the locomotor response on the
challenge day versus the first administration, in compari-
son to CTEP control (WT-saline+CTEP vs. WT-cocaine
+CTEP p= 0.0052) (Fig. 3c), and reached comparable
(See figure on previous page.)
Fig. 2 Spinophilin-KO effects on cocaine-related behaviors. aLocomotor responses to repeated cocaine injections in wild-type and spinophilin-
KO mice. bAcute hyperlocomotion induced by cocaine in wild-type and spinophilin-KO mice. cBehavioral sensitization to cocaine treatment in
wild-type and spinophilin-KO mice. dStereotypic rotation behavior during the challenge test calculated by automated analysis. eStereotypy
(including grooming, sniffing, rearing and head bobbing) on the challenge day analyzed by a blinder experimenter. fConditioned place
preference to cocaine in wild-type and spinophilin-KO mice. gRepresentative western blot confirming the knockout of spinophilin. Data
expressed as mean ± SEM. Two-way ANOVA with repeated measures followed by Tukey post-hoc, n =10–13 per group. **p< 0.01, ***p< 0.001
Areal et al. Molecular Brain (2019) 12:15 Page 6 of 16
1
2
3
4
5
6-10
challenge
0
5000
10000
15000
20000
25000
30000
35000
Sessions
DistanceT
ravelled(cm)
WT-cocaine (n=13)
KO-cocaine (n=11)
*
**
WT-saline (n=11)
KO-saline (n=10)
*
*
CTEP co-administration
Behavioral sensitization
A
BC
D
WT KO
0
10000
20000
30000
40000
Day1
Distancetravelled (cm)
saline
cocaine
****
CTEP co-administration
**** **
WT KO
0
5000
10000
15000
Diference between day1
andchallenge(cm)
saline
cocaine
**
CTEP co-administration
**
WT KO
-500
0
500
1000
Diference between saline-an
d
cocaine-paired side(s
)
saline
cocaine
CTEP co-administration
Conditioned Place Preference
*** ***
Fig. 3 (See legend on next page.)
Areal et al. Molecular Brain (2019) 12:15 Page 7 of 16
locomotor activity as spinophilin-KO on day 5 (p=
0.8724). On the other hand, similar to previously ob-
served, spinophilin-KO mice did not develop
sensitization (KO-saline+CTEP vs. KO-cocaine+CTEP
p= 0.6171) (Fig. 3c). However, it should be noted that
the maximal locomotor response had already been
achieved on the first sessions for the KO mice, which
could lead to the lack of a further increase. When
tested on the CPP paradigm, it was observed that mice
co-administered with cocaine and CTEP developed CPP
normally, independent of genotype (WT-saline+CTEP vs.
WT-cocaine+CTEP p= 0.0465, KO-saline+CTEP vs.
KO-cocaine+CTEP p= 0.0119, WT-cocaine+CTEP vs.
KO-cocaine+CTEP p= 0.9945) (Fig. 3d). Co-treatment
with CTEP was initially proposed to investigate if differ-
ences in cocaine effects on spinophilin-KO was mediated
by mGluR5. CTEP did not affect behavioral sensitization,
the striking behavioral difference promoted by deletion of
spinophilin. When combined with cocaine, CTEP potenti-
ated the hyperlocomotion, without affecting behavioral
sensitization or conditioned place preference, key para-
digms to study cocaine addiction in animal models. This
suggests that the CTEP effect on KO mice at the dose
used may be related mostly to motor aspects, in accord-
ance with previous reports that blockage of mGluR5 pro-
duces [17,43]. Therefore, herein we focused our
molecular and biochemical studies on the cocaine effects
in the presence or absence of spinophilin.
Spinophilin deletion attenuates c-Fos and ΔFosB
expression induced by cocaine
In order to investigate the molecular changes underlying
the behavioral responses on the spinophilin-KO mice,
immediate early genes from the Fos family were evaluated
in the striatum of mice that underwent the behavioural
sensitization protocol. Immunohistochemistry for c-Fos
revealed that although both WT and KO mice adminis-
tered with cocaine showed increased immunoreactivity to
c-Fos (WT-saline vs. WT-cocaine p< 0.0001; KO-saline
vs. KO-cocaine p< 0.0001), this effect was reduced in
spinophilin-KO in comparison to WT (p< 0.0001) (Fig. 4a
and b). Similarly, qPCR analysis of ΔFosb showed a signifi-
cant increase in mRNA levels of ΔFosb only on WT mice
(WT-saline vs. WT-cocaine p= 0.0479, KO-saline vs.
KO-cocaine p= 0.2252) (Fig. 4c).
Spinophilin-KO mice exhibit increased expression of
NR2A subunit with no alterations on other main
glutamate and dopamine receptors
We then explored possible alterations in dopaminergic and
glutamatergic signalling underlying the behavioral effects.
Gene and protein expression of dopamine and glutamate
receptors in the striatum were evaluated. Cocaine induced
changes in D1 receptor gene expression (p= 0.0377) in
spinophilin-KO mice only, but no changes on D2 receptor
gene expression were found (Fig. 5a and b). Similarly,
mGluR5 gene expression was not altered by any of the
experimental treatments (Fig. 5c).Interestingly,geneex-
pression of NMDA receptor subunit 2A was constitutively
increased in spinophilin-KO mice (WT-saline vs. KO-saline
p= 0.0289) and no significant differences were found in
NR2B subunit gene expression (Fig. 5d and e). Although
cocaine induced an increase in D1 receptor gene expression
in the spinophilin KO mice, D1 receptor protein levels were
not significantly altered (p= 0.9986) (Fig. 6aandb).No
differences were found between treatment or genotype for
either D2R protein expression (Fig. 6aandc)ormGluR5
expression (Fig. 6a and d). Similar to what was observed for
gene expression of NMDA receptor subunit 2A, NMDA
receptor subunit 2A protein levels in spinophilin-KO mice
were also elevated in comparison to WT mice (p= 0.0335)
(Fig. 6a and e). However, no difference between geno-
types was observed after cocaine treatment (p>0.05 for
WT-saline vs. KO-cocaine and WT-cocaine vs. KO-cocaine).
Although no significant differences on the posthoc were
found in NR2B subunit protein levels, 2-way ANOVA
showed a genotype effect (Fig. 6a and f ). In order to in-
vestigate if general synaptic alterations occurred, we
evaluated expression of PSD95 as a postsynaptic marker
(Fig. 6g) and tyrosine hydroxylase (TH) expression as a
dopaminergic presynaptic marker (Fig. 6h) and no differ-
ence was observed between groups suggesting that synap-
ses were intact.
Cocaine-induced activation of ERK1/2 in the striatum is
absent in spinophilin-KO mice
To further investigate if cocaine impacts striatal signal-
ling differently in the presence or absence of spinophilin,
dopamine and glutamate signalling pathways were evalu-
ated. Noteworthy, the increase in ERK phosphorylation
induced by cocaine in the WT mice was blunted in spi-
nophilin-KO mice (WT-saline vs. WT-cocaine p= 0.0077;
(See figure on previous page.)
Fig. 3 CTEP co-treatment affect acute locomotor response but not behavioral sensitization to cocaine in spinophilin-KO mice. aLocomotor
responses to repeated co-treatment with cocaine and CTEP in wild-type and spinophilin-KO mice. bAcute hyperlocomotion induced by cocaine
and CTEP co-treatment in wild-type and spinophilin-KO mice. cBehavioral sensitization to cocaine and CTEP co-treatment in wild-type and
spinophilin-KO mice. dConditioned place preference to cocaine and CTEP co-treatment in wild-type and spinophilin-KO mice. Data expressed as
mean ± SEM. Two-way ANOVA with repeated measures followed by Tukey post-hoc, n =10–13 per group. **p< 0.01, ***p< 0.001
Areal et al. Molecular Brain (2019) 12:15 Page 8 of 16
KO-saline vs. KO-cocaine p= 0.9965) (Fig. 7aandb).Co-
caine administration increased pAkt in both WT (p=
0.0385) and KO mice (p= 0.0049) when compared to
their respective controls, with no difference found be-
tween WT-cocaine and KO-cocaine (p= 0.7071) (Fig.
7a and c). With respect to pGSK3βlevels, no
A
BC
Fig. 4 Spinophilin deletion affects cocaine induction of Fos family IEGs. aRepresentative images for immunostaining of c-Fos in the striatum of
wild-type and spinophilin-KO mice. Quantification of cocaine-induced expression of b) c-Fos and c)ΔFosb mRNA levels in wild-type and spinophilin-
KO mice. Data expressed as mean± SEM. Two-way ANOVA followed by Tukey post-hoc.*p< 0.05 for the indicated comparisons,
###
p< 0.001 compared
to all other groups and
&&&
p< 0.001 compared to saline-WT and saline-KO
Areal et al. Molecular Brain (2019) 12:15 Page 9 of 16
genotype or treatment effect was observed (Fig. 7a
and d). Furthermore, phosphorylation of mTOR was
significantly increased in spinophilin-KO mice treated
with cocaine in comparison to WT-saline (p= 0.0429)
while a trend was seen for KO-saline (Fig. 7aande).
Although not statistically significant, there was a
trend for mTOR phosphorylation to be altered in the
wild-type mice after cocaine treatment as well. Two-way
ANOVA reveals that there is a treatment effect but not a
genotype effect, in alignment with the pAkt results [pAkt/
Akt: F (1, 28) = 0.8441, p= 0.3661 for genotype and F
(1, 28) = 21.43, p< 0.0001 for treatment; pmTOR/
mTOR:F(1,28)=3.218,p= 0.1836 for genotype and F
(1, 28) = 4.688, p= 0.0390 for treatment]. Presynaptic
signalling was also evaluated through phosphorylation
levels of TH, no difference in pTH was found between
the different conditions (Fig. 7aandf).
Discussion
Spinophilin has been shown to interact with both D2R
and mGluR5 which are components of dopamine and
glutamate systems that are known to be involved in drug
addiction. However, little is known about spinophilin’s
possible role in mechanisms underlying cocaine addic-
tion. Herein, we showed that deletion of spinophilin did
not alter acute locomotor responses to cocaine, but
attenuated cocaine-induced behavioral sensitization.
Similar results have been reported by Morris and
AB
CD
E
WT KO
0
100
200
300
RelativemRNA expression
(% of saline-wt)
D1R
*
saline
cocaine
WT KO
0
50
100
150
Relative mRNA expression
(% of saline-wt)
D2R
saline
cocaine
WT KO
0
50
100
150
200
250
Relative mRNA expression
(% of saline-wt)
mGluR5
saline
cocaine
WT KO
0
100
200
300
Relativem
RNA expression
(%ofsaline-wt)
NR2A
saline
cocaine
*
WT KO
0
50
100
150
200
250
Relative mRNA expression
(% of saline-wt)
NR2B
saline
cocaine
Fig. 5 Cocaine effects on gene expression in the striatum. Cocaine-induced changes in a) D1R, b)D2R,c) mGluR5, d)NR2Aande)NR2BmRNAlevels
in wild-type and spinophilin-KO mice. Data expressed as mean ± SEM. Two-way ANOVA followed by Tukey post-hoc,n=6–8 per group. *p<0.05
Areal et al. Molecular Brain (2019) 12:15 Page 10 of 16
WT KO
0
200
400
600
800
Protein expression
(% of saline-wt)
NR2A
saline
cocaine
*
WT KO
0
50
100
150
200
Protein expression
(% of saline-wt)
PSD95
saline
cocaine
WT KO
0
50
100
150
Protein expression
(%ofs
aline-wt)
mGluR5
saline
cocaine
WT KO
0
50
100
150
200
250
Protein expression
(% of saline-wt)
NR2B
saline
cocaine
WT KO
0
50
100
150
Proteinexpression
(%ofs
aline-wt)
TH
saline
cocaine
WT KO
0
50
100
150
Protein expression
(%ofsaline-wt)
D2R
saline
cocaine
WT KO
0
50
100
150
Protein expression
(%ofsaline-wt)
D1R
saline
cocaine
WT KO WT KO
saline cocaine
AB
C
D
F
E
D1R 48 kDa
D2R 50 kDa
mGluR5 150 kDa
NR2A 180 kDa
NR2B 190 kDa
GAPDH 37 kDa
Spinophilin 130 kDa
GH
PSD95 95 kDa
TH 60 kDa
Fig. 6 (See legend on next page.)
Areal et al. Molecular Brain (2019) 12:15 Page 11 of 16
colleagues, where spinophilin-KO mice did not develop
locomotor sensitization to amphetamine, while no geno-
type effect was seen on the first amphetamine adminis-
tration [33]. Despite the effect of spinophilin deletion on
the behavioral sensitization paradigm, this protein does
not seem to be required for cocaine-induced CPP, as
evidenced by the development of conditioned place pref-
erence in both wild-type and spinophilin-KO mice. A
previous study suggested that spinophilin-KO mice would
be more sensitive to cocaine effects based upon observa-
tions that cocaine induced CPP at a low dose (5 mg/Kg)
that did not induce responses in wild-type mice. However,
they observed no difference in response between genotypes
at 10 mg/Kg of cocaine: a dose closer to that used in
the present study (15 mg/Kg). In further comparison,
spinophilin-KO mice in our study did not develop co-
caine sensitization, while Allen et al. [2]reportthatthis
behavior was preserved in spinophilin-KO mice in their
study. This discrepancy is likely related to important
differences in the protocol used for the sensitization
paradigm, since the protocol used by Allen et al. [2]
consisted of 5 consecutive days where the locomotor
activity was monitored for 10 min after cocaine adminis-
tration (20 mg/Kg). The absence of withdrawal and chal-
lenge, shorter observational time, and higher dose in
comparison to our parameters may have impacted the
contrasting findings observed between the two studies.
Enhanced cocaine-induced c-Fos expression in spinophi-
lin-KO mice has also been previously reported by Allen et
al. [2]. Conversely, we observed attenuated c-Fos and ΔFosb
expression in cocaine-KO mice compared to cocaine-WT.
These differences may rely on the experimental approaches,
since in this study the analysis was performed after the
challenge of the behavioral sensitization protocol, while in
[2] it was after an acute administration, in addition, the
method used for c-FOS analysis was in situ hybridization in
[2], while herein immunostaining was performed. Rapid in-
duction of Fos family proteins is a classic cellular response
to cocaine and D1 agonists, especially in regions involved
with the rewarding and locomotor effects such as the nu-
cleus accumbens, dorsal striatum and prefrontal cortex [15,
29,35]. While c-Fos returns to basal levels within hours
after drug administration, Δfosb, a very stable truncated
form, accumulates with chronic exposure and can persist in
the neurons for weeks after cessation of drug administra-
tion and has been shown to increase sensitivity and
drug-seeking behavior to cocaine [25,37]. Fos gene deletion
in D1R-expressing neurons not only disrupts the
cocaine-induction of c-Fos and ΔFosb expression but also
attenuates behavioral sensitization in the mutant mice [63].
On the other hand, normal CPP and increased extinction
time were exhibited by the Fos-KO mice [63]. In accord-
ance with that, spinophilin-KO mice, in the present study,
did not develop behavioral sensitization and presented at-
tenuated cocaine-induction of c-Fos and ΔFosb, while CPP
was maintained.
c-Fos and ΔFosb expression can be induced by transcrip-
tion factors that are activated by pERK, such as CREB and
Elk-1 [49,58,64]. In the present study, ERK phosphoryl-
ation was not induced by cocaine treatment in the
spinophilin-KO mice. Several studies indicate that ERK ac-
tivity has a role in the development of cocaine-induced
locomotor sensitization. It has been shown that systemic
injections of MEK inhibitors during the development phase
prevents the expression of cocaine-induced locomotor
sensitization after withdrawal [12,41,56]. On the other
hand, MEK inhibitors show no significant effect on ei-
ther spontaneous locomotor activity or acute cocai-
ne-induced locomotion in the cited studies. Herein, while
the behavioral sensitization was absent in spinophilin-KO
mice they still developed a place preference for cocaine.
Although it has been shown that ERK activation is linked
to both sensitization and conditioned place preference,
there are several signalling pathways involved in both of
these processes. For example, Akt/GSK3/mTOR signalling
pathway in the nucleus accumbens, hippocampus, and/or
prefrontal cortex is critically involved in the expression
and reconsolidation of cocaine conditioned place prefer-
ence [4,50]. In the present study, Akt and mTOR phos-
phorylation in response to cocaine remained intact.
Therefore, it is possible that other signaling pathways
involved the development of conditioned place prefer-
ence may have compensated the reduced ERK activa-
tion and been sufficient for the expression of this
behavior, but not for the behavioral sensitization.
The mechanisms underlying cocaine-induced behav-
ioral sensitization are not fully elucidated. However, the
literature indicates that this phenomenon is associated
with an increase in dopaminergic neurotransmission,
with increases in dopamine release [24,39] and D1R
sensitivity [18,24], as well as decreased autorreceptor
activity [19,52] and LTP induction [5] being reported. In
addition, studies show that a reduction in D2R activity
in the prefrontal cortex occurs in association with the
development of cocaine sensitization and that repeated
administrations of a D2R antagonist promotes sensitization
(See figure on previous page.)
Fig. 6 Effects of cocaine on dopamine and glutamate receptors expression in the striatum. aRepresentative images of immunoblots for D1R, D2R,
mGluR5, NR2A, NR2B, PSD95, tyrosine hydroxylase (TH), GAPDH and spinophilin protein expression in the striatum of wild-type and spinophilin-KO
mice. Effect of cocaine treatment on b)D1R,c) D2R, d)mGluR5e)NR2A,f) NR2B, g)PSD95 and h) tyrosine hydroxylase protein expression in wild-type
and spinophilin-KO mice. Data expressed as mean ±SEM. Two-way ANOVA followed by Tukey post-hoc,n=6–8 per group. *p<0.05
Areal et al. Molecular Brain (2019) 12:15 Page 12 of 16
WT KO WT KO
saline cocaine
AB
C
D
E
pERK 42 kDa
ERK 42 kDa
pAkt 60 kDa
Akt 60 kDa
pGSK3 46 kDa
GSK3 46 kDa
pmTOR 289 kDa
mTOR 289 kDa
GAPDH 37 kDa
Spinophilin 130 kDa
F
pTH 60 kDa
TH 60 kDa
WT KO
0
100
200
300
400
pERK/ERK
(%ofs
aline-wt)
pERK
saline
cocaine
*
WT KO
0
50
100
150
200
250
pAkt/Akt
(% of saline-wt)
pAkt
saline
cocaine
*
**
WT KO
0
50
100
150
200
pGSK3/GSK3
(%ofs
aline-wt)
pGSK3b
saline
cocaine
WT KO
0
50
100
150
200
250
pmTOR/mTOR
(% of saline-wt)
pmTOR
saline
cocaine
*
WT KO
0
50
100
150
pTH/TH
(%ofs
aline-wt)
pTH
saline
cocaine
Fig. 7 Cocaine treatment differentially affect signalling pathways in WT and spinophilin-KO mice. aRepresentative images of immunoblots for
pERK, ERK, pAkt, Akt, pGSK3β, GSK3β, pmTOR, mTOR, and pTH in the striatum of wild-type and spinophilin-KO mice. Quantification of cocaine-
induced changes in b) pERK, c) pAkt, d) pGSK3β,e) pmTOR, and f) pTH in wild-type and spinophilin-KO mice. Data expressed as mean ± SEM.
Two-way ANOVA followed by Tukey post-hoc,n=6–8 per group. *p< 0.05
Areal et al. Molecular Brain (2019) 12:15 Page 13 of 16
[6,52]. Moreover, an increase in the excitability of VTA
neurons during the development of sensitization to stimu-
lants has been associated with a decrease in the
autoreceptor function of D2R [19,52]. It is known that
spinophilin binds to the third intracellular loop of D2R.
However, the consequences of this interaction have not yet
been elucidated as opposed to other receptors (i.e. α2AR,
mu-opioid and mGluR5). Considering the structural simi-
larity in the third intracellular loop of D2R and α2AR, and
that both receptors are coupled to Gi, it could be hypothe-
sized that spinophilin may regulate D2R in a similar man-
ner and antagonize beta-arrestin 2- dependent MAPK
signalling [62]. If that was the case, D2R signalling would
be exacerbated in spinophilin-KO mice, which could be a
possible mechanism underlying the prevention of
behavioral sensitization observed in these mice. How-
ever, specific studies on spinophilin’sroleonD2R
signalling are needed in order to confirm that hypothesis.
Interestingly, we observed that spinophilin-KO mice
have constitutively higher expression of NR2A. It is
known that stimulation of NR2A activates ERK path-
way, an important component of NMDAR signal trans-
duction involved in synaptic plasticity [27,61]. Notably,
despite increased NR2A, ERK activation following co-
caine administration was not observed in spinophilin
KO mice, suggesting that spinophilin is required for the
regulation of this signalling pathway. Noteworthy, [69]
demonstrated that injections of D-serine, an endogen-
ous co-agonist of NMDARs, in the NAc, blocked the be-
havioral sensitization to cocaine and suggested that the
inhibition of ERK-CREB-Fos pathway was involved in this
process [69]. The increased expression of NR2A in
spinophilin-KO mice observed in this study also raised the
possibility that the increased basal levels of intracellular
Ca
2+
, pAkt and pERK observed in neuronal cultures from
spinophilin-KO mice by [48] may be also mediated by an
NR2A overexpression. However, it should be noted that
results reported on [48] were obtained from cortical
neurons while herein we analyzed striatum samples.
Our laboratory has previously described spinophilin’s
involvement in the regulation of mGluR5, a metabotropic
glutamate receptor highly expressed in limbic and cortical
areas [48]. Previous studies have suggested a role for
mGluR5 in cocaine addiction, as deletion and antagonism
of this receptor have been shown to decrease cocaine
self-administration, cocaine-seeking after extinction, and
conditioned place preference [8,26,28]. McGueehan and
Olive (2003) tested the effect of MPEP, an mGluR5 antag-
onist, on the rewarding properties of different drugs of
abuse. The authors report that only CPP to cocaine was
affected, while amphetamine, morphine, nicotine or etha-
nol CPP remained unaltered [30]. On the other hand,
Fowler et al. (2011) showed that mGluR5 knockout
mice developed normal CPP to cocaine and
cocaine-induced hyperlocomotion on the same level as
wild-types at moderate doses of cocaine (10 and 20 mg/
Kg) [70]. In addition, a study using the mGluR5 antagonist
MTEP observed no effect on cocaine CPP in three dif-
ferent doses tested [59]. Therefore, the literature on
the potential therapeutic effect of mGluR5 antagonism
is still controversial. In the present study, when combined
with cocaine, CTEP potentiated the hyperlocomotion
on spinophilin-KO mice without affecting behavioral
sensitization or conditioned place preference, key para-
digms to study cocaine addiction in animal models, sug-
gesting that the CTEP effect on KO mice at the dose used
may be related mostly to motor aspects, in accordance
with previous reports that blockage of mGluR5 produces
hyperlocomotion [43,17]. This potentiated hyperlocomo-
tion could have affected the observation of a lack of be-
havioral sensitization in the KO mice co-treated with
cocaine and CTEP, considering the possibility that the
maximal locomotor response could have already been
achieved in the initial administrations, not allowing fur-
ther increases that would characterize a sensitized
response.
In the present study, we showed that deletion of spino-
philin does not affect acute locomotor effects of cocaine
or the conditioned place preference to this drug. However,
a loss of spinophilin expression blocks the development of
behavioral sensitization to cocaine. This effect was accom-
panied by blunted cocaine-induced ERK phosphorylation
and c-Fos and ΔFosB expression. Therefore, we suggest
spinophilin to play an important role in cocaine-induced
behavioral sensitization, likely via the activation of ERK1/2
and induction of c-Fos and ΔFosb in the striatum, a
mechanism that may underlie specific processes in-
volved in cocaine addiction. Further studies using an
operant-conditioning paradigm for self-administration
assessing the effect of spinophilin on reinforcing and
motivational effects of cocaine would help elucidating
spinophilin’s role in cocaine addiction.
Abbreviations
AMPA: A-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid;
ANOVA: Analysis of variance; CamKII: Ca2+/calmodulin- dependent protein
kinase II; cDNA: Complementary deoxyribonucleic acid; CPP: Conditioned
place preference; CTEP: 2-chloro-4-((2,5-dimethyl-1-(4-(trifluoromethoxy)phenyl)-
1H-imidazol-4-yl)ethynyl)pyridine; D1R: Dopamine receptor 1; D2R: Dopamine
receptor 2; DMSO: Dimethyl sulfoxide; ERK: Extracellular-signal-regulated kinase;
KO: Knockout; LTD: Long term depression; LTP: Long term potentiation;
mGluR: Metabotropic glutamate receptor; NAc: Nucleus accumbens; NMDA: N-
methyl-D-aspartate; PFC: Prefrontal cortex; PKA: Protein kinase A; PP1: Protein
phosphatase 1; qPCR: Quantitative polymerase chain reaction; RNA: Ribonucleic
acid; SDS-PAGE: Sodium dodecyl sulfate-polyacrylamide gel electrophoresis;
VTA: Ventral tegmental area; WT: Wild type
Acknowledgments
S.S.G.F is a Tier I Canada Research Chair in Brain and Mind.
Areal et al. Molecular Brain (2019) 12:15 Page 14 of 16
Funding
This study was supported by grants from Canadian Institutes for Health
Research (CIHR) grant (MOP 119437) to S.S.G.F and L. B. A. was supported by
a studentship from CAPES, Brazil.
Availability of data and materials
All data generated or analyzed during this study are included in this
published article.
Authors’contributions
L.B.A., A.H., C.M.S., R.G.W.P and S.S.G.F were responsible for the conception
and design of all experiments. L.B.A, and A.H. performed the experiments.
L.B.A analyzed the data. L.B.A., C.M.S., R.G.W.P and S.S.G.F wrote the
manuscript. All authors read and approved the final manuscript.
Ethics approval
All animal experiments were performed following the Canadian Council of
Animal Care guidelines and approved by the University of Ottawa animal
care committee (protocol no. CMM2519). Human ethics approval is not
applicable.
Consent for publication
Not applicable
Competing interests
The authors declare that they have no competing interests.
Publisher’sNote
Springer Nature remains neutral with regard to jurisdictional claims in
published maps and institutional affiliations.
Author details
1
Department of Cellular and Molecular Medicine and University of Ottawa
Brain and Mind Institute, University of Ottawa, 451 Smyth Road, Ottawa, ON
K1H 8M5, Canada.
2
Graduate Program in Neuroscience, Institute of Biological
Sciences, Federal University of Minas Gerais, Belo Horizonte, MG 31270-901,
Brazil.
3
Department of Physiological Sciences, Health Sciences Center, Federal
University of Espirito, Santo, Vitoria, ES 29043-910, Brazil.
Received: 18 November 2018 Accepted: 4 February 2019
References
1. Allen PB, Ouimet CC, Greengard P. Spinophilin, a novel protein phosphatase
1 binding protein localized to dendritic spines. Proc Natl Acad Sci U S A.
1997;94(18):9956–61.
2. Allen PB, Zachariou V, Svenningsson P, Lepore AC, Centonze D, Costa C,
Rossi S, Bender G, Chen G, Feng J, Synder GL, Bernardi G, Nestler EJ, Yan Z,
Calabresi P, Greengard P. Distinct roles for spinophilin and neurabin in
dopamine-mediated plasticity. Neuroscience. 2006;140(3):897–911.
3. Areal LB, Herlinger AL, Pelicao FS, Martins-silva C, Pires RGW. Crack cocaine
inhalation induces schizophrenia-like symptoms and molecular alterations in
mice prefrontal cortex. J Psychiatr Res. 2017;91:57–63.
4. Bailey J, Ma D, Szumlinski KK. Rapamycin attenuates the expression of
cocaine-induced place preference and behavioral sensitization. Addict Biol.
2012;17:248–58.
5. Borgland SL, Malenka RC, Bonci A. Acute and chronic cocaine-induced
potentiation of synaptic strength in the ventral tegmental area:
electrophysiological and behavioral correlates in individual rats. J Neurosci.
2004;24:7482–90.
6. Bowers MS, McFarland K, Lake RW, Peterson YK, Lapish CC, Gregory ML,
Lanier SM, Kalivas PW. Activator of G protein signaling 3: a gatekeeper of
cocaine sensitization and drug seeking. Neuron. 2004;42:269–81.
7. Brog JS, Salyapongse A, Deutch AY, Zahm DS. The patterns of afferent
innervation of the core and shell in the "accumbens" part of the rat ventral
striatum: immunohistochemical detection of retrogradely transported
fluoro-gold. J Comp Neurol. 1993;338(2):255–78.
8. Chiamulera C, Epping-jordan MP, Zocchi A, Marcon C, Cottiny C, Tacconi S,
Cosri M, Orzi F, Conquet F. Reinforcing and locomotor stimulant effects of
cocaine are absent in mGluR5 null mutant mice. Nat Neurosci. 2001;4(9):9–10.
9. Evans JC, Robinson CM, Shi M, Webb DJ. The guanine nucleotide exchange
factor (GEF) Asef2 promotes dendritic spine formation via Rac activation
and spinophilin-dependent targeting. J Biol Chem. 2015;290(16):10295–308.
10. Everitt BJ, Robbins TW. From the ventral to the dorsal striatum: devolving
views of their roles in drug addiction. Neurosci Biobehav Rev. 2013;37:1946–54.
11. Feng J, Yan Z, Ferreira A, Tomizawa K, Liauw JA, Zhuo M, Allen PB, Ouimet
CC, Greengard P. Spinophilin regulates the formation and function of
dendritic spines. Proc Natl Acad Sci U S A. 2000;97(16):9287–92.
12. Ferguson SM, Fasano S, Yang P, Brambilla R, Robinson TE. Knockout of ERK1
enhances cocaine-evoked immediate early gene expression and behavioral
plasticity. Neuropsychopharmacology. 2006;31(12):2660–8.
13. French SJ, Totterdell S. Individual nucleus accumbens-projection neurons
receive both basolateral amygdala and ventral subicular afferents in rats.
Neuroscience. 2003;119:19–31.
14. Futter M, Uematsu K, Bullock SA, Kim Y, Hemmings HC Jr, Nishi A,
Greengard P, Nairn AC. Phosphorylation of spinophilin by ERK and cyclin
dependent PK5 (Cdk5). Proc Natl Acad Sci U S A. 2005;102:3489–94.
15. Graybiel AM, Moratalla R, Robertson HA. Amphetamine and cocaine induce
drug-specific activation of the c-fos gene in striosome-matrix compartments
and limbic subdivisions of the striatum. Proc Natl Acad Sci U S A. 1990;
87(17):6912–6.
16. Grossman SD, Futter M, Snyder GL, Allen PB, Nairn AC, Greengard P, Hsieh-
Wilson LC. Spinophilin is phosphorylated by Ca2+/calmodulin-dependent
protein kinase II resulting in regulation of its binding to F-actin. J Neurochem.
2004;90:317–24.
17. Guimaraes IM, Carvalho TG, Ferguson SSG, Pereira GS, Ribeiro FM. The
metabotropic glutamate receptor 5 role on motor behavior involves specific
neural substrates. Mol Brain. 2015;8(24):1–13.
18. Henry DJ, White FJ. Repeated cocaine administration causes persistent
enhancement of D1 dopamine receptor sensitivity within the rat nucleus
accumbens. J Pharmacol Exp Ther. 1991;258:882–90.
19. Henry DJ, Greene MA, White FJ. Electrophysiological effects of cocaine in
the mesoaccumbens dopamine system: repeated administration. J Pharmacol
Exp Ther. 1989;251:833–9.
20. Holroyd KB, Adrover MF, Fuino RL, Bock R, Kaplan AR, Gremel CM,
Rubinstein M, Alvarez VA. Loss of feedback inhibition via D2 autoreceptors
enhances acquisition of cocaine taking and reactivity to drug-paired cues.
Neuropsychopharmacology. 2015;40(6):1495–509.
21. Hsieh-Wilson LC, Allen PB, Watanabe T, Nairn AC, Greengard P.
Characterization of the neuronal targeting protein spinophilin and its
interactions with protein phosphatase-1. Biochemistry. 1999;38:4365–473.
22. Hu XD, Huang Q, Yang X, Xia H. Differential regulation of AMPA receptor
trafficking by neurabin-targeted synaptic protein phosphatase-1 in synaptic
transmission and long-term depression in hippocampus. J Neurosci. 2007;
27:4674–86.
23. Kalivas PW, Duffy P. D1 receptors modulate glutamate transmission in the
ventral tegmental area. J Neurosci. 1995;15(7):5379–88.
24. Kalivas PW, Duffy P. Effect of acute and daily cocaine treatment on
extracellular dopamine in the nucleus accumbens. Synapse. 1990;5:48–58.
25. Kelz MB, Nestler EJ. deltaFosB: a molecular switch underlying long-term
neural plasticity. Curr Opin Neurol. 2000;13(6):715–20.
26. Kenny PJ, Boutrel B, Gasparini F, Koob GF, Markou A. Metabotropic glutamate 5
receptor blockade may attenuate cocaine self-administration by decreasing
brain reward function in rats. Psychopharmacology. 2005;179(1):247–54.
27. Kim MJ, Dunah AW, Wang YT, Sheng M. Differential roles of NR2A- and
NR2B-containing NMDA receptors in Ras-ERK Signalling and AMPA receptor
trafficking. Neuron. 2005;46:745–60.
28. Kumaresan V, Yuan M, Yee J, Famous KR, Anderson SM, Schmidt HD, Pierce
RC. Metabotropic glutamate receptor 5 (mGluR5) antagonists attenuate
cocaine priming- and cue-induced reinstatement of cocaine seeking. Behav
Brain Res. 2010;202(2):238–44.
29. McClung CA, Nestler EJ. Regulation of gene expression and cocaine reward
by CREB and DeltaFosB. Nat Neurosci. 2003;6(11):1208–15.
30. McGeehan AJ, Olive MF. The mGluR5 antagonist MPEP reduces the
conditioned rewarding effects of cocaine but not other drugs of abuse.
Synapse. 2003;47(3):240–2.
31. McIntosh S, Howell L, Hemby SE. Dopaminergic dysregulation in prefrontal
cortex of rhesus monkeys following cocaine self-administration. Front
Psychiatry. 2013;4(88):1–10.
32. McNamara RK, Logue A, Stanford K, Xu M, Zhang J, Richtand NM. Dose–
response analysis of locomotor activity and stereotypy in dopamine D3
Areal et al. Molecular Brain (2019) 12:15 Page 15 of 16
receptor mutant mice following acute amphetamine. Synapse. 2006;60(5):
399–405.
33. Morris CW, Watkins DS, Salek AB, Edler MC. The association of spinophilin
with disks large-associated protein 3 (SAPAP3) is regulated by metabotropic
glutamate receptor (mGluR) 5. Mol Cell Neurosci. 2018;90:60–9.
34. Nader MA, Czoty PW, Gould RW, Riddick NV. Positron emission tomography
imaging studies of dopamine receptors in primate models of addiction.
Philos Trans R Soc Lond Ser B Biol Sci. 2008;363(1507):3223–32.
35. Nestler EJ. Molecular basis of long-term plasticity underlying addiction.
Nat Rev Neurosci. 2001;2(2):119–28.
36. Nestler EJ. The neurobiology of cocaine addiction. Sci Pract Perspect.
2005;3(1):4–10.
37. Nestler EJ. Transcriptional mechanisms of addiction: role of ΔFosB. Philos
Trans R Soc Lond Ser B Biol Sci. 2008;363(1507):3245–55.
38. Nygard SK, Klambatsen A, Balouch B, Jenab S. Region and context specific
intracellular responses associated with cocaine-induced conditioned place
preference expression. Neuroscience. 2015;287:1–8.
39. Parsons LH, Justice JB Jr. Serotonin and dopamine sensitization in the
nucleus accumbens, ventral tegmental area, and dorsal raphe nucleus
following repeated cocaine administration. J Neurochem. 1993;61:1611–9.
40. Pascoli V, Terrier J, Espallergues J, Valjent E, O'Connor EC, Luscher C.
Contrasting forms of cocaine-evoked plasticity control components of
relapse. Nature. 2014;509:459–64.
41. Pierce RC, Pierce-Bancroft AF, Prasad BM. Neurotrophin-3 contributes to the
initiation of behavioral sensitization to cocaine by activating the Ras/
mitogen-activated protein kinase signal transduction cascade. J Neurosci.
1999;19(19):8685–95.
42. Ragusa MJ, Dancheck B, Critton DA, Nairn AC, Page R, Peti W. Spinophilin
directs protein phosphatase 1 specificity by blocking substrate binding sites.
Nat Struct Mol Biol. 2010;17(4):459–64.
43. Ribeiro FM, Hamilton A, Doria JG, Guimaraes IM, Cregan SP, Ferguson SS.
Metabotropic glutamate receptor 5 as a potential therapeutic target in
Huntington's disease. Expert Opin Ther Targets. 2014;18(11):1293–304.
44. Ritz MC, Cone EJ, Kuhar MJ. Cocaine inhibition of ligand binding at
dopamine, norepinephrine and serotonin transporters: a structure-activity
study. Life Sci. 1990;46:635–45.
45. Sakae DY, Marti F, Lecca S, Vorspan F, Morel LJ, Henrion A. The absence of
VGLUT3 predisposes to cocaine abuse by increasing dopamine and glutamate
signaling in the nucleus accumbens. Mol Psychiatry. 2015;20:1448–59.
46. Sarrouilhe D, Tommaso A, Métayé T, Ladeveze V. Spinophilin: from partners
to functions. Biochimie. 2006;88:1099–113.
47. Satoh A, Nakanishi H, Obaishi H, Wada M, Takahashi K, Satoh K, Hirao K,
Nishioka H, Hata Y, Mizoguchi A, Takai Y. Neurabin-II/spinophilin. An actin
filament-binding protein with one pdz domain localized at cadherin-based
cell-cell adhesion sites. J Biol Chem. 1998;273:3470–5.
48. Di Sebastiano AR, Fahim S, Dunn HA, Walther C, Ribeiro FM, Cregan SP,
Angers S, Schmid S, Ferguson SSG. Role of Spinophilin in group I
metabotropic glutamate receptor endocytosis, signaling, and synaptic
plasticity. J Biol Chem. 2016;291(34):17602–15.
49. Sgambato V, Pages C, Rogard M, Besson M, Caboche J. Extracellular signal-
regulated kinase (ERK) controls immediate early gene induction on
Corticostriatal stimulation. J Neurosci. 1998;18(21):8814–25.
50. Shi X, Miller JS, Harper LJ, Poole RL, Gould TJ, Unterwald EM. Re-activation
of cocaine reward memory engages the Akt/GSK3/mTOR signaling pathway
and can be disrupted by GSK3 inhibition. Psychopharmacology. 2014;231:
3109–18.
51. Smith FD, Oxford GS, Milgram SL. Association of the D2 dopamine receptor
third cytoplasmic loop with spinophilin, a protein phosphatase-1-interacting
protein. J Biol Chem. 1999;274(28):19894–900.
52. Steketee JD, Walsh TJ. Repeated injections of sulpiride into the medial
prefrontal cortex induces sensitization to cocaine in rats.
Psychopharmacology. 2005;179:753–60.
53. Stephens DJ, Banting G. Direct interaction of the trans-Golgi network
membrane protein, TGN38, with the F-actin binding protein, neurabin. J Biol
Chem. 1999;274:30080–6.
54. Swanson LW. The projections of the ventral tegmental area and adjacent
regions: a combined fluorescent retrograde tracer and immunofluorescence
study in the rat. Brain Res Bull. 1982;9:321–53.
55. United Nations Office on Drugs and Crime, World Drug Report 2017 (United
Nations publication, Sales No. E17XI.6).
56. Valjent E, Corvol J, Trzas kos JM, Girault A, Hervé D. Role of the ERK
pathway in psychostim ulant-induced locomotor sensitization. BMC
Neurosci. 2006;7(20):1–11.
57. Vanderschuren L, Di Ciano P, Everitt BJ. Involvement of the dorsal striatum
in cue-controlled cocaine seeking. J Neurosci. 2005;25:8665–70.
58. Vanhoutte P, Barnier J, Guibert B, Page C, Besson M, Hipskind RA, Caboche
J. Glutamate induces phosphorylation of Elk-1 and CREB, along with c -fos
activation, via an extracellular signal-regulated kinase-dependent pathway in
brain slices. Mol Cell Biol. 1999;19(1):136–46.
59. Veeneman MM, Broekhoven MH, Damsteegt R, Vanderschuren LJ. Distinct
contributions of dopamine in the dorsolateral striatum and nucleus
accumbens shell to the reinforcing properties of cocaine.
Neuropsychopharmacology. 2012;37:487–98.
60. Volkow ND, Fowler JS, Wang GJ, Baler R, Telang F. Imaging dopamine's role
in drug abuse and addiction. Neuropharmacology. 2009;56:3–8.
61. Wang JQ, Fibuch EW, Mao L. Regulation of mitogen-activated protein
kinases by glutamate receptors. J Neurochem. 2007;100:1–11.
62. Wang Q, Zhao J, Brady AE, Feng J, Allen PB, Lefkowitz RJ, Greengard P,
Limbird LE. Actions in vitro and in vivo at G protein –coupled receptors.
Science. 2004;304:1940–4.
63. Zhang J, Zhang L, Jiao H, Zhang Q, Zhang D, Lou D, Katz JL, Xu M. C-Fos
facilitates the acquisition and extinction of cocaine-induced persistent
changes. J Neurosci. 2006;26(51):13287–96.
64. Zhang L, Lou D, Jiao H, Zhang D, Wang X, Xia Y, Zhang J, Xu M. Cocaine-
induced intracellular signaling and gene expression are oppositely regulated
by the dopamine D1 and D3 receptors. J Neurosci. 2004;24:3344–54.
65. Barros VN, Mundim M, Galindo LT, Bittencourt S, Porcionatto M, Mello LE.
The pattern of c-Fos expression and its refractory period in the brain of rats
and monkeys. Front Cell Neurosci. 2015;9(72):1-8.
66. Martin-Fardon R, Baptista MA, Dayas CV, Weiss F. Dissociation of the effects
of MTEP [3-[(2-methyl-1,3-thiazol-4-yl)ethynyl]piperidine] on conditioned
reinstatement and reinforcement: comparison between cocaine and a
conventional reinforcer. J Pharmacol Exp Ther. 2009;329(3):1084–1090.
67. Herzig V, Schmidt WJ. Effects of MPEP on locomotion, sensitization
and conditioned reward induced by cocaine or morphine.
Neuropharmacology. 2004;47(7):973–984.
68. Knackstedt LA, Trantham-Davidson HL, Schwendt M. The role of ventral and
dorsal striatum mGluR5 in relapse to cocaine-seeking and extinction
learning. Addict Biol. 2014; 19(1):87-101.
69. Liu ZQ, Gu XH, Yang YJ, Yin XP, Xu LJ, Wang W. D-Serine in the nucleus
accumbens region modulates behavioral sensitization and extinction of
conditioned place preference. Pharmacol Biochem Behav.2016;143:44-56.
70. Fowler MA, Varnell AL, Cooper DC. mGluR5 knockout mice exhibit normal
conditioned place-preference to cocaine. Nature Precedings. 2011.
Areal et al. Molecular Brain (2019) 12:15 Page 16 of 16
