Content uploaded by Rezheen F. Abdulrahman
Author content
All content in this area was uploaded by Rezheen F. Abdulrahman on Feb 05, 2022
Content may be subject to copyright.
134
Exploratory Animal and Medical Research, Vol.10, Issue 2, December, 2020
Explor Anim Med Res,
Vol.10, Issue - 2, 2020, p. 134-140 ISSN 2277- 470X (Print), ISSN 2319-247X (Online)
Website: www.animalmedicalresearch.org
Research Article
HISTOPATHOLOGICAL AND MOLECULAR STUDIES ON CASEOUS
LYMPHADENITIS IN SHEEP AND GOATS IN DUHOK CITY, IRAQ
Rezheen F. Abdulrahman1*, Mahdi A. Abdullah1, Kareem Herish Kareem2, Zirak Dewali Najeeb2,
Hivi Miqdad Hameed2
Received 14 July 2020, revised 31 August 2020
ABSTRACT: Caseous lymphadenitis is an infectious bacterial disease of sheep and goats caused by Corynebacterium
pseudotuberculosis. This study is aimed to estimate the frequency of caseous lymphadenitis in sheep and goats and to
compare with the results of bacteriological analysis, histopathology and molecular diagnosis of suspected cases. In this
study, 22 (2.1%) suspected cases of caseous lymphadenitis were diagnosed clinically from 1090 sheep and goats slaughtered
at Duhok abattoir. The study showed grossly affected mediastinal lymph node was congested and highly oedematous
compared to other lymph nodes. Histopathological examination showed presence of abscess in the centre of affected
mediastinal lymph node. Based on standard bacteriological methods, Corynebacterium pseudotuberculosis was the only
causative agent isolated from all suspected cases. The confirmation was performed by amplification of the target genes of
Corynebacterium pseudotuberculosis including 16S rRNA, rpoB and pld. The results showed successful amplification of
16S rRNA, rpoB and pld among all suspected cases. Overall, the results of this study showed that the Corynebacterium
pseudotuberculosis is still the main causative agent of CLA in sheep and goats. The results also revealed molecular and
histopathological studies together could be used to identify Corynebacterium pseudotuberculosis directly from cases of
CLA from sheep and goats. Further studies including study of virulence genes and antimicrobial susceptibility together
with phylogenetic analyses are recommended to be done in the future for better understanding of the epidemiology of this
pathogen in Duhok city.
Key words: CLA, C. pseudotuberculosis, Histopathology, Molecular diagnosis, Sheep and goat, Duhok.
1Pathology and Microbiology Department, Collage of Veterinary Medicine, University of Duhok, Duhok, Kurdistan Region,
Iraq, 2Department of Medicine and Surgery, College of Veterinary Medicine, Duhok University, Iraq.
*Corresponding author. e-mail: rezheen_fatah@uod.ac
INTRODUCTION
Caseous lymphadenitis (CLA) is an infectious disease
that affects small ruminants including sheep and goats
and the disease is caused by Corynebacterium
pseudotuberculosis (C. pseudotuberculosis) (Guerrero et
al. 2018, Parin et al. 2018). C. pseudotuberculosis is a
Gram-positive, pleomorphic, facultative anaerobic, non-
motile, non-spore forming, non-capsulated, and
intracellular microorganism (Guimarães et al. 2011). The
microorganism is classified into two biovars based on
their ability to reduce nitrate and two biovars have been
confirmed by biotyping and molecular techniques
(Connor et al. 2000, Connor et al. 2007). The biovar Ovis
is unable to reduce nitrate and it mainly affects sheep
and goats causing caseous lymphadenitis. The biovar Equi
on the other hand, is able to reduce nitrate and is mainly
isolated from horses and cattle with ulcerative
lymphangitis (Oliveira et al. 2016). CLA is characterized
by formation of caseous abscesses in lymph nodes and
visceral organs as well and it may also cause disorders of
reproductive system including orchitis, abortion, and
stillbirth (Umer et al. 2017). Infection with C.
pseudotuberculosis is associated with necrosis,
inflammation, and enlargement of lymph nodes. In
addition, hair loss and chronic abscessation of affected
lymph nodes may occur. Sometimes rupture of the
affected node followed by pus discharge also is observed
(Baird and Fontaine 2007). CLA is one of the
economically important diseases in sheep and goats
worldwide and the economic losses are due to poor
135
growth of wool, decrease in meat, and milk production,
reproductive disorders of affected animals and carcasses
as well as skin condemnation in abattoirs (Arsenault et
al. 2003, Guimarães et al. 2011, Umer et al. 2017).
Diagnosis of CLA is based mainly on a post-mortem
examination of the lesions, isolation and identification
of C. pseudotuberculosis from the pus using phenotypic
characterization and biochemical tests (Dorella et al.
2006). The characteristics of the species within the
Corynebacterium genus are variable; accordingly
advance technique such as polymerase chain reaction
(PCR) is used to confirm the detection of the bacterium
with high specificity, sensitivity and efficiency. For
example, PCR based detection of 16S rRNA (Çetinkaya
et al. 2002), RNA polymerase β-subunit (rpoB) (Khamis
et al. 2004) and phospholipase D (pld) (Pacheco et al.
2007) genes has been developed to identify C.
pseudotuberculosis isolates. The aim of the study was to
estimate the frequency of CLA in sheep and goat in
Duhok city and to compare with the results of bacterial
cultures, histopathology and molecular diagnosis of
suspected cases.
MATERIALS AND METHODS
Sample collection
From September to January 2019-2020, 1090 sheep
and goat carcasses in a Duhok abattoir were randomly
selected for inspection at slaughter house. The samples
were taken from the carcasses that had prominent
enlargement of the following lymph nodes:
submandibular, prescapular, prefemoral, or medistinal.
Enlarged abnormal lymph nodes were collected with a
sterile scalpel under aseptic conditions and placed in
individual sterile containers. The samples were
immediately transported in an ice box to the Duhok
Research Centre at College of Veterinary Medicine and
were processed for microbial isolation, histopathological
processing and for molecular study to identify causitve
agent(s).
Histopathology study
Suspected lymph nodes were inspected
macroscopically for size, colour, consistency of exudate
and presence of lamellate or onion ring morphology.
Samples for histopathological study were fixed in 10%
neutral buffered formalin (NBF). After 24-48 h the
formalin solution was changed then tissue processing was
performed manually and sectioning of the tissues was
done using a sliding microtome to get 4-5 micrometers
thick sections (Leica, Germany). Cut sections were
stained with hematoxylin and eosin (H&E) (Luna1968).
Isolation and identification of bacteria using
conventional method
C. pseudotuberculosis is the causative agent of CLA
in sheep and goats, for the isolation of the bacterium,
pus was collected aseptically to prevent contamination
from either surrounding environment or surface of lymph
node. Briefly, the surface of abscessed lymph nodes was
cleaned with 70% ethanol and incised with a sterile
disposable surgical blade. Cheesy substance or pus were
collected using sterile disposable swabs and cultured onto
5% blood agar (brain heart infusion agar containing 5%
sheep blood). The inoculated plates were incubated for
24–48 h at 37 °C. The plates were checked after 24 h for
growth. Standard microbiology methods were used for
primary identification and these methods included
cultural characteristics, haemolytic activity after 24 and
48h incubation. Colonies with typical morphology of
C. pseudotuberculosis were selected and streaked onto
blood agar plate. Those isolates were further confirmed
by using Gram staining and biochemical tests including
catalase, urease and CAMP (Christie, Atkins, Munch-
Peterson) tests with Staphylococcus aureus. Suspected
C. pseudotuberculosis isolates were then maintained in
50% (v/v) glycerol in brain heart infusion broth (BHIB)
(Dorella et al. 2006) and stored till further analysis
at -20 °C.
Molecular detection of C. pseudotuberculosis by
PCR
DNA extraction from suspected isolates
PCR was used to confirm the detection of suspected
C. pseudotuberculosis isolates. To extract DNA,
suspected isolates were culturedon 5% sheep blood agar
from glycerol stocks. The plates were incubated for 24 h
at 37 °C. Thermal lysis method as described by de Sá et
al. (2013) was used to extract DNA. Briefly 5 to 10
colonies were resuspended in 500 µl of TAE buffer and
mixed very well. Bacterial suspensions were kept in
heating block for 15 min. The suspension was cooled at
4 °C for 5 min then centrifuged at 14,000 x g for 2 min.
The supernatant was then used as the DNA template for
PCR. NanoDrop 2000C spectrophotometer (Thermo
Scientific, UK) was used to check DNA purity and
concentration. For further studies, DNA was stored
at -20 °C.
Primers and PCR conditions
Primers targeting the 16S rRNA, rpoB and pld genes
of C. pseudotuberculosis were considered from
previously published work (Çetinkaya et al. 2002, Khamis
et al. 2004, Pacheco et al. 2007). Oligonucleotide primers
Histopathological and molecular studies on caseous lymphadenitis...
136
Exploratory Animal and Medical Research, Vol.10, Issue 2, December, 2020
were synthesised by Macrogen (South Korea) and the
details are presented in Table1. The 16S rRNA, rpoB and
pld genes were amplified using ready-to-use master mixes
for PCR (Ruby Taq Master®, Jena Bioscience, Thuringia,
Germany). A total reaction volume of 25 µl was used.
Each reaction contains the following reagents: 12.5 µl of
master mix, 1 µl of each forward and reverse primer (10
pmol), 2.5 µl of template DNA and 8 µl dH2O. PCR
amplification was carried out in a Gene Amp PCR System
9700 Thermo Cycler.
The following PCR conditions (35 cycles) were used
for amplification of 16S rRNA, rpoB and pld: initial
denaturation at 94 °C for 3 min, denaturation at 94 °C for
1 min, annealing at 56°C for 1 min, extension at 72 °C
for 2 min and a final extension step at 72 °C for 7 min.
PCR products were kept cold at 4°C until they were
collected from the cycler. Amplified products were
confirmed and separated by 1% (w/v) agarose gel
electrophoresis made with TAE (1X) buffer stained with
Prime Safe Dye (GeNet Bio, Korea). The fragment sizes
were viewed under UV light.
RESULTS AND DISCUSSION
Macroscopical observation
C. pseudotuberculosis is the causative agent of CLA
in sheep and goats and causes economic loses in many
countries. The aim of this study was to determine the
infection rate of CLA in sheep and goats slaughtered at
Duhok slaughterhouse and to correlate with the results
of bacterial isolation with histophathological and
molecular detection. From 1090 examined sheep and
goats slaughtered at Duhok abattoir, 22 (2.1%) suspected
CLA cases of mediastinal lymph nodes were collected
from sheep and goats. Previously it has been reported
that the prevalence rate of CLA among sheep and goats
was variable and it was varied from country to county.
Similar infection rates including 2.2%, 2.31% and 2.55%
were recorded in Turkey, India and Iraq, receptively (Al-
Badrawi and Habasha 2016, Cetinkaya et al. 2002, Kumar
et al. 2013). However, the prevalence was reported to be
4.81% in Egypt (Mubarak et al.1999) and it has also been
shown to vary between 0.2% to 90.07% in different other
studies (Al-Gaabary and Osman 2009, Al-Gaabary et al.
2010).
There was variation in the size of infected lymph nodes.
Amongst all affecetd lymph nodes, mediastinal lymph
node revealed marked congestion and oedematous
changes. The present observations were in consonance
to other studies as reported previously in goats and sheep
affected with C. pseudotuberculosis (Sonawane et al.
2016, Singh et al. 2017). On careful examination
extensive abscessation of mediastinal lymph nodes was
prominent. The cut surface(s) of the mediastinal lymph
node exhibited greenish yellow, thick semi solid ?uid
mixed with pus arranged and trapped in concentrically
lamellate layers of fibrous connective tissue (Fig. 1).
Onion-like appearance was also found in some of the
affected lymph nodes. The presence of onion-like layering
of fibrous tissue was due to progressive stages of necrosis
and capsule formation within abscess which given its
pathogonomic lesion. (West and Bruere 2002). This
Primer name
16S-F
6S-R
C2700-F
C3130-R
pld-F
pld-R2
Sequence (5'—3´)
ACCGCACTTTAGTGTGTGTG
TCTCTACGCCGATCTTGTAT
CGTATGAACATCGGCCAGGT
TCCATTTCGCCGAAGCGCTG
ATAAGCGTAAGCAGGGAGCA
ATCAGCGGTGATTGTCTTCCAGG
Product size (bp)
815
446
203
Ref.
(Çetinkaya et al. 2002)
(Khamis et al. 2004)
(Pacheco et al. 2007)
Gene
16S rRNA
rpoB
pld
Table 1. Details of primer sequence used for detection of C. pseudotuberculosis.
Fig.1. Macroscopic appearance of affected lymph node from
sheep and goats showing lesion of abscess in the center (1)
and thick fibrous connective tissue as lamellate layer (2).
137
findings corroborated similarly to other studies (Ali et
al. 2016, Mahmood et al. 2015) who observed the
presence of similar lesion(s) following experimental
inoculation of C. pseudotuberculosis in goats.
Microscopical observation
Histopathological lesions of affected lymph node(s)
was characterized by the presence of central zone of
abscess surrounded by pyogenic membrane with severe
infiltration of polymorphonuclear and mononuclear
inflammatory cells and concentric zones of connective
tissue (Fig. 2A, B, C, D). In CLA the development of
chronic lesions with multiple abscesses formation and
lamellate layer are attributed to the ability of bacteria to
escape the immune system and its intention to spread to
many other organs. Virulence factor like phospholipaseD
and mycolic acid (Baird and Fontaine 2007) determines
its pathogenic ability, thus facilitates this organism to
evade strong immune response from hosts. These findings
were consistent to the previous reports (Sonawane et al.
2016, Singh et al. 2017) who stated the classical
presentation of the histopathological feature of the
pyogranulomatous in?ammation in lungs.
Isolation and identification using standard
microbiology methods
In addition to the post-mortem examination of infected
lymph nodes, conventional laboratory methods have also
been used for the diagnosis of suspected cases of CLA in
sheep and goats (Dorella et al. 2006, Guimarães et al.
2011). The causative agent was identified as C.
pseudotuberculosis based on colony characteristic after
Fig. 2. (A) Microscopic section of affected lymph node showing lesion of abscess (1), pyogenic membrane (2) with concentric
fibrous layers separated as fibrous connective tissue (3); (B) Microscopic section of affected lymph node showing
concentrically layer as onion appearance (1) and zone of pyogenic membrane (2) with infiltration of inflammatory cells
and necrotic area (3); (C) Microscopic section of lymph node abscess revealing central caseo-necrotic core (1) surrounded
by pyogenic membrane with infiltration of polymorphonuclear and mononuclear inflammatory cells (2) and fibrous
capsule (3); (D) Microscopic section of lymph node showing abscess as a caseous necrosis (1) surrounded by pyogenic
membrane with infiltration of polymorphonuclear and mononuclear inflammatory cells (2) (H & E 20X).
Histopathological and molecular studies on caseous lymphadenitis...
138
Exploratory Animal and Medical Research, Vol.10, Issue 2, December, 2020
24 to 48 h incubation, and also on the basis of
morphological characteristics by Gram staining. On sheep
blood agar small, dry and non-haemolytic white colonies
were observed (Fig. 3A) and the colonies turned cream-
colored colonies, with a narrow β-hemolysis zone, after
further 48h of incubation (Fig. 3B). Gram-positive
pleomorphic rods arranged as chinese letters were
observed in Gram stained smear (Fig. 3C). The
presumptive identification was confirmed by biochemical
features. The isolates were catalase positive and they were
able to hydrolyse urea. CAMP test showed inhibition of
β-hemolysis by Staphylococus aureusas shown in Fig.
3D. The results of this study revealed that all caseous
lymph nodes examined were found to be positive for C.
pseudotuberculosis. It has been showed previously that
the lymph nodes are the primary sites for replication of
C. pseudotuberculosis and it has been identified from
lymph nodes of sheep and goats (Çetinkaya et al. 2002,
Ilhan 2013, Guerrero et al. 2018). Furthermore,
C. pseudotuberculosis was isolated and identified in
lymph nodes of mice in another study by Firdaus Jesse et
al. (2013).
Molecular detection of C. pseudotuberculosis
The conventional bacteriological methods including
colony morphology, biochemical test are usually not
accurate due to the species variation within the genus
Corynebacterium (Dorella et al. 2006). Therefore, fast
and specific diagnostic tools are developed for early
diagnosis of C. pseudotuberculosis especially from cases
Fig. 3. Colony characteristics, Gram stained smear and CAMP test of C. pseudotuberculosis isolates from sheep and
goats.
A, non-hemolytic, dry and small white colonies after 24 h.B, narrow zone of â-hemolysis appeared 48 h incubation on %5
sheep blood agar. C, Gram-positive and club-shaped rods detected in stained smear with Gram stain. D, CAMP test of C.
pseudotuberculosis (right) with S. aureus (center) shows inhibition of the effect of the beta-haemolysin produced by S.
aureus.
139
of CLA by amplification of specific target genes including
16S rRNA, RNA polymerase β-subunit (rpoB) and
phospholipase D (pld) genes (Çetinkaya et al. 2002,
Khamis et al. 2004, Pacheco et al. 2007). In order to
confirm the identification of the 22 suspected isolates by
bacteriological methods, the isolates were further
analysed using PCR. Detection was confirmed by
amplification of the specific target genes of C.
pseudotuberculosis including 16S rRNA, rpoB and pld
respectively. All isolates were confirmed as C.
pseudotuberculosis based on PCR amplification of 16S
rRNA (815bp), rpoB (446 bp) and pld (203 bp) as shown
in Fig. 4. Similar findings have also been confirmed in
previous studies (Cetinkaya et al. 2002, Khamis et al.
2004, Hexian et al. 2018).
CONCLUSION
Molecular and histopathological studies together could
be used to identify C. pseudotuberculosis directly from
cases of CLA from sheep and goats. Further studies
including study of virulence genes and antimicrobial
susceptibility together phylogenetic analyses are
recommended to be done in the future for better
understand the epidemiology of this pathogen in Duhok
city.
ACKNOWLEDGEMENT
The authors would like to thank Collage of Veterinary
Medicine and Duhok Research Center (DRC) for
supplying facilities to carry out this research work.
Thanks to director of Duhok abattoir for providing
facilities to collect samples from animals.
REFERENCES
Al-Badrawi TYG, Habasha FG (2016) Bacteriological and
molecular studies of ovine caseous lymphadenitis in Iraq. J Agri
Vet Sci 9(5): 46-51.
Al-Gaabary MH, Osman SA, Ahmed MS, Oreiby AF (2010)
Abattoir survey on caseous lymphadenitis in sheep and goats
in Tanta, Egypt. Small Rum Res 94: 117-124.
Al-Gaabary MH, Osman SA, Oreiby AF (2009) Caseous
lymphadenitis in sheep and goats: clinical, epidemiological and
preventive studies. Small Rum Res 87: 116-121.
Ali AD, Mahmoud AA, Khadr AM, Elshemey TM,
Abdelrahman AH (2016) Corynebacterium pseudotuberculosis:
disease prevalence, lesion distribution, and diagnostic
comparison through microbiological culture and molecular
diagnosis. Alex J Vet Sci 51: 189-198.
Arsenault J, Girard C, Dubreuil P, Daignault D, Galarneau
JR et al. (2003) Prevalence of and carcass condemnation from
maedi–visna, paratuberculosis and caseous lymphadenitis in
culled sheep from Quebec, Canada. Preventive Vet Med 59:
67-81.
Baird GJ, Fontaine MC (2007) Corynebacterium
pseudotuberculosis and its role in ovine caseous lymphadenitis.
Comp Path 137: 179-210.
Çetinkaya B, Karahan M, Atil E, Kalin R, De Baere T et al.
(2002) Identification of Corynebacterium pseudotuberculosis
isolates from sheep and goats by PCR. Vet Microbiol 88 (1):
75-83.
Connor KM, Quirie MM, Baird G, Donachie W (2000)
Characterization of United Kingdom isolates of
Corynebacterium pseudotuberculosis using pulsed-field gel
electrophoresis. J Clin Microbiol 38(7): 2633-2637.
Connor K, Fontaine M, Rudge K, Baird G, Donachie W
(2007) Molecular genotyping of multinational ovine and caprine
Corynebacterium pseudotuberculosis isolates using pulsed-
field gel electrophoresis. Vet Rec 38(4): 613-623.
de Sá MCA, Gouveia GV, da Costa KC, Veschi JLA, de
Mattos-Guaraldi AL et al. (2013) Distribution of PLD and
FagA, B, C and D genes in Corynebacterium
pseudotuberculosis isolates from sheep and goats with caseus
lymphadenitis. Gen Mol Biol 36(2): 265-268.
Fig. 4. Molecular detection of C. pseudotuberculosis isolates
from sheep and goats.
1% agarose gel electrophoresis shows amplification of pld,
rpoB and 16S rRNA genes specific for C. pseudotuberculosis
from cases of CLA in sheep and goats. Lane 1: 100 bp DNA
marker, Lane 2-4: amplification of 203 bp fragment of pld,
Lane 5-7: amplification of 446 bp fragment of rpoB, lane 8-10
amplification of 815 bp fragment of 16S rRNA.
Histopathological and molecular studies on caseous lymphadenitis...
140
Exploratory Animal and Medical Research, Vol.10, Issue 2, December, 2020
Dorella FA, Pacheco LGC, Oliveira SC, Miyoshi A, Azevedo
V (2006) Corynebacterium pseudotuberculosis: microbiology,
biochemical properties, pathogenesis and molecular studies of
virulence. Vet Rec 37: 201-218.
Firdaus JF, Adamu L, Osman AY, Bin Muhdi AF, Haron AW
et al. (2013) Polymerase chain reaction detection of C.
pseudotuberculosis in the brain of mice following oral
inoculation. Inter J Ani Vet Advan 5(1): 29-33.
Guerrero JAV, de Oca Jiménez RM, Dibarrat JA, León FH,
Morales-Erasto V, Salazar HGM (2018) Isolation and molecular
characterization of Corynebacterium pseudotuberculosis from
sheep and goats in Mexico. Microbial Path 117: 304-309.
Guimarães AS, Carmo FB, do Pauletti RB, Seyffert N,
Ribeiro D et al. (2011) Caseous lymphadenitis: epidemiology,
diagnosis, and control. IIOAB Journal 2(2): 33-43.
Hexian L, Yang H, Zhou Z, Li X, Yi W et al. (2018) Isolation,
antibiotic resistance, virulence traits and phylogenetic analysis
of Corynebacterium pseudotuberculosis from goats in
southwestern China. Small Rum Res168: 69-75.
Ilhan Z (2013) Detection of Corynebacterium
pseudotuberculosis from sheep lymph nodes by PCR. Rev de
Med Vet 164(2): 60-66.
Khamis A, Raoult D, Scola BL (2004) rpoB gene sequencing
for identification of Corynebacterium species. J Clin Microbiol
42(9): 3925-3931.
Kumar J, Tripathi BN, Kumar R, Sonawane GG, Dixit SK
(2013) Rapid detection of Corynebacterium pseudotuberculosis
in clinical samples from sheep. Trop Anim Health Prod 45(6):
1429-1435.
Luna L (1968) Manual of histological staining methods of
the Armed Forces Institute of Pathology. 3rd edn. McGraw-Hill
Book Company, New York.
Mahmood ZKH, Jesse FF, Saharee AA, Jasni S, Yusoff R et
al. (2015) Clinicopathological changes in goats challenged with
Corynebacterium pseudotuberculosis and its exotoxin (PLD).
Am J Anim Vet Sci 10: 112-132.
Mubarak M, Bastawrows AF, Abdel-Hafeez MM, Ali MM
(1999) Caseous lymphadenitis of sheep and goats in Assiut
farms and abattoirs. Ass Vet Med J 42: 89-112.
Oliveira A, Teixeira P, Azevedo M, Jamal SB, Tiwari S et
al. (2016) Corynebacterium pseudotuberculosis may be under
anagenesis and biovar Equi forms biovar Ovis: a phylogenic
inference from sequence and structural analysis. BMC
Microbiol 16: 100.
Pacheco LGC, Pena RR, Castro TLP, Dorella FA, Bahia RC
et al. (2007) Multiplex PCR assay for identification of
Corynebacterium pseudotuberculosis from pure cultures and
for rapid detection of this pathogen in clinical samples. J Med
Microbiol 56(4): 480-486.
Parin U, Kirkan S, Ural K, Savasan S, Erbas G et al. (2018)
Molecular identification of Corynebacterium
pseudotuberculosis in sheep caseous lymphadenitis (CL) is a
bacterial disease that causes considerable economic loss in
sheep and goat industries. Acta Vet Brno 87: 03-08.
Singh R, Kumar P, Sahoo M, Bind RB, Kumar MA et al.
(2017) Spontaneously occurring lung lesions in sheep and goats.
Indian J Vet Path 4: 18-24.
Sonawane GG, Kumar J, Sisodia SL (2016) Etio-pathological
study of multiple hepatic abscesses in a goat. Indian J Vet Path
40(3): 257.
Umer M, Abba Y, Firdaus JFA, Monther MSW, Umer M et
al. (2017) Caseous lymphadenitis in small ruminants. Int J Vet
Sci Ani Hus 2: 23-31.
West DM, Bruere AN, Ridler AL (2002) Caseous
lymphadenitis, In: The sheep: health, disease and production
2nd edn. Palmerston North: Foundation for continuing education.
274-279.
*Cite this article as: Rezheen FA, Abdullah MA, Kareem KH, Najeeb ZD, Hameed HM (2020) Histopathological
and molecular studies on caseous lymphadenitis in sheep and goats in Duhok city, Iraq. Explor Anim Med Res 10(2):
134-140.
