Access to this full-text is provided by Springer Nature.
Content available from BMC Microbiology
This content is subject to copyright. Terms and conditions apply.
R E S E A R C H A R T I C L E Open Access
Isolation, characterization, and assessment
of lactic acid bacteria toward their selection
as poultry probiotics
Rine Christopher Reuben
1,2
, Pravas Chandra Roy
1
, Shovon Lal Sarkar
1
, Rubayet-Ul Alam
1
and Iqbal Kabir Jahid
1*
Abstract
Background: Probiotics are live microorganisms that, when administered in adequate amounts, confer a health
benefit on the host, are now accepted as suitable alternatives to antibiotics in the control of animal infections and
improving animal production. Lactic acid bacteria (LAB) with remarkable functional properties have been evaluated
in different studies as possible probiotic candidates. The purpose of this study was to isolate, characterize and
assess the potentials of LAB from poultry gastrointestinal tract as potential poultry probiotics.
Results: Potential LAB probiotics were isolated from broilers, characterized and evaluated for probiotic properties
including antagonistic activity (against Escherichia coli,E. coli O157: H7, Enterococcus faecalis,Salmonella
Typhimurium, S. Enteritidis and Listeria monocytogenes), survivability in simulated gastric juice, tolerance to phenol
and bile salts, adhesion to ileum epithelial cells, auto and co-aggregation, hydrophobicity, α–glucosidase inhibitory
activity, and antibiotic susceptibility tests. Most promising LAB strains with excellent probiotic potentials were
identified by API 50 CHL and 16S rRNA sequencing as Lactobacillus reuteri I2, Pediococcus acidilactici I5, P. acidilactici
I8, P. acidilactici c3, P. pentosaceus I13, and Enterococcus faecium c14. They inhibited all the pathogens tested with
zones of inhibition ranging from 12.5 ± 0.71 to 20 ± 0 mm, and competitively excluded (P< 0.05) the pathogens
examined while adhering to ileum epithelial cells with viable counts of 3.0 to 6.0 Log CFU/ml. The selected LAB
strains also showed significant (P< 0.005) auto and co-aggregation abilities with α-glucosidase inhibitory activity
ranging from 12.5 to 92.0%. The antibiotic susceptibility test showed 100.00% resistance of the LAB strains to
oxacillin, with multiple antibiotic resistance indices above 0.5.
Conclusion: The selected LAB strains are ideal probiotic candidates which can be applied in the field for the
improvement of poultry performance and control of pathogens in poultry, hence curtailing further transmission to
humans.
Keywords: Probiotics, Lactic acid bacteria, Antagonistic activity, Poultry
Background
Over the last decades, increased attention has been given
by researchers on the health benefits of microbial species
inhabiting animals including humans. The reason is that
intestinal microbiota is believed to be the largest bacter-
ial reservoir in animals [1]. These beneficial microbial
strains collectively referred to as probiotics are known to
be “live microorganisms that, when administered in ad-
equate amounts, confer a health benefit on the host”[2].
Therefore, the application of native strains of lactic
acid bacteria (LAB) as animals’probiotics could provide
most suitable substitute for the control and prevention
of animals’diseases [3]. LAB including species of Entero-
coccus, Lactobacillus, Pediococcus, Streptococcus, Lacto-
coccus, Vagococcus, Leuconostoc, Oenococcus, Weissella,
Carnobacterium and Tetragenococcus are natural micro-
flora of both humans and animals GIT [4,5]. They have
been reported to possess a broad spectrum of beneficial
and health promoting properties which dramatically in-
fluences the host microbial intestinal balance and gen-
eral performance [6,7]. Although the effectiveness of
LAB strains used as probiotics are species and/or strains
© The Author(s). 2019 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0
International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and
reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to
the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver
(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
* Correspondence: ikjahid_mb@just.edu.bd
1
Department of Microbiology, Faculty of Biological Sciences and Technology,
Jashore University of Science and Technology, Jashore 7408, Bangladesh
Full list of author information is available at the end of the article
Reuben et al. BMC Microbiology (2019) 19:253
https://doi.org/10.1186/s12866-019-1626-0
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
dependent, they must nevertheless meet all the necessary
criteria needed for acceptability as probiotics as earlier
described [8].
Feed supplementation with different types of antibi-
otics used as growth promoters and therapeutic agents
for enhancing poultry’s performance is a widespread
practice in Bangladesh and most countries. Conse-
quently, with the resultant public health concerns in-
cluding the emergence and spread of antibiotic-resistant
strains of bacteria, and the presence of low concentra-
tions of antibiotics in broiler meat, antibiotic supple-
mentation has raised serious concerns lately [9].
Furthermore, regulatory pressures over the years have
limited the application of antibiotics in poultry and live-
stock production mostly in developed countries [10].
The continuous growing demand for organic farming
and the reduction of antimicrobial usage in food-
producing animals obviously necessitate the intense
search for novel alternatives, including new probiotic
strains with more effective properties most especially in
curtailing diseases and improving production. Presently,
different commercial probiotic products marketed glo-
bally are available for poultry. Nevertheless, some of
them may not be highly potent due to insufficient exam-
ination of the specific beneficial properties of the pro-
biotic strains formulated in the product [11]. Moreover,
most manufacturers lack the patience to conduct an in-
depth study of each strain to ascertain its full probiotic
potentials before commercializing as most industries are
after profits maximization with minimal expense.
Currently, poultry production is increasing in develop-
ing countries including Bangladesh [12]. With the pres-
sure placed on antibiotics in poultry production and its
consequent public health dangers, there is an increasing
demand for poultry probiotics in Bangladesh. Unfortu-
nately, available commercial probiotics marketed are
readily imported, with huge fortunes expended. As such,
this research will unravel novel LAB strains with best
probiotic properties which will be used in poultry and
subsequently formulated for large-scale industrial pro-
duction and commercialized for poultry farmers in and
outside Bangladesh. Therefore, this study was designed
to isolate, characterize, and assess LAB strains with opti-
mal probiotic properties from broilers GIT for supple-
mentation as poultry probiotics.
Results
The criteria for identifying and selecting the most prom-
ising LAB probiotic strains to be used as poultry probio-
tics are shown in Fig. 1.
Isolation of LAB
In total, 57 LAB strains were isolated from the GIT of
apparently healthy broiler chickens (with 35 and 22 from
the intestine and crop respectively) based on their typical
morphological appearance (small pinpointed and creamy
white colonies), Gram-positive, catalase and coagulase-
negative and non-motile, coccus and rod-shaped charac-
teristics [13].
Antagonistic activity
Agar well diffusion method
Antagonistic activity against 6 indicator strains (patho-
gens) including Escherichia coli ATCC 10536, E. coli
O157: H7 ATCC 43894, Enterococus faecalis ATCC
51299, Salmonella Typhimurium ATCC 14028, S. Enter-
itidis ATCC 13098 and Listeria monocytogenes ATCC
19113 was tested with the 57 LAB isolates. Using the
agar well diffusion assay, 18 LAB isolates (9 each from
both intestine and crop) displayed inhibition activities
against all the pathogens tested at different degrees
(Table 1). Wider zones of inhibition were exhibited by
LAB isolates against E. coli ranging between 17 ± 0 to
20.0 ± 0 mm while the least zones of inhibition ranging
from 12.5 ± 0.71 to 17 ± 0 mm as revealed from this
study were recorded against S. Enteritidis. Furthermore,
LAB isolates from the intestines showed wider inhibition
zones against indicator pathogens examined.
Agar spot test
As in the agar well diffusion assay, only 18 LAB isolates
inhibited all the pathogens, with zones of inhibition ran-
ging from 1 to 4.0 mm (with the exception of LAB strain
c13, which showed no activity to E. coli O157: H7 and E.
faecalis). Although, pathogen inhibition by the LAB
strains is strain and pathogen specific, LAB strains iso-
lated from the intestine showed greater activity against
the tested pathogens than the LAB strains isolated from
the crop. Also, LAB strains examined showed wider in-
hibition zones against E. coli, L. monocytogenes and E.
faecalis than against S. Enteritidis respectively (Table 2).
LAB isolates that failed to show antimicrobial activity
against the pathogens examined were immediately dis-
continued from preceding evaluation.
Safety of LAB probiotic strains
LAB Haemolytic ability
Three (3) out of the 18 LAB isolates examined for
haemolytic activity were β-haemolytic and so were
screened out of the subsequent screening for probiotic
properties, as they are not considered safe. As such, only
15 LAB isolates (7 and 8 from intestine and crop) were
used for subsequent assays (Fig. 1).
Bile salt tolerance
All the 15 LAB isolates (7 and 8 from intestine and crop)
tested show good tolerance to 0.3% bile salt after 6 h of ex-
posure. No statistical difference (P> 0.05) in the LAB
Reuben et al. BMC Microbiology (2019) 19:253 Page 2 of 20
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
strains viability after 3 and 6 h of incubation. Furthermore,
the range of intestine LAB strains viability (Log
10
CFU
ml
−1
) after 6 h incubation was between 8.925 ± 0.055 to
9.245 ± 0.077 while 8.847± 0.048 to 9.131 ± 0.029 was re-
corded for LAB strains from the crop (Table 3).
Simulated gastric juice survivability with and without
lysozyme (pH 2)
LAB isolates survivability in simulated gastric juice with
lysozyme at pH 2.0 was examined. After 90 min exposure
to the simulated environment, only 6 LAB strains iso-
lated from the intestine were able to survive with vi-
able counts > 2.0 CFU/ml. There were significant
differences (P< 0.05) in the viability of LAB strains I1,
I2 and I13 with the control after 90 min of incuba-
tion. Also, only 5 of the LAB strains isolated from
crop were able to survive the simulated environment
after 90 min of incubation, with viable counts > 3.0
CFU/ml. LAB strains c1, c9, c13 and c14 showed
significant differences (P< 0.05) in their viability with
the control after 90 min of incubation while c3
showed no difference (P> 0.05) with the control
(Fig. 2).
Adhesion of LAB strains to chicken ileum epithelial cells
The ability of LAB Strains to adhere to chicken ileum
epithelial cells was assessed. All the LAB strains adhere
to the epithelial cells with a gradual increase in their via-
bility count from time 0 to 90 min of incubation. Mul-
tiple comparison test of the adherence capability shows
a statistically significant difference (P< 0.05) between the
LAB strains viability counts after 30, 60 and 90 min in-
cubation (Fig. 3).
Phenol tolerance
The result of the LAB isolates tolerance to 0.1–0.4%
phenol concentration is shown in Fig. 4. Only 6 (4 and 2
from intestine and crop) LAB isolates were able to
Fig. 1 Strain selection flow chart by phenotypic and genotypic methods. Strains without desired probiotics properties were excluded from
subsequent examination. LAB: lactic acid bacteria
Reuben et al. BMC Microbiology (2019) 19:253 Page 3 of 20
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
tolerate 0.4% phenol with OD values > 1.000. The viabil-
ity of all the LAB isolates examined differ significantly
(P< 0.05) with respect to phenol concentration.
Temperature and NaCl tolerance
All the LAB isolates grew optimally at 37 °C after 24 h
incubation (Fig. 1). Nevertheless, at 4 °C and 55 °C
growths were drastically reduced for all the isolates ex-
amined. Furthermore, all the LAB isolates tolerated in-
creasing NaCl concentration to 6.5% with OD > 0.500
except isolate c14 with OD of 0.310. Also, at 10.0%
NaCl, there was very weak growth of all the isolates ran-
ging from 0.115 to 0.177.
Competitive adherence of LAB strains and pathogens to
ileum cells
The ability of LAB Strains to competitively adhere to
chicken ileum epithelial cells while excluding patho-
gens was assessed. LAB strains from intestine were
able to adhere to ileum cells while successfully ex-
cluding all the pathogens tested. After 90 min incuba-
tion, there were significant differences (P< 0.05)
between the viable count of all the LAB strains and
the pathogens examined. Whereas the viable count of
the entire LAB strains examined ranges between
3.65 ± 0.11 to 4.63 ± 0.14 Log CFU/ml (except LAB
strain c3 which had 3.14 ± 0.14) after 90 min of
incubation, the viable count of all the pathogens was
between 2.30 ± 0.10 to 3.27 ± 0.06. The adhesion of all
LAB strains to the ileum epithelial cells differed sig-
nificantly (P< 0.05) from that of all the pathogens
after 90 min of incubation. Nevertheless, there was no
statistically significant difference (P< 0.05) between
the adhesion of LAB c3 with all the pathogens exam-
ined after 90 min of incubation (Fig. 5).
Cell surface characteristics
Auto-aggregation and co-aggregation ability
Table 4shows the results of both auto-aggregation
and co-aggregation abilities of all the LAB strains
examined. The auto-aggregation of these isolates
ranged from 32 ± 5.66 to 56.5 ± 3.54%. The auto-
aggregation of LAB strains I5 and I13 differ signifi-
cantly (P< 0.05) from other strains respectively. Al-
though the co-aggregation abilities of these LAB
strains as revealed from this study is strain specific,
and also dependent on the pathogen tested, all the
LAB examined show co-aggregation abilities to all the
tested pathogens. Generally, the co-aggregation was
between 24.03 ± 0.04 (E. faecalis) to 83.6 ± 0.83% (L.
monocytogenes). The co-aggregation abilities of all the
LAB strains to E. coli O157: H7 differs significantly
(P< 0.05). Also, high co-aggregation abilities were
Table 1 Antagonistic activity of potential lactic acid bacteria (LAB) probiotic strains from broiler GIT against pathogenic bacteria by
agar well diffusion technique
Zone of inhibition (mm)
Strain Escherichia coli Escherichia coli O157: H7 Enterococcus faecalis Salmonella Typhimurium Salmonella Enteritidis Listeria monocytogenes
I1 19.5 ± 0.71 17 ± 0 16 ± 1.41 16 ± 0 15.5 ± 0.71 17 ± 1.41
I2 19 ± 1.41 17.5 ± 0.71 16.5 ± 0.71 15.5 ± 0.71 14.5 ± 0.71 16 ± 1.41
I4 19 ± 0 14.5 ± 0.71 16.5 ± 0.71 14.5 ± 0.71 15 ± 0 17 ± 0
I5 20 ± 0 16 ± 0 17 ± 1.41 17 ± 1.41 16 ± 0 19 ± 1.41
I6 18 ± 0 17 ± 0 16 ± 1.41 16.5 ± 2.12 17 ± 0 17.5 ± 4.95
I8 18.5 ± 0.71 15.5 ± 2.12 16 ± 1.41 17 ± 1.41 16 ± 0 20 ± 4.24
I9 17 ± 0 14.5 ± 0.71 17 ± 0 15.5 ± 0.71 14.5 ± 0.71 15.5 ± 3.54
I12 18.5 ± 0.71 15 ± 2.83 18.5 ± 0.71 16.5 ± 0.71 15.5 ± 0.71 17 ± 4.24
I13 19 ± 0 15.5 ± 0.71 17 ± 0 17 ± 0 15 ± 0 17.5 ± 0.71
c1 18.5 ± 2.12 14.5 ± 0.71 15.5 ± 0.71 15 ± 0 15.5 ± 0.71 14 ± 0
c2 18.5 ± 0.71 15 ± 1.41 15.5 ± 0.71 16 ± 1.41 15.5 ± 0.71 14.5 ± 0.71
c3 19.5 ± 0.71 14.5 ± 0.71 15 ± 0 14.5 ± 0.71 15.5 ± 0.71 14 ± 0
c5 18.5 ± 2.12 17 ± 1.41 17 ± 1.41 15 ± 0 14.5 ± 2.12 15.5 ± 2.12
c9 20 ± 0 14 ± 1.41 16 ± 1.41 17 ± 0 14.5 ± 0.71 15 ± 1.41
c12 17.5 ± 0.71 14 ± 1.4 16.5 ± 0.71 15.5 ± 0.71 15 ± 0 14 ± 0
c13 17 ± 1.41 11.5 ± 2.12 15.5 ± 2.12 16.5 ± 0.71 12.5 ± 0.71 14 ± 1.41
c14 17.5 ± 0.71 14 ± 1.41 17 ± 1.41 14.5 ± 0.71 14 ± 1.41 15 ± 0
c19 20 ± 0 13.5 ± 0.71 18 ± 1.41 13.5 ± 0.71 14.5 ± 0.71 15 ± 1.41
Data are mean values ± SD of independent experiments (n=3)
Reuben et al. BMC Microbiology (2019) 19:253 Page 4 of 20
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
recorded for LAB strains I2 and c3 while I5 had the
least values.
Cell surface hydrophobicity
The results of the cell surface hydrophobicity of the LAB
strains examined is shown in Fig. 6. Although the mean
of the values of hydrophobicity obtained for the LAB
strains do not differ significantly (P> 0.05), isolates from
crop tend to have higher values (70.0 ± 2.84 to71.0 ±
8.48) than those from the intestine (with values ranging
from 40.5 ± 12.02 to 61.5 ± 3.54).
α–Glucosidase inhibitory activity of LAB strains The
α-glucosidase inhibitory activity results of potential LAB
probiotic strains is shown in Fig. 7, with values ranging
from 8.44 to 94.41%. All LAB probiotic strains from
both crop and intestine showed significant difference
(P< 0.05) when compared with the positive control.
Characterization of LAB antimicrobial substances
Potential LAB probiotic strains were characterized for
the production of inhibitory substances such as bacteri-
ocin, hydrogen peroxide and organic acid. Untreated
and heat treated (100 °C) CFS show wide zones of patho-
gens growth inhibition. The antimicrobial substances
produced by LAB strains examined were heat stable.
Nevertheless, there was reduced (for LAB strains I8 and
Table 3 Potential lactic acid bacteria (LAB) probiotic strains
viability (Log
10
CFU ml
−1
) after 0, 3 and 6 h incubation in 0.3%
bile salt
0.3% Bile Salt
Strains 0 h 3 h 6 h
I1 8.938 ± 0.088 8.914 ± 0.064 8.878 ± 0.012
I2 9.107 ± 0.122 9.094 ± 0.115 9.245 ± 0.077
I4 8.967 ± 0.083 9.160 ± 0.190 9.025 ± 0.017
I5 9.027 ± 0.199 9.031 ± 0.197 9.110 ± 0.014
I8 8.972 ± 0.075 8.911 ± 0.019 8.925 ± 0.055
I9 8.944 ± 0.066 8.934 ± 0.075 8.947 ± 0.069
I13 8.979 ± 0.035 8.986 ± 0.038 8.981 ± 0.045
c1 8.911 ± 0.019 9.037 ± 0.189 8.966 ± 0.066
c2 8.951 ± 0.074 8.916 ± 0.011 8.908 ± 0
c3 8.936 ± 0.078 8.895 ± 0.020 8.895 ± 0.012
c5 9.011 ± 0.015 9.033 ± 0.023 9.131 ± 0.029
c9 8.931 ± 0.032 8.914 ± 0.022 8.949 ± 0.007
c13 9.027 ± 0.199 8.869 ± 0.033 8.902 ± 0.038
c14 9.028 ± 0.154 9.082 ± 0.086 9.100 ± 0.066
c19 8.926 ± 0.141 8.905 ± 0.170 8.847 ± 0.048
Values are means of duplicate experiments; ± indicates standard deviation
from the mean. Values are not significant different (P> 0.05)
Table 2 Antagonistic activity of potential lactic acid bacteria (LAB) probiotic strains from poultry against pathogenic bacteria by agar
spot test
Inhibition ± SD
a
Strain Escherichia coli Escherichia coli O157:H7 Enterococcus faecalis Salmonella Typhimurium Salmonella Enteritidis Listeria monocytogenes
I1 3 ± 0 3 ± 0 2.3 ± 0.6 2 ± 0 2 ± 0 2 ± 0
I2 3.3 ± 0.6 2 ± 0 2.5 ± 0.4 1.8 ± 0.2 1 ± 0 2 ± 0
I4 2 ± 0 1 ± 0 1.7 ± 0.7 1 ± 0 1 ± 0 2 ± 0
I5 4 ± 0 2 ± 0 3 ± 0.1 3 ± 0 2.1 ± 0.5 3 ± 1
I6 2 ± 0 2 ± 0 2.3 ± 0.7 2 ± 0 2 ± 0 2 ± 0
I8 3 ± 0.1 2 ± 0 2 ± 0.3 2 ± 1 2 ± 0 3 ± 0
I9 2 ± 0 1 ± 0.5 2 ± 0 1.5 ± 0.4 1 ± 0 1 ± 0
I12 1 ± 0 1 ± 1 1.7 ± 0.4 1.5 ± 0.1 1 ± 0 2 ± 0
I13 3.2 ± 0.5 2 ± 0 2 ± 1 2.7 ± 0.6 1.7 ± 0.2 2.3 ± 0.5
c1 2 ± 0.1 1 ± 0.7 1.7 ± 0.3 1.5 ± 0 1 ± 0.5 1 ± 0
c2 2 ± 0.5 1 ± 0 1 ± 0 1.3 ± 0.4 1 ± 0.2 1 ± 0
c3 3 ± 0.1 2 ± 0 2.1 ± 0.5 1 ± 0 2 ± 0 2 ± 0.3
c5 2.4 ± 1 2 ± 0.3 2 ± 0.8 1.3 ± 0.3 1 ± 0.1 2 ± 0.7
c9 3 ± 0 2 ± 1 2 ± 0 2 ± 0 1.7 ± 0.6 2 ± 0
c12 2 ± 0.2 1 ± 1 1.4 ± 0.3 1.5 ± 0.9 2 ± 0 2 ± 0.4
c13 2 ± 0.1 0 ± 0 1 ± 0 1 ± 0.8 1 ± 0.3 1 ± 0.2
c14 3 ± 0 1.7 ± 1 2 ± 0 1.3 ± 0.3 1 ± 0 1.4 ± 0.3
c19 4 ± 0 2 ± 0 2.7 ± 1 1 ± 0 1.6 ± 0.3 1 ± 1
a
Values are expressed as the mean ± SD of triplicate ind ependent experiments
Reuben et al. BMC Microbiology (2019) 19:253 Page 5 of 20
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
I13) and complete loss (for LAB strains I2, I5, c3 and c14)
of antimicrobial activity by neutralized (pH 7) CFS of LAB
cultures (Table 8). This indicated that acid production con-
tributed hugely to the inhibitory effect of these LAB isolates
and the effects of bacteriocins as seen in some strains. Fur-
thermore, supernatants that were heat treated did not also
affect pathogens inhibition. This implies that heat-labile
component produced by LAB strains were not responsible
for the inhibition of pathogens. Catalase treated superna-
tants of LAB strains showed no effect on the inhibitory ac-
tivities of the six LAB strains examined. This depicts that
microbial inhibitory activity by these LAB strains was not
as a result of the production of hydrogen peroxides.
Antibiotic susceptibility
The antibiotic susceptibility profile of the LAB isolates to
12 commonly used antibiotics was examined (Table 5).
Exactly, 100.00% resistance was shown by all the 6 LAB
isolates to oxacillin and 83.33% resistance by 5 isolates to
erythromycin, vancomycin, ciprofloxacin, streptomycin
and tetracycline. All the 6 isolates (100.00%) were suscep-
tible to penicillin, as 5 (83.33%) were susceptible to chlor-
amphenicol while 4 (66.67%) to ceftriaxone and ampicillin
respectively (Table 6). Four different resistant phenotypes
were expressed by these strains of LAB examined. Strains I2
and I5, and c3 and c14 showed the same resistant phenotype
consisting of Erythromycin-Oxacillin-Vancomycin-Cip-
rofloxacin-Streptomycin-Tetracyclin, and Ceftriaxone-
Erythromycin-Oxacillin-Vancomycin-Ciprofloxacin-Strepto-
mycin-Tetracyclin-Gentamycin while strain I8 and I13 also
expressed different resistant phenotypes comprising only
Oxacillin, and Erythromycin-Oxacillin-Vancomycin-Cipro-
floxacin-Streptomycin-Tetracyclin-Gentamycin respectively.
Generally, isolates from the crop were resistant to more anti-
biotics than those from the intestine. The multiple antibiotic
resistance (MAR) indexes of LAB strains examined all were
above 0.2 except for strain I8 with 0.08. The MAR of isolates
obtained from the crop was 0.67 while those of isolates ob-
tained from the intestine ranged between 0.5 to 0.58 respect-
ively (Table 7).
Fig. 2 Survival of lactic acid bacteria (LAB) strains from poultry crop in stimulated gastric juice pH 2.0. The data are the means of triplicate
experiments, and error bars indicate SD. *values are significantly different (P< 0.05). A-H are LAB strains examined
Reuben et al. BMC Microbiology (2019) 19:253 Page 6 of 20
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
Biochemical identification of LAB strains using API 50 CHL
The carbohydrates fermentation profile of all the LAB
strains were determined by API 50 CHL micro-
identification system8. The isolates showed varying re-
sults of their reaction with the 50 substrates tested. For
the identification of each LAB isolate examined, the re-
sults of their reactions were inputted into the apiweb™
Software version 5.0 (BioMèrieux, France, and the iden-
tity of each strain was obtained (Table 9).
Molecular identification of LAB strains
Potential LAB probiotics strains were identified using
the 16S rRNA sequencing. All the 6 LAB strains exam-
ined were positive with 1500 bp size after agarose gel
Fig. 4 Tolerance to 0.10, 0.20, 0.30 and 0.40% phenol by lactic acid bacteria (LAB) strains from poultry. The data are the means of triplicate
experiments, and error bars indicate standard deviations. *values are significantly different (P< 0.05)
Fig. 3 Adherence of poultry lactic acid bacteria (LAB) strains to poultry ileum epithelial cell. The data are the means of triplicate experiments, and
error bars indicate standard deviations. *values are significantly different (P< 0.05)
Reuben et al. BMC Microbiology (2019) 19:253 Page 7 of 20
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
electrophoresis of amplified PCR products (Fig. 8). The
16S rRNA sequences obtained were blasted and finally
deposited in GenBank (https://www.ncbi.nlm.nih.gov/
genbank/) under accession numbers (Table 8). Further-
more, Fig. 9shows the Phylogenic tree based on 16S
rRNA gene sequences of potential LAB strains in rela-
tion to the isolates and type strains. The sequences of
LAB strains analyzed aligned with the 16S DNA se-
quences as obtained from the database of the Gen-Bank.
The 6 LAB isolates were identified as: Lactobacillus reu-
teri I2, P. acidilactici I5, P. acidilactici I8, P. pentosaceus
I13, P. acidilactici c3 and Enterococcus faecium c14.
Discussion
The application of probiotics in the poultry industry as
suitable alternative to antibiotics as well as for improving
the performance and productivity of birds have received
tremendous attention in recent years. Apart from
other beneficial properties of probiotics, sourcing pro-
biotic strains from their natural host is most pre-
ferred, as such microbial strains are already familiar
with the GIT, and can spontaneously proliferate and
express the desired beneficial effects better than
strains isolated from other sources. Therefore, the
need to develop host-specific probiotic for optimal health
benefits and livestock performance is imperative [14]. Fur-
thermore, direct evaluation of potential probiotics in vivo
is often expensive and time-consuming. Consequently,
in vitro evaluation as major criteria for probiotic selection
is to find the most efficient and suitable strain with opti-
mal beneficial properties. Also, grading the extent of
health and beneficial effect(s) expressed by specific poten-
tial probiotic strain in vivo can be very difficult and expen-
sive [15].
Fig. 5 Competitive adherence lactic acid bacteria (LAB) strains and pathogens to poultry ileum epithelial cell. The data are the means of triplicate
experiments, and error bars indicate standard deviations. *values are significantly different (P< 0.05). A-F are different LAB strains examined
Reuben et al. BMC Microbiology (2019) 19:253 Page 8 of 20
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
LAB strains were selectively isolated from broilers
using MRS medium with pH ranging between 6.4 ± 0.2 ̶
6.5 ± 0.2, and then evaluated towards their development
as poultry probiotics. The optimal pH for the growth of
LAB was reported to range between 6.2 ̶8.5 [16]. After
isolating 57 strains of LAB from the crop (35) and intes-
tine (22) of broilers as previously described [13], they
were subjected to various contemporary in vitro pro-
biotic properties evaluation and finally characterized
molecularly.
Infections by zoonotic and foodborne enteric patho-
gens cause high morbidity and mortality with significant
economic loss in the poultry industry [17]. Also, these
pathogens are often transmitted to humans either via oc-
cupational exposure or through the food chain, which is
of immense public health concern. Antimicrobial activity
against these pathogens is a major requirement of poten-
tial probiotics. Out of the 57 LAB strains examined, 18
(9 each from crop and intestine) showed broad-
spectrum antagonistic activity against the six pathogens
tested (Table 1). There was no discrepancy in the antag-
onistic activity shown against Gram negative and Gram
positive pathogens by our LAB strains, nevertheless, least
inhibitory zones were recorded against S. Enteritidis. In
agreement with our finding, Shin et al. [18], Taheri et al.
[19], Yaneisy et al. [20], Busayo et al. [21], and Olufemi
et al. [22] reported antagonistic activity against wide
spectrum of pathogens by LAB isolated from poultry.
Conversely, Kizerwetter-Swida and Binek [23] reported
higher antagonistic activity by strains of LAB against
Gram positive pathogens (including Clostridium perfrin-
gens and Staphylococcus aureus) than Gram-negative
pathogens (including E. coli and Salmonella). Neverthe-
less, no relationship between the degree of LAB antag-
onistic activity and Gram type of pathogens tested was
recorded from the finding of de Almeida Júnior et al.
[24]. Previously, Spanggaard et al. [25] stated that
pathogen antagonism by probiotics was the major influ-
ential factor hindering heterochthonous bacteria to es-
tablish in the GIT, and this indicates that a significant
Fig. 6 Adhesion of poultry lactic acid bacteria (LAB) strains to n- hexadecane. Results are expressed as mean± SD of triplicate experiments. Values
without * are not significantly different (P> 0.05)
Table 4 Aggregation abilities of potential lactic acid bacteria (LAB) probiotic strains from poultry
Co-aggregation (%)
Strain Auto-aggregation (%) Escherichia coli Escherichia coli O157: H7 Enterococcus faecalis Salmonella
Typhimurium
Salmonella
Enteritidis
Listeria
monocytogenes
I2 52.50 ± 0.71 75.81 ± 0.98* 83.07 ± 0.08* 68.49 ± 0.6* 66.30 ± 0.39* 66.66 ± 1.0* 71.83 ± 1.82*
I5 32 ± 5.66* 42.46 ± 0.64* 49.04 ± 1.02* 44.01 ± 1.39 49.7 ± 0.59 38.78 ± 0.33 50.81 ± 0.37
I8 47 ± 0 62.38 ± 2.05* 65.45 ± 2.04* 53.82 ± 2.7* 53.76 ± 0.37* 42.75 ± 2.33 60.49 ± 0.04*
I13 56.5 ± 3.54* 53.92 ± 0.02 64.22 ± 0.02* 47.48 ± 0.5* 53.25 ± 1.13* 50.42 ± 1.9* 56.98 ± 2.79
c3 51 ± 0 71.03 ± 1.59* 33.4 ± 0.57* 64.26 ± 0.2* 78.51 ± 0.59* 68.02 ± 0.0* 83.6 ± 0.83*
c14 40.5 ± 3.54 60.01 ± 1.31* 46.68 ± 0.74* 24.03 ± 0.0* 45.46 ± 0.83* 36.16 ± 1.6* 48.03 ± 4.82
Data are mean ± SD of results from triplicate experiments. *values are significantly different (P< 0.05)
Reuben et al. BMC Microbiology (2019) 19:253 Page 9 of 20
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
contribution to the control pathogens is expected when
autochthonous microflora are used as probiotics. Simi-
larly, Jose et al. [26] found that LAB strains from animal
rumen inhibited the growth of pathogens better that
LAB strains from dairy sources. The specificity of the
agar spot test revealed less inhibition zones against path-
ogens that earlier had wider zones of inhibition as re-
corded from the agar well diffusion technique. This
agrees with the findings of Armas et al. [27] who re-
cently reported similar activities of LAB strain against
array of pathogens using the agar spot assay.
According to FAO [8] guidelines, microbial strains to
be used as probiotics are recommended to be safe in the
host. The selection and application of strains devoid of
haemolytic activity as probiotics, depicts their non-
virulent nature. Out of the LAB strain examined for
haemolytic activity, 16 were non-haemolytic, and so they
were selected for subsequent evaluation since they are
safe to use as probiotics. Similar results indicating that
majority of LAB strains are non-haemolytic have been
previously reported [22].
Table 6 Percentage of Antibiotic susceptibility of potential
lactic acid bacteria (LAB) probiotic strains from poultry
Susceptibility (n=6)
RIS
Antibiotic No. (%) No. (%) No. (%)
Ceftriaxone 2 (33.33) 0 (0.00) 4 (66.67)
Ampicillin 0 (0.00) 2 (33.33) 4 (66.67)
Penicillin 0 (0.00) 0 (0.00) 6 (100.00)
Erythromycin 5 (83.33) 0 (0.00) 1 (16.67)
Oxacillin 6 (100.00) 0 (0.00) 0 (0.00)
Novobiocin 0 (0.00) 2 (33.33) 4 (66.67)
Vancomycin 5 (83.33) 0 (0.00) 1 (16.67)
Chloramphenicol 0 (0.00) 1 (16.67) 5 (83.33)
Ciprofloxacin 5 (83.33) 0 (0.00) 1 (16.67)
Streptomycin 5 (83.33) 1 (16.67) 0 (0.00)
Tetracycline 5 (83.33) 0 (0.00) 1 (16.67)
Gentamicin 3 (50.00) 2 (33.33) 1 (16.67)
RResistant; IIntermediate; SSensitive
Table 5 Antibiotic susceptibility profile of potential lactic acid
bacteria (LAB) probiotic strains from poultry
Antibiotic Susceptibility
a
Strain CTR AMP P E OX NV VA C CIP S TE GEN
I2 S S S R R I R S R R R I
I5 S S S R R S R S R R R I
I8 S S S S R S S S S I S S
I13 S S S R R S R I R R R R
c3 R I S R R I R S R R R R
c14 R I S R R S R S R R R R
CTR ceftriaxone, AMP ampicillin, Ppenicillin G, Eerythromycin, OX oxacillin, NV
novobiocin, VA vancomycin, Cchloramphenicol, CIP ciprofloxacin, S
streptomycin, TE tetracycline and GEN gentamicin
a
RResistance, SSensitive and IIntermediate
Fig. 7 α-glucosidase inhibitory activity of lactic acid bacteria (LAB) strains from poultry. Data are expressed as mean expressed as mean ± SD from
3 independent experiments. *significant differences at P< 0.05
Reuben et al. BMC Microbiology (2019) 19:253 Page 10 of 20
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
The ability of potential probiotic strains to tolerate or
withstand intestinal bile salt is of immense importance
to their survival and growth in the GIT, as such, it is a
major requirement for probiotic selection [15]. In the
chicken GIT, the duodenum and cecum have a total bile
salt concentration of 0.175 and 0.008% [28]. However,
the average level of 0.3% bile salt has been considered in
many studies for bile salt tolerance of potential probiotic
LAB [20,29]. In our studies, all the LAB strains exam-
ined were able to tolerate 0.3% bile salt after 6 h incuba-
tion (Table 3). This was expected since the LAB strains
originated from chicken. Similarly, all the LAB strains
isolated from chicken as reported by Shin et al. [18], and
Shokryazdan et al. [29] showed good tolerance to 0.3%
bile salts.
Apart from the ability of potential probiotics to toler-
ate bile salts, it is also expected that probiotics should be
able to tolerate the acidic environment of the GIT as
they pass through to colonize the gut of their host [30].
The secretion of gastric juice with an approximate pH of
2.0 causes the death of most exogenous microbes when
ingested into the GIT [31]. Out of the 15 LAB strains
evaluated, four (1 from crop and 3 from the intestine)
failed to survive in simulated gastric juice with lysozyme
(pH of 2.0), with no viable cells after 90 min of incuba-
tion (Fig. 2). LAB are known for their ability to tolerate
acidic pH [31]. Our finding corresponds with previous
studies who reported moderate to good survival of LAB
strains isolated from chicken to simulated gastric juice
with pH of 2.0 [1,18,20,32]. Similarly, LAB strains in-
cluding L. pentosus and L. plantarum isolated from fer-
mented sausages were able to survive acidic
environment [33]. Generally, based on the time of feed-
ing, the age and kind of animal, gastric juice pH concen-
tration may vary from 2.0 to 3.5 [34]. Results obtained
from our study revealed that the survival of our potential
LAB probiotic strains in simulated gastric juice (pH of
2.0) is strain-specific. Furthermore, strains that were able
to survive this environment can also be able to transit
the harsh condition of chicken gut and attach to intes-
tinal cells while exerting beneficial effects.
Adherence to host’s intestinal cells is a major feature
required by probiotics strains for colonization [35].
Beneficial effects exerted by probiotics including anti-
microbial activities against pathogens, immune-
modulation, cholesterol lowering etc. are only possible
with strong adherence to the epithelial cells of the intes-
tine [29,36]. All the LAB strains evaluated from this
study adhered to chicken ileum epithelial cells with a
gradual increase in their viability count time 0 to 90 min
of incubation (Fig. 3). Nevertheless, strain c13 showed
the least adherence ability with viable cell count < 2.5
CFU/cm
2
, and so it was screened out from preceding
evaluation. Jose et al. [26] in their work reported better
Fig. 8 Agarose gel electrophoresis of PCR products after amplification of 16S rRNA; lane M, 1 kb Marker (PROMEGA, USA), lane PC, Positive control
(Lactobacillus casei ATCC 393), Lanes 1, 2, 3, 4, 5 and 6 are positive lactic acid bacteria (LAB) strains I2, I5, I8, I13, c3 and c14 at 1500 bp
Table 7 Multiple Antibiotic Resistance indices of potential lactic
acid bacteria (LAB) probiotic strains from poultry
Strain No. of Antibiotic Resistant MAR Indices
I2 6 0.5
I5 6 0.5
I8 1 0.08
I13 7 0.58
c3 8 0.67
c14 8 0.67
MAR Multiple antibiotic resistance
Reuben et al. BMC Microbiology (2019) 19:253 Page 11 of 20
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
adherence ability exhibited by LAB isolates from animal
rumen that dairy isolates. Also, our finding agrees with
Nitisinprasert et al. [37] and Setyawardani et al. [38],
who reported the adhesion abilities of LAB to intestinal
cells. During peristaltic flow and gut contraction, the ad-
hesion of LAB strains to chicken intestinal cells further
protects them from frequent removal [39].
Phenol is a microbial toxic metabolite secreted in the
GIT as a result of the deamination of some amino acids
[40]. It is expected that potential probiotics should be
able to tolerate the effect of phenol. With increasing
phenol concentration, LAB strains I1, I9, c1 and c9
poorly tolerated 0.4% phenol concentration with OD <
0.3 (Fig. 4), and so they were discontinued. At 0.4% con-
centration of phenol, Shehata et al. [41] previously ob-
served tolerance of LAB strains at varying degrees.
Findings from our study further revealed that all LAB
strain examined grew optimally at 37 °C after 24 h incu-
bation. At 4 °C and 55 °C the growth of LAB examined
was reduced. This finding is in agreement with previous
report [42]. Also, our LAB strains showed excellently
tolerance to 6.5% NaCl concentration but at 10.0% NaCl
weak growth of the strains was recorded. LAB from milk
and milk products, meats, chicken faeces etc. are able to
survive 1.0–9.0% NaCl [41,43]. These results are desir-
able features from potential LAB probiotics which could
increase bacterial growth and production of beneficial
metabolites. Also, these traits exhibited by these LAB
strains are of industrial and technological relevance as
well as for preservation.
Apart from good adherence to intestinal cells, probio-
tics should most importantly have the ability to competi-
tively exclude or inhibit pathogens adhering to hosts’
intestinal cells. Although all the LAB strains examined
were able to significantly exclude all the pathogens
tested, there were variations in the degree of the patho-
gen exclusion by LAB isolates (Fig. 5). In agreement with
our finding, Kos et al. [44] and Dowarah et al. [14] re-
ported a lot of variation among LAB ability to compete
with pathogens when co-cultured. Although some pro-
biotics are administered orally, they should be able to
competitively exclude harmful organisms once they suc-
cessfully colonize the host intestinal cells. LAB adhesion
is a complex process initiated from the foremost bacter-
ial contact with the cell membrane of the host entero-
cytes followed by diverse surface interactions [44]. Most
LAB produce cell surface proteins which among other
functions aid the bacteria to bind with the epithelium of
the GIT. This further enables immunoregulation by LAB
which is also relevant in the removal of pathogens [36].
Furthermore, we examined LAB cell-binding abilities
that is, autoaggreation and coaggregation abilities. These
are 2 of the several factors involved in probiotics adhe-
sion in chicken intestinal cells [45]. Whereas
autoaggregation is an important requirement for the for-
mation of biofilm which further aid adhesion and
colonization of host intestinal cells by probiotics, coag-
gregation on the other hand enables probiotics to form
barrier that is effective in the prevention of enteric path-
ogens adhesion on intestinal cells [17]. The results of
autoaggregation abilities by LAB strains as recorded
from our study was between 32 ± 5.66 to 56.5 ± 3.54%
(Table 4). After determining the autoagrregation of 332
LAB strains from chickens, Taheri et al. [19] reported
that only 62 strains from cecum (18), ileum (22), and
crop (22) showed good autoaggregation abilities. Our
findings are in consonance with Puniya et al. [46] who
recorded LAB autoaggregation ranging between 30.0–
76.0% and 48–73.0% respectively. The coaggregation
abilities between the potential LAB probiotics and the 6
pathogens tested showed strain-and-pathogen specific
coaggregation abilities, ranging between 24.03 ± 0.04 (for
E. faecalis) to 83.6 ± 0.83% (for L. monocytogenes). Find-
ings from the work of Venkatasatyanarayana et al. [17]
reported 62.2 ± 1.03% and 35.5 ± 1.32% coaggregation
between L. plantarum to E. coli and L. monocytogenes.
Another major requirement to be considered when
selecting potential probiotic candidates is the strain sur-
face hydrophobicity. The hydrophobicity of probiotics
directly measures their adhesion abilities to cellular lines
of the enterocytes [47], which is a much-desired prop-
erty in probiotics. All the LAB strains examined show
good hydrophobicity abilities with values ranging from
40.0–70.0%, with strain from the crop showing higher
hydrophobicity ability (Fig. 6). On the basis of superior-
ity, hydrophobicity of 40.0% and above against hexade-
cane was the standard used by Pringsulaka et al. [48]in
the selection of LAB probiotics. Dowarah et al. [14], re-
corded 15–60.0% hydrophobicity of LAB strains from
pigs while Karimi et al. [49] and Yaneisy et al. [20], re-
corded hydrophobicity of between 3.6 ± 0.19–93.53 ±
3.10 and 30–71.10%, from LAB strains isolated from
poultry. Also, Ehrmann et al. [15] obtained high hydro-
phobicity among LAB strains isolated from poultry. Pre-
vious reports have shown that a correlation exists
between high hydrophobicity of LAB strains with their
attachment to intestinal mucosal and epithelial cells [2,
15,19]. Due to the strong relationship between aggrega-
tion and hydrophobicity abilities of probiotics with their
adhesion to GIT epithelial cells, potential LAB probiotics
could be evaluated for these 2 characteristics instead of
mucus adhesion ability [19].
α-glucosidase inhibitory ability of potential probiotic
strains is a valuable functional property which we evalu-
ated in this study. Although α-glucosidase inhibitory activ-
ity is strain specific, LAB strain I13 from the intestine
showed the highest percentage (92.0) of activity while ac-
tivity by other strains ranged between 8.3 to 45.0% (Fig. 7).
Reuben et al. BMC Microbiology (2019) 19:253 Page 12 of 20
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
This activity could result from LAB ability to produce exo-
polysaccharides (EPS) [50]. These LAB strains could re-
duce the absorption of intestinal carbohydrates.
Antagonistic activity by LAB are sustained by the
secretion of different antimicrobial substances includ-
ing organic acids (lactic, acetic etc), bacteriocins, alco-
hols, hydrogen peroxide, antimicrobial peptide etc.
[17]. The substances responsible for the antagonistic
activity by most promising LAB probiotic strains se-
lected as revealed in our study were organic acid and
low molecular weight substances. When the pH of
the CFS was neutralized, all the LAB lost their antag-
onistic activity against the pathogens examined except
LAB strains I8 and I13 which showed weak and mod-
erate antagonistic activity against E. coli and E. faeca-
lis (by I8), and E. coli,E. coli O157: H7, E. faecalis,S.
Typhimurium and S. Enteritidis (by I13) (Table 8).
Similarly, Gusils et al. [51] reported the complete loss
of antagonistic activity by 100 LAB strains isolated
from GIT of pigs against pathogens when the pH of
CFS was neutralized. LAB strains from poultry also
lost their inhibitory action after pH neutralization
[49]. Lin and Pan [52] reported constant antimicrobial
activity within the pH range from 1.0 to 4.0 but
complete loss of activity at 5.0 to 11.0 pH. In the
same vein, Blajman et al. [1] reported no zones of in-
hibition against pathogen tested when the CFS of
LAB strains isolated from poultry were adjusted to
pH 6.5. Also, when the CFS from our LAB strains
were heated at 100 °C for 10 min, there was no loss
of antimicrobial activity, depicting that the sub-
stance(s) responsible for antimicrobial activity may
not be heat sensitive. Furthermore, our study revealed
that hydrogen peroxide was not responsible for antag-
onistic activity by the selected LAB strains as there
was no effect when the supernatants of our LAB were
treated with catalase. Our findings showed that the
antimicrobial activity by our LAB strains was as a re-
sult of the secretion of organic acids, bacteriocins or
other natural antimicrobial substances. The secretion
of bacteriocins by LAB is greatly influenced by
temperature, pH, time of incubation and some other
environmental factors [53]. Also, it has been reported
that optimum bacteriocin secretion is between the
pH 4 and 5. Bacteriocins secreted by strains of LAB
have attracted unprecedented increased attention in
the food industry, medical and veterinary medicine
due to their safety [32]. From the last few decades,
several new bacteriocins secreted by strains of LAB
have been identified, named and characterized [54].
The assessment of antimicrobial susceptibility profile
is a major criterion for potential probiotics evaluation.
Microbial strains to be considered as probiotics should
not serve as antibiotic resistance genes reservoir, which
may further be transferred to intestinal pathogens [17].
All the 6 (100.00%) LAB isolates were susceptible to
penicillin, 5 (83.33%) were susceptible to chlorampheni-
col while 4 (66.67%) were susceptible to ceftriaxone,
ampicillin, and novobiocin (Tables 5and 6). Dowarah
et al. [14] also reported high susceptibility to penicillin,
ampicillin and chloramphenicol by LAB strains isolated
from pigs and poultry. Also, Puniya et al. [46], and Ana-
ndharaj and Sivasankari [55] showed ceftriaxone and no-
vobiocin susceptibility among LAB strains. It has also
been documented that lactobacilli are generally suscep-
tible to ampicillin [56]. Nevertheless, all the 6 (100.00%)
LAB strains examined were resistant to oxacillin, 5
(83.33%) were resistant to vancomycin, ciprofloxacin,
streptomycin, tetracycline while 3(50.00%) were resistant
to gentamicin. It has been reported in literature that
strains of LAB are resistant to β-lactam antibiotics in-
cluding oxacillin, because they harbor of β-lactamase
Table 8 The Effects of pH and heat treatment on antimicrobial
activity of potential lactic acid bacteria (LAB) probiotic strains
Treatment Indicator Strain Inhibition zone by
I2 I5 I8 I13 c3 c14
Untreated E. coli +++ +++ ++ ++ +++ ++
E. coli O157: H7 ++ ++ ++ ++ ++ ++
E. faecalis ++ ++ ++ ++ ++ ++
S. Typhimurium ++ ++ ++ ++ + +
S. Enteritidis + ++ ++ ++ ++ +
L. monocytogenes ++ ++ +++ ++ + ++
Neutralized E. coli ̶̶ ̶̶ +++̶̶ ̶̶
E. coli O157: H7 ̶̶ ̶̶ ̶̶ +̶̶ ̶̶
E. faecalis ̶̶ ̶̶ +++̶̶ ̶̶
S. Typhimurium ̶̶ ̶̶ ̶̶ +̶̶ ̶̶
S. Enteritidis ̶̶ ̶̶ ̶̶ +̶̶ ̶̶
L. monocytogenes ̶̶ ̶̶ ̶̶ ̶̶ ̶̶ ̶̶
Heat treated E. coli ++ +++ ++ ++ +++ +++
E. coli O157: H7 ++ ++ ++ ++ ++ +++
E. faecalis ++ ++ ++ ++ ++ +++
S. Typhimurium ++ ++ ++ ++ + +++
S. Enteritidis + ++ ++ ++ ++ +++
L. monocytogenes ++ ++ +++ ++ ++ +++
Catalase treated E. coli +++ +++ ++ ++ +++ ++
E. coli O157: H7 ++ ++ ++ ++ ++ ++
E. faecalis ++ ++ ++ ++ ++ ++
S. Typhimurium ++ ++ ++ ++ + +
S. Enteritidis + ++ ++ ++ ++ +
L. monocytogenes ++ ++ +++ ++ + ++
Symbols show zones of inhibition (mm): ̶̶, no inhibition ; +, weak (< 14); ++,
good (15–19); +++, strong (> 20), Neutralized; supernatant treated with 6 N
NaOH to obtained a pH 7, heat treated; Supernatants boiled for 10 min,
Catalase treated; supernatant treated with 0.5 mg/ml catalase
Reuben et al. BMC Microbiology (2019) 19:253 Page 13 of 20
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
[26,43]. Also, LAB have been reported to have intrin-
sic resistant to streptomycin and gentamicin, and
vancomycin which are aminoglycosides and glycopep-
tide [26]. This is as a result of their membrane im-
permeability. Similarly, high natural resistant to
ciprofloxacin as obtained in our work has also been
reported by Tang et al. [57]. Jose et al. [26]havepre-
viously reported tetracycline resistance from LAB
strains isolated from milk, animal rumen and most
commercial probiotics. The intrinsic antibiotic resist-
ance nature of LAB probiotics suggests their applica-
tion for both therapeutic and preventive purposes in
the treatment and control of intestinal infections es-
pecially when they are simultaneously administered
alongside antibiotics [58]. Also, the recovery of GIT
microflora can be enhanced such probiotics [46].
The high MAR indices recorded among LAB strains
isolated from poultry as recorded in our study show that
these strains were obtained from environment where
there is misuse of antibiotics. Indeed, this is the case
with the study area, where antibiotics are discriminately
used as feed additives in poultry. Furtula et al. [59] re-
ported that MAR index above 0.2 depicts that such
strain is obtained from environment with free access and
abuse of antimicrobial agents.
Results from both API 50 CHL and 16S rRNA se-
quencing shows inconsistencies except for Pediococcus
acidilactici (I8) and P. pentosaceus (I13) (Table 9).
Such inconsistencies were also recorded by Boyd
et al. [60] who opined that the identification of lacto-
bacilli using API 50 CHL database can lead to unin-
terpretable or misidentification results. Also, out of
the 7 LAB strains identified by both API 50 CHL and
16S rRNA sequencing, only 2 species L. salivarius
and P. acidilactici matched both identification systems
[61]. In some cases, commercial systems used for
identification often give correct identification of the
genus (as the case with LAB strain I2 in our study)
but not adequate enough to identify up to species
level. De Vries et al. (2006) further reported that
similar physiological profiles are often shown by
phylogenetically related LAB species, which makes it
inadequate to only rely on biochemical methods for
identification. Our results confirm the precision and
accuracy of 16S rRNA sequencing in the identification
of LAB as previously recommended [61].
Conclusion
In conclusion, 6 LAB strains from poultry were found to
possess suitable in vitro probiotic properties, including
broad spectrum of antimicrobial activity against zoonotic
and foodborne pathogens, good ability to competitively
exclude pathogens while adhering to chicken ileum epi-
thelial cells, high cell surface properties, survivability in
gastric juice (pH 2), and phenol and bile salt tolerance.
The six LAB strains identified by 16S rRNA sequencing to
Fig. 9 Phylogenic tree based on 16S rRNA gene sequences of potential lactic acid bacteria (LAB) strains in relation to the isolates and type
strains. The isolates sequenced in the study are depicted in bold font mentioning the accession number and the source of the samples within
bracket. Four strains are under the Pediococcus genus, one is Enterococcus faecium and another is Lactobacillus reuteri
Reuben et al. BMC Microbiology (2019) 19:253 Page 14 of 20
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
be Lactobacillus reuteri BCS134 (I2), Pediococcus acidilac-
tici R76 (I5 and c3), Pediococcus acidilactici X1 (I8) Pedio-
coccus pentosaceus LAB2 (I13), and Enterococcus faecium
ISMMS VRE 2 (c14). These LAB strains are ideal pro-
biotic candidates which can be used in vivo for both bio-
control of intestinal pathogens and to increase poultry
performance.
Methods
Isolation and phenotypic characterization of LAB strains
LAB strains were isolated from the GIT (crop and in-
testine) of apparently healthy male and female broilers
from the poultry farms in Jashore, Bangladesh. Briefly,
the chickens were euthanized using overdose of iso-
flurane anesthesia followed by cervical dislocation
after which their crops and intestines were aseptically
removed, placed in sterile plastic bags, and immedi-
ately brought to the laboratory for microbial analysis.
All efforts were made to minimize suffering. This eu-
thanasia method was adopted for this study due to its
rapidity, efficacy, ease of use and operator safety.
Also, it does not have deleterious effects on the birds.
After removing the content of each section, 10 g of
each of the GIT section was aseptically removed and
enriched in de Man, Rogosa, Sharpe (MRS) broth (40
ml) (Hi-Media, India), homogenized and then inocu-
lated at 37 °C for 24 h with constant homogenous
shaking under aerobic conditions [26]. All the tubes
showing turbidity were selected and further inoculated
onto MRS agar (Hi-Media, India) plates and incu-
bated for 24-72 h at 37 °C under aerobic conditions.
Plates showing white and creamy colonies (presump-
tive for LAB) were selected, and individual colonies
purified through three successive transfers on MRS
medium.
The pure cultures were characterized as LAB by Gram
staining, cell morphology, catalase, and coagulase reac-
tion according to standard procedures [13]. Gram-
positive, and catalase and coagulase-negative isolates
were selected and stored at -20 °C in MRS broth plus
28% glycerol (El-Soda et al., 2003). The purified stocked
cultures were resuscitated by sub-culturing twice in
MRS broth before each use.
Antagonistic activity
Agar well diffusion assay
The antagonistic effect of the LAB isolates against
some pathogens was first determined by the agar well
diffusion technique [62]. The LAB isolates were cul-
tured in MRS broth at 37 °C overnight, and the tar-
geted pathogens were also pre-cultured under the
same conditions in Brain Heart Infusion (BHI) broth
(Liofilchem, Italy). Exactly 200 μLofthetestpatho-
gens (10
7
CFU/ml) was further spread onto the sur-
face Mueller Hinton Agar (Biomark Lab, India) plates.
Wells punctured into the inoculated plates were filled
with 100 μL cell-free supernatant (CFS) obtained by
centrifugation of LAB cultures at 6000 rpm for 10 min
(Boeco, Germany). The plates were incubated at 37 °C
for 24 h. Antagonistic activity of the LAB strains was
assessed in terms of the formation of inhibition zones
(mm) around the wells. This technique was conducted
in triplicate for each LAB isolate and the mean result
taken. The target pathogens tested were Escherichia
coli ATCC 10536, E. coli O157: H7 ATCC 43894,
Enterococus faecalis ATCC 51299, Salmonella Typhi-
murium ATCC 14028, S. Enteritidis ATCC 13098 and
Listeria monocytogenes ATCC 19113.
Agar spot test
The antagonistic activity of the LAB strains was also
conducted using the agar spot test as previously de-
scribed by Armas et al. [27]. Overnight cultures of
the target strains (pathogens) were diluted in BHI
broth with 1 ml of each diluted culture (approximately
10
6
CFU/ml) inoculated onto BHI agar plates. The ex-
cess culture was removed after 5 min of contact, and
plates were left to dry for 30 min. MRS broth con-
taining overnight cultures of the LAB strains to be
tested for antagonistic activity were centrifuged (10
Table 9 Species identification of potential lactic acid bacteria (LAB) Probiotic strains by API 50 CHL and 16S rRNA Sequencing
Identification by API 50 CHL Identification by 16S rRNA sequences
Isolate Source Strains %
Accuracy
Strains Sequence Accession
Number
Sequence Identity
%
I2 Intestine Lactobacillus paracasei ssp
paracasei 1
98.3 Lactobacillus reuteri strain I2 MK953805 99.65
I5 Intestine Lactococcus lactis ssp. lactis 1 96.9 Pediococcus acidilactici strain I5 MK953806 99.72
I8 Intestine Pediococcus acidilactici 99.9 Pediococcus acidilactici strain I8 MK953807 99.72
I13 Intestine Pediococcus pentosaceus 2 99.9 Pediococcus pentosaceus strain
I13
MK953808 99.44
c3 Crop Pediococcus pentosaceus 2 95.5 Pediococcus acidilactici strain c3 MK953809 99.87
c14 Crop Lactococcus lactis ssp. lactis 1 92.9 Enterococcus faecium strain c14 MK953804 98.06
Reuben et al. BMC Microbiology (2019) 19:253 Page 15 of 20
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
min at 15000 g), and 3 μl of CFSC of each LAB strain
was spotted on the pathogen inoculated agar surface
in triplicate. Plates were left for 5 min to absorb and
then incubated aerobically at 37 °C for 24 h. Clear in-
hibition zone > 1 mm around a spot was measured
andscoredaspositive.
Safety of LAB probiotic strains
Haemolytic activity assay
The method of Maragkoudakis et al. [63]wasusedto
determine the haemolytic activity of LAB isolates.
Overnight cultures of LAB isolates grown in MRS
broth were streaked onto blood agar base (Diagnostic
Pasteur, France) plates containing 5% (v/v) of sheep
blood and then incubated at 37 °C overnight. Haemo-
lytic activities of the strains were recorded by the
presence of Beta (β) haemolysis (indicated by a clear,
colourless/lightened yellow zone surrounding the
colonies depicting total lysis of RBC. Alpha (α) haem-
olysis (indicated by a small zone of greenish to
brownish discoloration of the media, depicting reduc-
tion of haemoglobin to methemoglobin which diffuses
around, and Gamma (ϒ) haemolysis (with no change
observed in the media).
Assessment of probiotic properties of LAB strains
Bile salt tolerance test
To assess the bile salt tolerance, overnight LAB cultures
were resuspended in sterile PBS (pH 7.2) after centrifu-
gation, and further adjusted to give 10
8
CFU ml/L which
was added into fresh MRS broth containing 0.3% bile
salt (Merck KGaA, Germany) (w/v), and subsequently
incubated for 6 h. The viability of cells was determined
after 0, 3 and 6 h incubation by serial dilution and plat-
ing onto MRS agar [26].
Simulated gastric juice survivability test
Preparation of simulated gastric juice
As previously described by Corcoran et al [64], simu-
lated gastric juice was prepared with modifications. The
formulation was devoid of proteose peptone because it
may serve as free amino acid (L-glutamate,) source,
which may consequently enhance bacterial growth by
extruding protons from the cell.
Simulated gastric juice survivability test with and without
lysozyme (pH 2)
For each LAB strain, 1 ml of fresh culture was resus-
pended in an equal volume of PBS as earlier ex-
plained. Pelleted cells were then resuspended in 5 ml
volume of simulated gastric juice (with and without
lysozyme) and then incubated at 37 °C for 90 min
with constant stirring. At different time intervals of 0,
30, 60, and 90 min, samples were taken and serially
diluted in maximum-recovery diluent up to 10
−8
,and
finally seeded on MRS agar plates, and incubated at
37 °C for 48 h [64].
Adhesion of LAB strains to chicken ileum epithelial cells
The LAB strains were tested for adherence to chicken
epithelial cells as previously described [37] with modi-
fications. The entire GIT was removed from chicken
immediately after slaughter from a local abattoir and
transported to the laboratory in the icebox. Gut con-
tents were removed aseptically, and ileal segments
were opened, repeatedly washed with PBS and held in
PBS at 4
0
C for half an hour, to loosen the surface
mucus. The washed ileum was divided into four small
pieces (1cm
2
/1cm
2
), and each was incubated in cell
suspension of LAB strains (10
9
CFU/mL PSB) at 37°C
for 90 min. At 0, 30, 60, and 90 min time intervals,
samples were taken and screened for adherence. Non-
adherent bacteria were removed by gently washing of
incubated ileum with PSB, then macerated and finally,
serially diluted in a maximum-recovery diluent, and
subsequently plated onto MRS agar plates and incu-
bated at 37
o
Cfor24hrs.
Phenol tolerance test
Phenol tolerance ability of LAB strains was determined
by growing the strains in MRS broth containing increas-
ing concentration (0.1–0.4%) of phenol [43]. After
sterilization, each tube containing MRS broth with spe-
cific phenol concentration was inoculated with 1% (v/v)
of fresh overnight cultures of LAB strains and incubated
at 37
0
C for 24 h. Strains viability was assessed by meas-
uring the absorbance by spectrophotometer (PG instru-
ments, UK) at 620 nm after incubation. The experiment
was repeated thrice.
Temperature and NaCl tolerance assay
Overnight LAB cultures (1% v/v) were inoculated into
MRS broth and incubated at different temperatures of
4, 25, 37, 45 and 55 °C respectively for 24 h. Their
growths were afterward determined by measuring
their turbidity using the spectrophotometer at 600
nm, and subsequently seeded on MRS agar plates and
incubated for 24 –48hat37°C.Theappearanceof
LAB colonies on MRS agar plates corresponded and
confirmed their growth in MRS broth [65]. Similarly,
overnight LAB cultures (1% v/v) were inoculated into
MRS broth containing increasing concentration of
NaCl (0.5, 2.0, 4.0, 6.5 and 10.0%) and incubated
overnight at 37 °C. Strains viability was assessed by
measuring the absorbance at 600 nm. The experiment
was carried out in triplicate.
Reuben et al. BMC Microbiology (2019) 19:253 Page 16 of 20
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
Competitive adherence of LAB strains and pathogens to
chicken ileum epithelial cells
Competitive pathogens exclusion is one of the primary
mechanisms used by LAB in GIT. A piece of chicken
ileum was prepared as previously described above and
suspended in equal volumes of individual LAB strain
and each pathogen (10
9
CFU/mL PSB) and then incu-
bated with at 37 °C for 90 min. Samples were taken and
screened for competitive adherence 0, 30, 60, and 90
min intervals. Non-adherent bacteria from each piece of
the incubated ileum was removed by gently washing
with PSB, and then marcerated and subsequnetly, seri-
ally diluted in maximum-recovery diluent. Each diluent
was plated onto MRS agar plates for LAB, MacConkey
agar (HiMedia, India) plates for both E. coli and E. coli
O157:H7 and Salmonella Shigella Agar (Liofilchem,
Italy) plates for S. Typhimurium and S. Enteritidis
respectively and incubated at 37 °C for 24 h for
enumeration.
Cell surface characteristics
Auto-aggregation assay
With some modifications, the method of Polak-Berecka
et al. [66] was used in determining the auto-aggregation
ability of LAB strains. LAB strains were pelleted in PBS
(pH 7.2) (as previously described), and adjusted to get
10
8
CFU ml/L in the same solution. Exactly 5 mL of bac-
terial suspension was vortexed (Vision Scientific, Korea)
for 10 s, and the absorbance measured by the spectro-
photometer at 600 nm (OD
i
), and then incubated for 2 h
at 37 °C. The absorbance of the supernatant after 2 h of
incubation was then measured (OD
2h
). The auto-
aggregation coefficient (AC) was determined according
to the formula below:
ACt%ðÞ¼1OD2h=ODi
ðÞ½X100
Given :ODi¼initial optical density of the microbial suspension at 600 nm
OD2h¼optical density of the microbial suspension at 600 nm after 2h
Co-aggregation assay
Co-aggregation assay was conducted as previously de-
scribed [27,66]. The LAB isolates grown in MRS broth
were harvested by centrifugation at 6000 x gfor 15 min,
washed twice and resuspended with sterile PBS (pH 7.2)
and adjusted to 10
8
CFU ml/L in the same solution. An
equal volume, 2 ml of each isolate and each pathogen
cultures were mixed, vortexed and incubated for 2 h at
37 °C. Each control tubes contained 4 mL of each bac-
terial suspension (i.e., the probiotic strain and the patho-
gen). The absorbance of each mixed suspension was
then measured at 600 nm (ODmix) and compared to
those of the control tubes containing the probiotic strain
(ODstrain) and the specific pathogen (ODpathogen) at
2 h of incubation. co-aggregation was calculated using
the formula below:
Co−aggregation %ðÞ¼1−ODmix=ODstrain þODpathogenðÞ=2½x100
LAB cell surface hydrophobicity assay
The cell surface hydrophobicity of LAB cells was
assayed according to the method described previously
by Abbasiliasi et al. [65]. Three tubes each containing 3
mL of each LAB strain cells suspension in PBS (pH 7.2)
at 10
8
CFU/mL were each mixed with n-hexadecane (1
mL) (a solvent) and then vortexed for 1 min. The mix-
ture was subsequently allowed to separate into two
phases by standing for 5–10 min. The OD (at 600 nm)
of the aqueous phase was measured with a spectropho-
tometer. Bacterial affinity to solvent (n-hexadecane)
(BATS) (hydrophobicity) was expressed using the equa-
tion below:
BATS %ðÞ¼1−A10 min =A0min
ðÞx100
Where, A
10min
is the absorbance at t = 10 min, and
A
0min
is the absorbance at t = 0 min.
α–Glucosidase inhibitory activity of LAB strains
With slight modifications, the procedure of Kim et al.
[50] was used to determine the inhibitory activity of
α–glucosidasebyLABstrains.Overnightcultureof
each LAB strain was centrifuged for 15 min at 4000×g
and resuspended in PBS (50 μl). Exactly 3 mM p-ni-
trophenol-αD-glucopyranoside (pNPG, 50 μL) and the
enzymatic reaction was allowed to proceed at 37°C
for 30 min and finally stopped by the addition of 50
μLof0.1MNa
2
CO
3
, and the absorption released of
Nitrophenol was measured at 405 nm using a micro-
platereader.Theformula;(1-A/B)x100wasusedto
calculate the inhibition of α-glucosidase activity of
LAB strains, where A was the absorbance of the reac-
tants with the sample, and B was the absorbance of
the reactants without the sample (negative control).
Acarbose was used as the standard reference (positive
control).
Characterization of LAB antimicrobial substances
LAB strains with probiotic potentials were selected and
further tested for the production antimicrobial sub-
stance, mainly bacteriocins, organic acids and hydrogen
peroxides using the agar well diffusion technique as pre-
viously described [67] with modifications. Overnight cul-
tures of LAB grown in MRS broth were centrifuged at
6000 g for 10 min, and the supernatants were collected
and divided into four treatments: one was heat treated
(boiled) for 10 min, the second was neutralized to pH 7
Reuben et al. BMC Microbiology (2019) 19:253 Page 17 of 20
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
with 6 N NaOH (Fisher), the third was treated with 0.5
mg/ml catalase (Hi-media) and the fourth was untreated.
These supernatants were subsequently filter sterilized
(0.22 μm), and 100 μl was placed into wells bored in agar
plates inoculated with 1% (v/v) overnight cultures of in-
dicator pathogens as previously listed. The plates were
further incubated at 37 °C overnight, and diameter of in-
hibition zones were measured (mm).
Antibiotic susceptibility test
The LAB isolates were examined for antimicrobial sus-
ceptibility, using the agar disc diffusion method [68].
The LAB strains to be tested were grown in fresh MRS
broth at 37 °C overnight. The bacterial suspensions were
matched to McFarland’s standard 2 (10
8
CFU/mL) and
subsequently spread onto the surface of the MRS agar
plates using a sterile cotton swab. Commercially avail-
able antibiotic discs (Hi-Media, Mumbai) including peni-
cillin G (2 units), ceftriaxone (30 μg), ampicillin (25 μg),
vancomycin (30 μg), oxacillin (μg), streptomycin (10 μg),
chloramphenicol (30 μg), gentamicin (10 μg), erythro-
mycin (10 μg), tetracycline (10 μg), novobiocin (30 μg)
and ciprofloxacin (10 μg) were aseptically placed on the
surface of the dried inoculated agar plates, and then in-
cubated for 24 h at 37 °C. Clear zones of microbial
growth inhibition around each antibiotic were measured
using a transparent ruler after 24 h incubation. Isolates
were categorized as sensitive (≥21 mm), intermediate
(16–20 mm), or resistant (≤15 mm) as previously
assessed [65].
Biochemical identification of LAB strains using API 50 CHL
The carbohydrate fermentation profiles of most prom-
ising LAB probiotic strains were investigated using
API 50 CH strips and API CHL medium according to
the manufacturer’s instruction (API system, BioMèr-
ieux,France).Overnightcultures of LAB grown in
MRS broth were pelleted after washing twice with
sterile PBS, and were re-suspended in API 50 CHL
medium, using sterile pipettes. With subsequent mix-
ing, the homogenized cells suspension were trans-
ferred into each of the 50 wells on the API 50 CH
strips. The strips were covered as recommended and
incubated at 30°C. Changes in color were monitored
after 24 and 48 hrs of incubation. Results were repre-
sented by a positive sign (+) while a negative sign (−)
was designated for no change. The apiweb™Software
version 5.0 (BioMèrieux, France) was used according
to manufacturer’s instruction in the interpretation of
the results.
Molecular identification by 16S rRNA sequencing
The molecular identification of LAB strains was con-
ducted by 16S rRNA amplification, sequencing and
analysis, using the universal forward and reverse primers
27F: AGAGTTTGATCMTGGCTCAG and 1492R:
TACGGCTACCTTGTTACGACTT with 1500 bp prod-
uct [29]. PCR reactions were conducted using a total
volume of 20 μl, containing 10 μl of NZYTaq 2× Green
Master Mix, 0.5 μl each of forward and reverse primers,
6μl of DNase free water and 2 μl of DNA template. The
amplification protocol of Shokryazdan et al. [29] was
adopted for this study. After amplification, 10 μl of PCR
products were analyzed for electrophoresis and then
visualizaed by transillumination under UV light using
ImageMaster (Pharmacia Biotech, UK). The PCR prod-
ucts with 1.5 kb as the expected size were purified and
sequenced. The sequence data obtined were further
compared with the database in the Genbank using the
basic local alignment search tool (BLAST) fot the final
idetification of the LAB strains.
Statistical analysis
All measurements were repeated independently in tripli-
cate, and results were expressed as mean ± standard de-
viation (SD). Data obtained were statistically analysed
using GraphPad Prism version 5.0 for Windows (Graph-
Pad Software, San Diego, CA, USA). One-way analysis of
variance was used to study significant difference between
means, with significance level at P< 0.05. Duncan’s mul-
tiple ranges or t-student test was used, when necessary,
to discriminate differences between means. Differences
were considered statistically significant at p< 0.05.
Abbreviations
16SrRNA: 16S ribosomal ribonucleic acid; CFS: Cell free supernatant; CFU/
ml: Colony forming unit per millilitre; DNA: Deoxyribonucleic;
GIT: Gastrointestinal tract; LAB: Lactic acid bacteria; MRA: Multiple antibiotic
resistance; MRS: De Man, rogosa and sharpe; OD: Optical density;
PCR: Polymerase chain reaction; spp: Species
Acknowledgments
We acknowledge the support and technical assistance of genome center
and microbiology laboratory throughout this research.
Authors’contributions
RCR carried out the isolation, probiotic assessment assays and drafted the
manuscript. PCR was involved in data collection, analysis and manuscript
revision. SLS participated in the sample collection, design of the study and
manuscript editing. RAU conducted the molecular characterization and the
sequencing. IKJ designed the study, coordinated the research and revised
the manuscript. All the participating authors read and approved the
submitted manuscript.
Funding
This research was supported by the Bangladesh Academy of Science
under BAS-USDA program with grant code number LSC 33. The funding
agency received quarterly report while routinely monitoring the progress
of the research as they provide useful suggestions and
recommendations.
Availability of data and materials
All 16S sequences obtained in this study were deposited in NCBI with the
accession numbers MK953805- MK953809.
Reuben et al. BMC Microbiology (2019) 19:253 Page 18 of 20
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
Ethics approval and consent to participate
All experiments on animals were performed in accordance to European
convention for the protection of vertebrate animals used for experimental
and other scientific purposes (Directive 2010/63/EU). All experimental
procedures and protocols conformed to the International Guiding Principles
for Biomedical Research Involving Animal. The experiment on chicken was
approved by the Animal Care and Use Guidelines of the Faculty Biological
Sciences and Technology, Jashore University of Science and Technology,
Jashore, Bangladesh (certification number: ERC/FBST/JUST/2019–32) and was
permitted by the owners of the poultry farms. Every effort was made to
minimize animal suffering.
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Author details
1
Department of Microbiology, Faculty of Biological Sciences and Technology,
Jashore University of Science and Technology, Jashore 7408, Bangladesh.
2
Department of Science Laboratory Technology, Nasarawa State Polytechnic,
P.M.B 109, Lafia, Nigeria.
Received: 25 July 2019 Accepted: 27 October 2019
References
1. Blajman J, Cristian G, María VZ, Lorena S, Diego A, Ayelén B, et al. In vitro
and in vivo screening of native lactic acid bacteria toward their selection as
a probiotic in broiler chickens. Res Vet Sci. 2015;101:50–6. https://doi.org/10.
1016/j.rvsc.2015.05.017.
2. Hill C, Guarner F, Reid G, Gibson GR, Merenstein DJ, Pot B, et al. The
international scientific Association for Probiotics and Prebiotics consensus
statement on the scope and appropriate use of the term probiotic. Nat Rev
Gastroenterol Hepatol. 2014;11:506–14.
3. Tavakoli M, Hamidi-Esfahani Z, Hejazi MA, Azizi MH, Abbasi S.
Characterization of probiotic abilities of lactobacilli isolated from Iranian
koozeh traditional cheese. Polish J Food Nutrition Sci. 2017;67(1):1. https://
doi.org/10.1515/pjfns-2016-0003.
4. Ahmed FE. Genetically modified probiotics in foods. Trends Biotechnol.
2003;21:491–7.
5. Vaughan EE, Heilig HG, Ben-Amor K, de Vos WM. Diversity, vitality and
activities of intestinal lactic acid bacteria and bifidobacteria assessed by
molecular approaches. FEMS Microbiol Rev. 2005;29:477–90.
6. RiazRajokaMS,ShiJ,ZhuJ,ShaoD,HuangQ,YangH,etal.Capacityoflactic
acid bacteria in immunity enhancement and cancer prevention. Appl Microbiol
Biotechnol. 2017;101(1):35–45. https://doi.org/10.1007/s00253-016-8005-7.
7. Shahid R, Shaheen M, Batool T, Saleem N, Hayat F. Lactic acid bacteria as
probiotic candidate and their application. J Biol Today’s World. 2015;4(12):
209–16.
8. Food and Agriculture Organization (FAO). In: Makkar HPS, editor. Probiotics
in animal nutrition –Production, impact and regulationby Yadav S. Bajagai,
Athol V. Klieve, Peter J. Dart and Wayne L. Bryden, vol. 179. Rome: FAO
Animal Production and Health; 2016. Available on: http://www.fao.org/3/a-i5
933e.pdf.
9. Toghyani M, Toghyani M, Tabeidian SA. Effect of probiotic and prebiotic as
antibiotic growth promoter substitutions on productive and carcass traits of
broiler chicks. Int Conf Food Eng Biotechnol. 2011;9:82–6.
10. Huff GR, Huff WE, Rath NC, El-Gohary FA, Zhou ZY, Shini S. Efficacy of a
novel prebiotic and a commercial probiotic in reducing mortality and
production losses due to cold stress and Escherichia coli challenge of
broilers chicks. Poult Sci. 2015;94:918–26.
11. Kizerwetter-Świda M, Binek M. Assessment of potentially probiotic
properties of Lactobacillus strains isolated from chickens. Polish J Vet Sci.
2016;19(1):15–20. https://doi.org/10.1515/pjvs-2016-0003.
12. Food and Agriculture Organization (FAO). FAOSTAT Livestock Primary, 2017.
Available on: http://www.fao.org/faostat/en/#data/QL
13. De Man JC, Rogosa M, Sharpe ME. A medium for the cultivation of
lactobacilli. J Appl Microbiol. 1960;23:130–5.
14. Dowarah R, Verma AK, Agarwal N, Singh P, Singh BR. Selection and
characterization of probiotic lactic acid bacteria and its impact on
growth, nutrient digestibility, health and antioxidant status in weaned
piglets. PLoS One. 2018;13(3):e0192978. https://doi.org/10.1371/journal.
pone.0192978.
15. Ehrmann MA, Kurzak P, Bauer J, Vogel RF. Characterization of lactobacilli
towards their use as probiotic adjuncts in poultry. J Appl Microbiol.
2002;92:966–75.
16. Yang E, Fan L, Yan J, Jiang Y, Doucette C, Fillmore S, et al. Influence of
culture media, pH and temperature on growth and bacteriocin production
of bacteriocinogenic lactic acid bacteria. AMB Express. 2018;8(1):10. https://
doi.org/10.1186/s13568-018-0536-0.
17. Venkatasatyanarayana N, Vishwanathan S, Kadirvelu J. Molecular
characterization of antimicrobial Lactobacillus isolates and evaluation of
their probiotic characteristics in vitro for use in poultry. Food Biotechnol.
2017;31(1):20–41. https://doi.org/10.1080/08905436.2016.1269289.
18. Shin MS, Han SK, Ji AR, Kim KS, Le WK. Isolation and characterization of
bacteriocin-producing bacteria from the gastrointestinal tract of broiler
chickens for probiotic use. J Appl Microbiol. 2008;105:2203–12. https://doi.
org/10.1111/j.1365-2672.2008.03935.x.
19. Taheri HR, Moravej H, Tabandeh F, Zaghari M, Shivazad M. Screening of
lactic acid bacteria toward their selection as a source of chicken probiotic.
Poultry Sci. 2009;88:1586–93. https://doi.org/10.3382/ps.2009-00041.
20. Yaneisy GH, Tania PS, Ramón B, José L, Balcázar JR, Nicoli JMS, et al.
Isolation, characterization and evaluation of probiotic lactic acid bacteria for
potential use in animal production. Res Vet Sci. 2016;108:125–32. https://doi.
org/10.1016/j.rvsc.2016.08.009.
21. Busayo DA, Clara P, Vincenza F, Patrícia RM, Adewale OO, Lateef OS, et al.
Screening and molecular identification of lactic acid bacteria from gari and
fufu and gari effluents. Ann Microbiol. 2017;67:123–33. https://doi.org/10.
1007/s13213-016-1243-1.
22. Olufemi FO, Chijioke OM, Popoola ST, Oluwafemi OF. In vitro study of potential
probiotic lactic acid Bacteria isolated from the gut of chickens in Abeokuta,
Nigeria. Alexandria J Vet Sci. 2018;58(1):73–84. https://doi.org/10.5455/ajvs.290499.
23. Kizerwetter-Swida M, Binek M. Selection of potentially probiotic Lactobacillus
strains towards their inhibitory activity against poultry enteropathogenic
bacteria. Pol J Microbiol. 2005;54:287–94.
24. de Almeida Júnior WLG, Ferrari ÍDS, de Souza JV, da Silva CDA, da Costa
MM, Dias FS. Characterization and evaluation of lactic acid bacteria isolated
from goat milk. Food Control. 2015;53:96–103. https://doi.org/10.1016/j.
foodcont.2015.01.013.
25. Spanggaard B, Huber I, Nielsen J, Sick EB, Pipper CB, Martinussen T, et al.
The probiotic potential against vibriosis of the indigenous microflora of
rainbow trout. Environ Microbiol. 2001;3(12):755–76.
26. Jose NM, Bunt CR, Hussain AM. Comparison of microbiological and
probiotic characteristics of lactobacilli isolates from dairy food products and
animal rumen contents. Microorganisms. 2015;3:198–212. https://doi.org/10.
3390/microorganisms3020198.
27. Armas F, Camperio C, Marianelli C. In Vitro assessment of the probiotic potential
of Lactococcus lactis LMG 7930 against ruminant mastitis-causing pathogens.
PLoS One. 2017;12(1):e0169543. https://doi.org/10.1371/journal.pone.0169543.
28. Lin J, Sahin O, Michel LO, Zhang Q. Critical role of multidrug efflux pump
CmeABC in bile resistance and in vivo colonization of Campylobacter jejuni.
Infect Immunity. 2003;71:4250–9.
29. Shokryazdan P, Kalavathy R, Sieo CC, Alitheen NB, Liang JB, Jahromi MF,
et al. Isolation and characterization of Lactobacillus strains as potential
probiotics for chickens. Pertanika J Tropical Agric Sci. 2014;37(1):141–57.
30. Dunne C, O’Mahony L, Murphy L, Thornton G, Morrissey D, O’Halloran S,
et al. In vitro selection riteria for probiotic bacteria of human origin:
correlation with in vivo findings. Am J Clin Nutr. 2001;73:386S–92S.
31. Vizoso P, Franz MG, Schillinger U, Holzapfel WH. Lactobacillus spp. with
in vitro probiotic properties from human faeces and traditional fermented
products. Int J Food Microbiol. 2006;109:205–14.
32. Musikasang H, Sohsomboon N, Tani A, Maneerat S. Bacteriocin-producing
lactic acid bacteria as a probiotic potential from Thai indigenous chickens.
Czech J Anim Sci. 2012;57(3):137–49.
33. Klingberg TD, Axelsson L, Naterstad K, Elsser D, Budde BB. Identification of
potential probiotic starter cultures for Scandinavian-type fermented
sausages. Int J Food Microbiol. 2005;105:419–31.
34. Yu B, Tsen HY. Lactobacillus cells in the rabbit digestive tract and the factors
affecting their distribution. J Appl Bacteriol. 1993;75:269–75.
Reuben et al. BMC Microbiology (2019) 19:253 Page 19 of 20
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
35. Collado MC, Meriluoto J, Salminen S. In vitro analysis of probiotic strain
combination to inhibit pathogen adhesion to human intestinal mucus.
Food Res Int. 2007;40:629–36.
36. Mack DR, Michail S, Wei S, McDougall L, Hollingsworth MA. Probiotics inhibit
enteropathogenic E. coli adherence in vitro by inducing intestinal mucin
expression. Am J Physiol Gastrointest Liver Physiol. 1999;276:G941–50.
37. Nitisinprasert S, Pungsungworn N, Wanchaitanawong P, Loiseau G, Montet
D. In vitro adhesion assay of lactic acid bacteria, Escherichia coli and
Salmonella sp. by microbiological and PCR methods. Songklanakarin J Sci
Technol. 2006;28(Suppl.1):99–106.
38. Setyawardani T, Rahayu WP, Maheswari RR, Palupi NS. Antimicrobial activity
and adhesion ability of indigenous lactic acid bacteria isolated from goat
milk. Intl Food Res J. 2014;21(3):959–64.
39. PeresCM,AlvesM,Hernandez-MendozaA,MoreiraL,SilvaS.Novel
isolates of lactobacilli from fermented Portuguese olive as potential
probiotics. LWT - Food Sci Technol. 2014;59(1):234–46. https://doi.org/
10.1016/j.lwt.2014.03.003.
40. Sathyabama S, Vijayabharathi R, Priyadarisini VB. Screening for probiotic
properties of strains isolated from feces of various human groups. J
Microbiol. 2015;50:603–12.
41. Shehata MG, El Sohaimy SA, Malak AE, Youssef MM. Screening of isolated
potential probiotic lactic acid bacteria for cholesterol lowering property and
bile salt hydrolase activity. Ann Agric Sci. 2016;61(1):65–75. https://doi.org/
10.1016/j.aoas.2016.03.001.
42. Coulibaly I, Robin DD, Destain J, Philippe T. Characterization of lactic acid
bacteria isolated from poultry farms in Senegal. African J Biotechnology.
2008;7(12):2006–12.
43. Hoque MZ, Akter F, Hossain KM, Rhaman MSM, Billah MM, Islam KMD. Isolation,
identification and analysis of probiotic properties of Lactobacillus spp from
selective regional yoghurt. World J Dairy Food Science. 2010;5(1):39–46.
44. Kos B, Šuškovi J, Vukovi S, Šimpraga M, Frece J, Matoši S. Adhesion and
aggregation ability of probiotic strain Lactobacillus acidophilus M92. J Appl
Microbiol. 2003;94:981–7. https://doi.org/10.1046/j.1365-2672.2003.01915.x.
45. Dharmawan J, Surono IS, Kun LY. Adhesion properties of indigenous Dadih
lactic acid bacteria on human intestinal mucosal surface. Asian-Aust J
Animal Sci. 2006;19:751–5.
46. Puniya M, Ravinder Kumar M, Panwar H, Kumar N, Ramneek R. Screening of
lactic acid Bacteria of different origin for their probiotic potential. J Food
Process Technol. 2016;7:545. https://doi.org/10.4172/2157-7110.1000545.
47. Onifade AA. Growth performance, carcass characteristics, organ
measurements and haematology of broiler chickens fed a high fibre diet
supplemented with antibiotics or dried yeast. Die Nahrung. 1997;41:370–4.
48. Pringsulaka O, Rueangyotchanthana K, Suwannasai N, Watanapokasin N,
Amnueysit P, Sunthornthummas S. In vitro screening of lactic acid bacteria
for multi-strain probiotics. Livestock Sci. 2015;174:66–73.
49. Karimi T, Rahimi MA, Mojgani N, Esmaeilkhanian S, Grime JL. Screening of
indigenous strains of lactic acid Bacteria for development of a probiotic for
poultry. Asian-Aust J Animal Science. 2008;21(10):1495–500.
50. Kim S, Eunchong H, Soyoung P, Holzapfel W, Lim SD. Physiological
characteristics and anti-obesity effect of Lactobacillus plantarum K10. Korean
J Food Sci An. 2018;38(3):554–69.
51. Gusils C, Bujazha M, Gonzalez S. Preliminary studies to design a probiotic for
use in swine feed. Interciencia. 2002;27:409–13.
52. Lin TH, Pan TM. Characterization of an antimicrobial substance produced by
Lactobacillus plantarum NTU 102. J Microbiol Immunol Infect. 2017;8:1–9.
https://doi.org/10.1016/j.jmii.2017.08.003.
53. Annamalai N, Manivasagan P, Balasubramanian T, Vijayalakshmi S. Enterocin
from Enterococcus faecium isolated from mangrove environment. Afr J
Biotechnol. 2009;8(22):6311–6.
54. Perez RH, Zendo T, Sonomoto K. Novel bacteriocins from lactic acid bacteria
(LAB): various structures and applications. Microb Cell Factories. 2014;
13(Suppl 1):S3. https://doi.org/10.1186/1475-2859-13-S1-S3.
55. Anandharaj M, Sivasankari B. Isolation of potential probiotic Lactobacillus oris
HMI68 from mother's milk with cholesterol-reducing property. J Biosci
Bioeng. 2014;118:153–9.
56. Gueimonde M, Sanchez B. de los Reyes-Gavilan CG, Margolles A. antibiotic
resistance in probiotic bacteria. Front Microbiol. 2013;202:1–6.
57. Tang H, Qian B, Xia B. Screening of lactic acid bacteria isolated from fermented
Cornus officinalis fruits for probiotic potential. J Food Safety. 2018;38:e12565.
58. Kim DH, Austin B. Characterization of probiotic Carnobacteria isolated from
rainbow trout (Oncorhynchus mykiss) intestine. Lett Appl Microbiol. 2008;47:141–7.
59. Furtula V, Jackson CR, Farell EG, Barrett JB, Hiott LM, Chambers PA.
Antimicrobial resistance in Enterococcus spp. isolated from environmental
samples in an area of intensive poultry production. Int J Environ Res Public
Health. 2013;10:1020–36.
60. Boyd MA, Antonio MAD, Hillier SL. Comparison of API 50 CH strips to whole
chromosomal DNA probes for identification of Lactobacillus species. J Clin
Microbiol. 2005;43(10):5309–11.
61. Sakaridis I, Soultos N, Dovas CI, Papavergou E, Ambrosiadis I, Koidis P. Lactic
acid bacteria from chicken carcasses with inhibitory activity against
Salmonella spp. and Listeria monocytogenes. Anaerobe. 2012;18:62–6. https://
doi.org/10.1016/j.anaerobe.2011.09.009.
62. Vinderola G, Capellini B, Villarreal F, Suarez V, Quiberoni A, Reinheimer J.
Usefulness of a simple set of in vitro tests for the screening and
identification of probiotic candidate strains for dairy use. LWT—Food Sci
Technol. 2008;41:1678–88.
63. Maragkoudakis PA, Zoompopoulou G, Miaris C, Kalantzopoulos C, Pot B,
Tsakalido E. Probiotic potentials of Lactobacillus strains isolated from dairy
products. Itnl Dairy J. 2006;16:189–99.
64. Corcoran BM, Stanton Fitzgerald GF, Ross RP. Survival of probiotic
lactobacilli in acidic environments is enhanced in the presence of
Metabolizable sugars. Appl Environ Microbiol. 2005;71(6):3060–7.
65. Abbasiliasi S, Tan JS, Bashokouh F, Ibrahim TAT, Mustafa S, Vakhshiteh F,
et al. In vitro assessment of Pediococcus acidilactici Kp10 for its potential use
in the food industry. BMC Microbiol. 2017;121:1–11.
66. Polak-Berecka MA, Waśko RP, Skrzypek P, Sroka-Bartnicka A. The effect of cell
surface components on adhesion ability of Lactobacillus rhamnosus. Antonie
Van Leeuwenhoek. 2014;106:751–62.
67. Prabhurajeshwar C, Chandrakanth RK. Probiotic potential of lactobacilli with
antagonistic activity against pathogenic strains: An in vitro validation for the
production of inhibitory substances. Biom J. 2017;40:270–83. https://doi.org/
10.1016/j.bj.2017.06.008.
68. Bauer AW, Kirby WMN, Sherries JL. Antibiotics susceptibility testing a
standard disc method. Am J Clin Pathol. 1996;45:493e6.
Publisher’sNote
Springer Nature remains neutral with regard to jurisdictional claims in
published maps and institutional affiliations.
Reuben et al. BMC Microbiology (2019) 19:253 Page 20 of 20
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
1.
2.
3.
4.
5.
6.
Terms and Conditions
Springer Nature journal content, brought to you courtesy of Springer Nature Customer Service Center GmbH (“Springer Nature”).
Springer Nature supports a reasonable amount of sharing of research papers by authors, subscribers and authorised users (“Users”), for small-
scale personal, non-commercial use provided that all copyright, trade and service marks and other proprietary notices are maintained. By
accessing, sharing, receiving or otherwise using the Springer Nature journal content you agree to these terms of use (“Terms”). For these
purposes, Springer Nature considers academic use (by researchers and students) to be non-commercial.
These Terms are supplementary and will apply in addition to any applicable website terms and conditions, a relevant site licence or a personal
subscription. These Terms will prevail over any conflict or ambiguity with regards to the relevant terms, a site licence or a personal subscription
(to the extent of the conflict or ambiguity only). For Creative Commons-licensed articles, the terms of the Creative Commons license used will
apply.
We collect and use personal data to provide access to the Springer Nature journal content. We may also use these personal data internally within
ResearchGate and Springer Nature and as agreed share it, in an anonymised way, for purposes of tracking, analysis and reporting. We will not
otherwise disclose your personal data outside the ResearchGate or the Springer Nature group of companies unless we have your permission as
detailed in the Privacy Policy.
While Users may use the Springer Nature journal content for small scale, personal non-commercial use, it is important to note that Users may
not:
use such content for the purpose of providing other users with access on a regular or large scale basis or as a means to circumvent access
control;
use such content where to do so would be considered a criminal or statutory offence in any jurisdiction, or gives rise to civil liability, or is
otherwise unlawful;
falsely or misleadingly imply or suggest endorsement, approval , sponsorship, or association unless explicitly agreed to by Springer Nature in
writing;
use bots or other automated methods to access the content or redirect messages
override any security feature or exclusionary protocol; or
share the content in order to create substitute for Springer Nature products or services or a systematic database of Springer Nature journal
content.
In line with the restriction against commercial use, Springer Nature does not permit the creation of a product or service that creates revenue,
royalties, rent or income from our content or its inclusion as part of a paid for service or for other commercial gain. Springer Nature journal
content cannot be used for inter-library loans and librarians may not upload Springer Nature journal content on a large scale into their, or any
other, institutional repository.
These terms of use are reviewed regularly and may be amended at any time. Springer Nature is not obligated to publish any information or
content on this website and may remove it or features or functionality at our sole discretion, at any time with or without notice. Springer Nature
may revoke this licence to you at any time and remove access to any copies of the Springer Nature journal content which have been saved.
To the fullest extent permitted by law, Springer Nature makes no warranties, representations or guarantees to Users, either express or implied
with respect to the Springer nature journal content and all parties disclaim and waive any implied warranties or warranties imposed by law,
including merchantability or fitness for any particular purpose.
Please note that these rights do not automatically extend to content, data or other material published by Springer Nature that may be licensed
from third parties.
If you would like to use or distribute our Springer Nature journal content to a wider audience or on a regular basis or in any other manner not
expressly permitted by these Terms, please contact Springer Nature at
onlineservice@springernature.com
Available via license: CC BY 4.0
Content may be subject to copyright.
Content uploaded by Rine C. Reuben
Author content
All content in this area was uploaded by Rine C. Reuben on Nov 13, 2019
Content may be subject to copyright.
Content uploaded by Rine C. Reuben
Author content
All content in this area was uploaded by Rine C. Reuben on Nov 13, 2019
Content may be subject to copyright.
