Content uploaded by Rashidul Haque
Author content
All content in this area was uploaded by Rashidul Haque on Jun 13, 2016
Content may be subject to copyright.
Available via license: CC BY 4.0
Content may be subject to copyright.
RESEARCH ARTICLE
Natural History of Cryptosporidiosis in a
Longitudinal Study of Slum-Dwelling
Bangladeshi Children: Association with
Severe Malnutrition
Poonum S. Korpe
1
*, Rashidul Haque
2
, Carol Gilchrist
3
, Cristian Valencia
1
, Feiyang Niu
4
,
Miao Lu
4
, Jennie Z. Ma
5
, Sarah E. Petri
6
, Daniel Reichman
7
, Mamun Kabir
2
, Priya Duggal
1
,
William A. Petri, Jr.
3
1Department of Epidemiology, Johns Hopkins School of Public Health, Baltimore, Maryland, United States
of America, 2International Centre for Diarrhoeal Disease Research, Bangladesh, Dhaka, Bangladesh,
3Department of Medicine, Division of Infectious Diseases, University of Virginia, Charlottesville, Virginia,
United States of America, 4Department of Statistics, University of Virginia, Charlottesville, Virginia, United
States of America, 5Division of Biostatistics, Department of Public Health Sciences, University of Virginia,
Charlottesville, Virginia, United States of America, 6Department of Animal and Veterinary Sciences,
Cummings School of Veterinary Medicine, Tufts University, North Grafton, Massachusetts, United States of
America, 7Emory University School of Medicine, Atlanta, Georgia, United States of America
*pkorpe1@jhu.edu
Abstract
Background
Cryptosporidiosis is a common cause of infectious diarrhea in young children worldwide,
and is a significant contributor to under-five mortality. Current treatment options are limited
in young children. In this study, we describe the natural history of Cryptosporidium spp.
infection in a birth cohort of children in Bangladesh and evaluate for association with
malnutrition.
Methodology/Principal Findings
This is a longitudinal birth cohort study of 392 slum-dwelling Bangladeshi children followed
over the first two years of life from 2008 to 2014. Children were monitored for diarrheal dis-
ease, and stool was tested for intestinal protozoa. Anthropometric measurements were
taken at 3-month intervals. A subset of Cryptosporidium positive stools were genotyped for
species and revealed that C.hominis was isolated from over 90% of samples. In the first
two years of life, 77% of children experienced at least one infection with Cryptosporidium
spp. Non-diarrheal infection (67%) was more common than diarrheal infection (6.3%)
although 27% of children had both types of infection. Extreme poverty was associated with
higher rates of infection (chi-square, 49.7% vs 33.3%, p= 0.006). Malnutrition was common
in this cohort, 56% of children had stunted growth by age two. Children with Cryptosporid-
ium spp. infection had a greater than 2-fold increased risk of severe stunting at age two
compared to uninfected children (odds ratio 2.69, 95% CI 1.17, 6.15, p= 0.019)
PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0004564 May 4, 2016 1 / 15
a11111
OPEN ACCESS
Citation: Korpe PS, Haque R, Gilchrist C, Valencia
C, Niu F, Lu M, et al. (2016) Natural History of
Cryptosporidiosis in a Longitudinal Study of Slum-
Dwelling Bangladeshi Children: Association with
Severe Malnutrition. PLoS Negl Trop Dis 10(5):
e0004564. doi:10.1371/journal.pntd.0004564
Editor: Gagandeep Kang, Christian Medical College,
INDIA
Received: August 8, 2015
Accepted: March 1, 2016
Published: May 4, 2016
Copyright: © 2016 Korpe et al. This is an open
access article distributed under the terms of the
Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are
credited.
Data Availability Statement: The data used for
analyses in this manuscript are derived from a clinical
study and are de-identified but sharing of the
individual-level data with an external bona fide third
party investigator will require the investigator to sign a
data use agreement per local IRB and Bangladesh
Ethics Board regulations (Section 3, PLoSPolicies).
Investigators making such requests will be required to
adhere to the data use agreement and to preserve
participant confidentiality. The investigator is not
permitted to share data with any other person or
investigator without explicit prior approval. Data
independent of sex, income, maternal body-mass index, maternal education and weight for
age adjusted z(WAZ) score at birth.
Conclusions/Significance
Cryptosporidium infection is common (77%) in this cohort of slum-dwelling Bangladeshi
children, and both non-diarrheal and diarrheal infections are significantly associated with a
child’s growth at 2 years of age.
Author Summary
Diarrheal disease is a leading cause of death in young children worldwide. Cryptosporid-
ium species are responsible for a large proportion of global burden of diarrhea. This study
describes the natural history of cryptosporidiosis in a birth cohort of impoverished Bangla-
deshi children. Children were enrolled at birth and monitored for diarrhea twice a week
for two years. Stool samples were tested for enteric protozoa. Children in this cohort had
significant rates of malnutrition compared to the W.H.O. reference population, and
extreme poverty was common. A majority of children were infected with Cryptosporidium
spp, and we found that children who had at least one infection with Cryptosporidium spp
during the two year follow up period were significantly more likely to have growth falter-
ing by age 24 months. Cryptosporidiosis is a common infection in this cohort, and is asso-
ciated with poverty and reduced growth during the first two years of life.
Introduction
Diarrheal disease is the second leading cause of death in children under age five worldwide,
with cryptosporidiosis estimated to be second only to rotavirus as the leading cause of moder-
ate-to-severe diarrhea [1–3]. Cryptosporidium spp. are enteric protozoa, with 26 described spe-
cies, but C.hominis and C.parvum most commonly infect humans [4,5]. Infection is
characterized by profuse, watery diarrhea. Disease is self-limited in immune-competent adults,
but can be associated with fulminant disease in immunocompromised patients and young chil-
dren. Cryptosporidium infection has been associated with longer duration of diarrhea and 2–3
times higher mortality in young children [6,7].
Risk factors for cryptosporidiosis relate to the host, environment, and the species of the par-
asite. Immune-compromised adults, including those with HIV/AIDS or on immunosuppres-
sive drugs, are at increased risk [8–10]. Young children, especially those with malnutrition, are
more vulnerable, presumably due to lack of acquired immunity, however the biological mecha-
nism is not clear [11–16]. In a child cohort in Bangladesh, almost 40% of children were infected
with Cryptosporidium in the first year of life [15]. Breastfeeding and breast milk IgA have been
identified as protective factors [15–17]. Host genetic susceptibility is also implicated as Crypto-
sporidium infection has been associated with HLA class II alleles and polymorphisms in the
mannose binding lectin gene [18–19].
Environmental risk factors can be species specific, and include prolonged contact with
domestic animals [20–22], overcrowded living conditions [23–26] and household contact with
young children [12,22,27]. Sporadic epidemics have been reported in relation to contaminated
water sources [28]. Livestock serve as an environmental reservoir for C.parvum, and transmis-
sion has been reported after direct contact with animals or drinking water contaminated by
Cryptosporidium Infection and Malnutrition in Bangladeshi Children
PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0004564 May 4, 2016 2 / 15
agreements can be guaranteed for any qualified
researcher upon reasonable request. Please contact
Dr. Uma Nayak to obtain permission to access data
(Center for Public Health Genomics, University of
Virginia Phone: 434-982-3749, email:
un8x@eservices.virginia.edu).
Funding: This work was funded by: 1) National
Institutes of Health, Allergy and Infectious Disease
K23AI108790-0. PI: PSK. http://www.niaid.nih.gov/
Pages/default.aspx; 2) National Institutes of Health,
Allergy and Infectious Disease AI043596-16. PI: WAP
http://www.niaid.nih.gov/Pages/default.aspx; and 3)
The Sherrilyn and Ken Fisher Center for
Environmental Infectious Diseases Discovery
Program. PI: PD. http://www.hopkinsmedicine.org/
Medicine/id/funding_our_future/fisher_fund.html. The
funders had no role in the study design, data
collection and data analysis, decision to publish, or
preparation of the manuscript.
Competing Interests: The authors have declared
that no competing interests exist.
human or animal waste [20]. In contrast, humans are the only major reservoir for C.hominis,
and transmission is related to person-to-person contact, thus urban settings and overcrowding
have been associated with C.hominis [29]. In contrast to other enteric diseases, household
income has not been reported to be a protective factor, and in one study was even associated
with increased risk of infection [29,30]. Malnutrition has been identified as a risk factor for
infection, and may potentiate adverse impact from infection [14]. Furthermore, studies from
Brazil and Peru have noted short-term growth faltering after infection [31,32]. The relationship
between cryptosporidiosis and malnutrition is complex and poorly understood.
In this study we describe the natural history of cryptosporidiosis in a peri-urban slum com-
munity near Dhaka, Bangladesh, over the first two years of life, a critical period for childhood
growth and development [33]. Additionally, we identify risk factors in an endemic region,
describe genetic diversity of the parasite, and test for contribution of infection on growth falter-
ing in this population.
Methods
The subjects studied were part of a community-based prospective cohort study of enteric infec-
tions in infants from a peri-urban slum of Mirpur, near Dhaka, Bangladesh from 2008 to 2014
[14,15]. Infants were enrolled at birth and actively monitored in their homes for diarrheal dis-
ease by twice-weekly visits of trained field research assistants. Study size was determined by
estimates of diarrheal disease in this region and an estimated 10% annual loss to follow up [14].
Data on the subjects’clinical symptoms were collected by interview of mothers. Diarrhea was
defined as greater than three loose stools per day as reported by the mother.
Anthropometric measurements, consisting of length and weight, were taken once every
three months. Each child was weighed on an electronic scale (Digital Baby & Toddler Scales,
Seca 354). The length of the children was measured to the nearest centimeter (Infantometer
Baby Board, Seca 416). Nutritional status was assessed by comparing weight and height with
the weight and height of the World Health Organization (W.H.O.) reference population of the
same age and sex, using W.H.O. Anthro software, version 3.0.1 [14].
Surveillance stool samples were collected from each subject once a month. Additionally,
when diarrhea was reported by the mother, a diarrheal stool sample was collected. Both diar-
rheal and monthly stool samples were tested for Cryptosporidium species by real-time polymer-
ase chain reaction. Cryptosporidium spp. infection was quantitated by qPCR, threshold cycle
(C
t
). A Cryptosporidium diarrheal infection was defined by a child having a diarrheal stool pos-
itive with a negative preceding surveillance stool, and a Cryptosporidium asymptomatic or
non-diarrheal infection was defined by a child having a surveillance stool test positive.
Laboratory methods
All stool samples were tested for Cryptosporidium species by real-time polymerase chain
reaction.
DNA Extraction was performed by a modified QiaAmp stool DNA extraction protocol
which incorporates a three-minute bead-beating step to lyse Cryptosporidium oocysts (Qiagen,
Valencia, CA) [34]. Cryptosporidium positive samples were detected using an assay previously
described by our group that targets the Cryptosporidium Oocyst Wall Protein (COWP) [35].
COWP positive samples were further genotyped by the polymorphic region within the gp60
gene using primers and conditions previously described [36,37] but with the modification that
the amplifications were done using the MyFi (Bioline, Taunton, MA) with an activation 94°C
for 5 min followed by 40 cycles in the primary PCR (94°C, 30 sec; 45°C, 55 sec; 72°C, 60 sec)
Cryptosporidium Infection and Malnutrition in Bangladeshi Children
PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0004564 May 4, 2016 3 / 15
with a final extension of 10min at 72°C. In the secondary PCR the cycling conditions [35] were
(94°C, 30 sec; 55°C, 30 sec; 72°C, 30 sec) with a final extension of 10 min at 72°C.
Phusion high fidelity polymerase (ThermoFisher Scientific Inc, Waltham, MA) was used in
a final PCR to add sequencing primer binding sites [38]. As necessary for the Phusion enzyme
the activation step was at 98°C, 20 sec was followed by 34 cycles (98°C, 10 sec; 60°C, 20 sec;
72°C, 20 sec) with a final extension of 10min at 72°C. The QIAquick PCR purification kit was
then used as per manufacturer’s instructions (Qiagen, Valencia, CA) to purify the amplicon.
This was then sequenced by a contract research organization (GENEWIZ, South Plainfield,
NJ) using standard protocols and the sequencing primers IS5 (AATGATACGGCGACCACCG
A) or IS6 (CAAGCAGAAGACGGCATACGA).
The resulting sequences were then trimmed and aligned to the gp60 reference sequence
(Genbank Accession Numbers HQ631408, AY738187, AY738192, AY738184 and AF440638)
using the Geneious Program (R7) (Biomatters, NZ). Consensus phylogeny was inferred from
500 bootstrap replicates to build a neighbor-joining consenus tree, and based on the Tamura-
Nei model, the Nearest Neighbor method and the Geneious Program (R7). Branches that pro-
duced in fewer than 50% of the bootstrap phylogenies were collapsed.
Statistical analysis
Differences in demographic factors between infected and uninfected children were assessed
using two-sample t-test and chi-square according to exposure status (no Cryptosporidium
infection, any type of Cryptosporidium infection, diarrheal Cryptosporidium infection, and
exclusively non-diarrheal Cryptosporidium infection). Family monthly income (expressed in
Bangladeshi Taka or BDT) below 6000 BDT/month was defined as “extreme poverty”based on
the World Bank’s definition of less than 1.25 international dollars per person per day [39].
Anthropometric measures (height-for-age adjusted z-score or HAZ; weight-for-age adjusted z-
score or WAZ; weight-for-height adjusted z-score or WHZ) were evaluated both as continuous
and categorical variables. HAZ score at 24 months was used as the outcome in the final analy-
ses evaluating nutrition, as HAZ is most representative of chronic malnutrition [40]. For all
analyses evaluating malnutrition, we excluded children who fell into the bottom 2.3% of HAZ
scores at birth (HAZ <-3.49), per WHO Global Database on Child Growth and Malnutrition
guidelines [40]. Based on our cohort’s distribution of anthropometric indices, we classified
children into four categories: 1) HAZ >-1; HAZ <= -1 and >-2 (mild stunting); HAZ <=-2
and >-3 (moderate stunting); and HAZ <= -3 (severe stunting).
To determine the time to first diarrheal and time to first asymptomatic Cryptosporidium
infection, we performed Kaplan Meier survival analysis separately. All children who completed
24 months in the study were included, and those children without a Cryptosporidium infection
within the first 24 months were censored at this time point. The probability of growth
impairment at 24 months of age was evaluated using univariate and multivariable logistic
regression with the categorized HAZ at 24 months as a polynomial response. Potential con-
founding variables including sex, family income, maternal body-mass index, maternal educa-
tion, and WAZ at birth were adjusted in the multivariable analysis. Statistical significance was
considered if p<0.05. Analyses were performed in Stata v.10 (Statacorp, USA). Comparison of
Cryptosporidium quantitation in stool (threshold cycle) to severity of clinical infection was per-
formed using the Kruskal Wallis test.
Ethics statement
The study was approved by the Institutional Review Board of the University of Virginia and
the Research and Ethical Review Committees of the International Centre for Diarrhoeal
Cryptosporidium Infection and Malnutrition in Bangladeshi Children
PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0004564 May 4, 2016 4 / 15
Disease Research, Bangladesh (icddr,b). Informed written consent was obtained from parents
or guardians for the participation of their child in the study.
Results
From 2008 to 2014, we followed 392 children from birth to 24 months of age. In this cohort,
fifty-five percent of children were male. The median number of family members per household
was 5, with range from 2 to 18. During the follow up period, there were 990 episodes of diar-
rhea in the first year of life (2.5 episodes of diarrhea/child), and 763 episodes in the second year
of life (1.9 episodes of diarrhea/child). Over this time, 1712 diarrheal stools and 9231 surveil-
lance stools were collected. In year one, 5.6% of all diarrheal episodes were positive for Crypto-
sporidium spp. and in year two 9.0% of diarrheal episodes were Cryptosporidium spp. positive
(Fig 1). Mean age of onset for Cryptosporidium diarrhea was significantly greater than non-
Cryptosporidium diarrhea (T-test, 13.9 months vs 11.3 months, p<0.001). Forty-six percent of
households were considered to be of “extreme poverty,”which is a higher rate than the Bangla-
desh national average of 31.5% [39]. Comparison of demographic factors between the 392 chil-
dren who completed follow up with 237 children who were lost to follow up revealed no
significant difference in gender (55% male vs 49%, chi square, p = 0.144), mean HAZ at birth
(-0.96 sd 1.16 vs -0.9 sd 1.03, t-test, p = 0.513), and mean family income (6789.7 BDT sd
3049.0 vs 7092.4 BDT sd 4140, ttest, p= 0.294).
By the end of the follow up period, 302 children (77.0%) experienced at least one infection
associated with Cryptosporidium spp and of these, 100 (25.5%) children had at least one diar-
rheal infection and 283 (72.2%) children had at least one asymptomatic or non-diarrheal infec-
tion. A majority of Cryptosporidium detections were from non-diarrheal stools (Fig 2).
Cryptosporidium spp. infection was associated with a higher parasite burden in diarrheal dis-
ease, as Cryptosporidium positive diarrheal samples had lower CT values (median 33.35, inter-
quartile range 6.8) than positive surveillance samples (median 35.50, interquartile range 5.6),
(Kruskal Wallis, chi-square, p<0.0001). Of the 302 children with cryptosporidiosis during the
two year follow up, 102 children had a second infection, 13 children had a third infection, and
3 children had 4 total episodes of cryptosporidiosis. There was no evidence of a decreasing par-
asite burden with repeated infection, as measured by threshold cycle (Wilcoxon test, paired
between median C
t
value of first vs second infection, 33.70 (IQR 6.6) vs 34.50 (IQR 7.2),
p= 0.96; paired between median C
t
value of second vs third infection, 34.50 (IQR 7.2) vs 35.40
(IQR 4.3) p= 0.62).
Risk factors for Cryptosporidium infection
Table 1 summarizes demographic characteristics of children who became infected with Crypto-
sporidium spp. during the first 24 months of life. A higher proportion of Cryptosporidium-
infected children came from extreme poverty (monthly income <6000 BDT/month) (chi-
square p = 0.006). We found no association between increased risk of Cryptosporidium infec-
tion and HAZ at birth (p= 0.89), presence of an animal in the house (chi-square,p= 0.57), or
family size (chi-square,p= 0.44).
Nutritional measures
Seventeen percent of children (68/392) met W.H.O. guidelines for moderate stunting (height-
for-age adjusted z-score less than -2) at birth. By age two, 29.6%, 35.7%, and 21.1% of children
met W.H.O. criteria for mild, moderate, and severe stunting, respectively. Over the first two
years of life, the mean height-for-age adjusted z-score in this cohort fell consistently below the
Cryptosporidium Infection and Malnutrition in Bangladeshi Children
PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0004564 May 4, 2016 5 / 15
W.H.O. reference population. Fig 3 shows the steady decline in HAZ from birth to 24 months
of age.
Survival analysis for diarrheal and non-diarrheal infection
Fifty-percent of children had at least one non-diarrheal Cryptosporidium infection by 16
months of age, and 25% of children had a symptomatic infection by 2 years of age. The hazard
ratio of an asymptomatic infection did not differ by sex (HR = 1.12, 95% CI 0.89. 1.42, p-
value = 0.315) but was decreased for individuals with higher family income (HR = 0.74, 95% CI
Fig 1. Total number of diarrheal episodes per month. The x-axis represents the child’s age in months, and the y-axis represents total number of diarrheal
episodes per age-month. The dark blue segment represents number of total diarrheal episodes, and the light blue segment represents the proportion of
diarrheal episodes per month that test positive for Cryptosporidium species. In each month, the total possible number of children included is 392.
Cryptosporidium infection makes up a very small portion of the total burden of diarrhea in our cohort.
doi:10.1371/journal.pntd.0004564.g001
Cryptosporidium Infection and Malnutrition in Bangladeshi Children
PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0004564 May 4, 2016 6 / 15
0.58, 0.93, p-value = 0.011). The hazard ratio remained consistent for the symptomatic diar-
rheal infections.
There was no significant difference in time to first asymptomatic or diarrheal infection
(Fig 4). However, children who had both diarrheal and asymptomatic infections during the
24-month follow up period were infected at an earlier age (HR = 1.74, 95% CI 1.34, 2.27,
p-value <0.0001).
Cryptosporidium genotypic diversity
A subset of diarrheal and surveillance stool samples (n = 238) testing positive for Cryptosporid-
ium spp. were further typed by gp-60. C.hominis was the sole Cryptosporidium species in 92.4%
of samples (n = 220) and C.parvum was the sole species identified in 3.4% (n = 8). In only five
Fig 2. Total number of children with Cryptosporidium infection per month. The x-axis represents age of the child in months, and the y-axis represents
total number of infected children per age-month. The solid-segment represents number of children with asymptomatic Cryptosporidium infection, and the
lined-segment represents number of children with diarrhea from Cryptosporidium infection. In each month, the total possible number of children included is
392. A child who had both a diarrheal and asymptomatic stool positive in the same month was counted as having Cryptosporidium diarrhea. This figure
demonstrates peaks of diarrheal Cryptosporidium infection at 10 and 17 months of age, and peaks of asymptomatic infection at 10–13 and 17 months of age.
doi:10.1371/journal.pntd.0004564.g002
Cryptosporidium Infection and Malnutrition in Bangladeshi Children
PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0004564 May 4, 2016 7 / 15
cases did we observe a mixed infection of C.hominis and C.parvum.C.hominis positive sam-
ples were further subtyped and the distribution of gp 60 alleles found in our study population
was 1a (17.3%); 1b (21.4%); 1d (13.9%); 1e (40.5%); 1f (7.0%). Of these sequences, one hundred
and one samples were of sufficient quality to subtype by multiple sequence alignment with
GenBank reference sequences and phylogenetic analysis (Fig 5). In contrast to other molecular
epidemiologic studies there was no gp60 subtype diversity within our population (Ia, A14R1;
Ib, A9G3R2; Id, A15G1; Ie, A11G3T3; If, A13G1) (32).
Risk factors for growth faltering at 24 months
Using logistic regression, we observed that children with linear growth faltering at 24 months
had a greater than 2-fold increased odds of experiencing any type of Cryptosporidium spp.
infection during the first two years of life compared to non-stunted children (Table 2). The
associated risk of Cryptosporidium spp. infection increased with the severity of stunting, and
children with severe stunting at 24 months had a 2.69 times increased odds of Cryptosporidium
infection (Table 2). The association of stunting and linear growth faltering at 24 months was
present for both non-diarrheal “asymptomatic”and symptomatic Cryptosporidium spp. infec-
tions (Table 2). Stunting was associated with increased odds of infection even after adjusting
for income, gender, maternal BMI, maternal education, days of exclusive breastfeeding, and
nutritional status at birth. When we considered HAZ at 24 months as a linear variable, the
association with Cryptosporidium was further supported in an adjusted model (linear
Table 1. Comparison of demographics of 392 children who completed two years of follow up.
No Cryptosporidium infection (n = 90)
a
Any
Cryptosporidium
infection (n = 302
a
Diarrheal
Cryptosporidium
infection (n = 100)
a
Non-
diarrhealCryptosporidium
infection (n = 202)
a
p
b
p
b
p
b
Male % 57 55 0.78 59 0.75 53 0.56
Income <6000 BDT % 33 50 0.006 52 0.009 48.5 0.016
Animal % 6 7 0.57 7 0.68 7 0.56
No Maternal education 63 62 0.85 59 0.54 64 0.93
Mean WAZ at birth -1.38 -1.41 0.83 -1.45 0.64 -1.39 0.96
Mean HAZ at birth +/- 0.99 +/- 0.97 +/- 0.95 +/- 0.99
-0.94 -0.96 0.89 -1.02 0.60 -0.93 0.95
Mean Maternal BMI +/- 1.15 +/- 1.16 +/- 1.00 +/- 1.23
21.7 21.2 0.21 21.4 0.52 21.2 0.150
Exclusive breast feeding days +/-3.5 +/-3.2 +/-3.46 +/- 3.0
130.5 119.2 0.16 118.0 0.22 119.8 0.20
Family size >5% +/- 70.3 +/- 65.9 +- 70.5 +/- 63.7
42 38 0.44 37 0.86 36 0.32
a
Children having at least one Cryptosporidium infection (either in diarrheal or surveillance stool) over the first 24 months of life were included in the “Any
Cryptosporidium infection”group, and all others were included in the “No Cryptosporidium infection”group. Cryptosporidium positive children were further
divided into “Diarrheal Cryptosporidium infection”, which included all children who ever had a single diarrheal stool test positive for Cryptosporidium, and
“Non-diarrheal Cryptosporidium infection”which included only children who had surveillance stools positive (children with both Cryptosporidium positive
diarrhea and asymptomatic stools were excluded from this category). Each Cryptosporidium infection group was compared to the “No Cryptosporidium
infection”group.
b
Chi-square or two-sample t-test
doi:10.1371/journal.pntd.0004564.t001
Cryptosporidium Infection and Malnutrition in Bangladeshi Children
PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0004564 May 4, 2016 8 / 15
regression, b= -0.33, 95% CI -0.57, -0.08, p= 0.0009). Furthermore, there was additive impact
of each additional infection on HAZ at 24 months (linear regression, b= -0.18, 95% CI -0.24,
-0.026, p= 0.02).
Among Cryptosporidium spp. infected children, the mean 24-month HAZ was significantly
lower in children from households with lower monthly income (t-test, p= 0.0053). Among
those from higher income households, Cryptosporidium spp. infected children had lower
24-month HAZ scores compared to uninfected children (t-test, p= 0.016). Additionally, there
was no association between number of diarrheal episodes over the first 24 months of life and
24-month HAZ score (S1 Table).
Discussion
In an urban slum in Bangladesh, we followed 392 children from birth to age two years of life.
In this cohort, extreme poverty and malnutrition were common, affecting almost half of all
Fig 3. Box plot of mean height-for-age adjusted z-scores over first 24 months of life. In this cohort of 392 children, mean HAZ dropped continuously
over the first two years of life, which was also consistently well below the W.H.O. reference population mean (indicated by red line).
doi:10.1371/journal.pntd.0004564.g003
Cryptosporidium Infection and Malnutrition in Bangladeshi Children
PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0004564 May 4, 2016 9 / 15
households and half of enrolled children. Fifty-six percent of children met W.H.O criteria for
moderate stunting at age two, which is higher than the reported rate of under-five stunting
across South Asia (40.7%) [40]. Cryptosporidium spp. infection affected 77% of children in
this cohort. Interestingly, we identified a larger number of asymptomatic infections than diar-
rheal infections. Potentially, this is due to consistent monthly surveillance sample collection
and use of qPCR for diagnosis, rather than microscopy or antigen detection. In a birth cohort
in India, Sarkar et al also reported a higher rate of asymptomatic than diarrheal Cryptosporid-
ium infection [12].
In the current study, poverty was associated with Cryptosporidium infection, with children
in households with more income less likely to have cryptosporidiosis. Based on gp-60 genotyp-
ing, we identified a predominance of C.hominis isolates in this cohort, which is consistent with
other reports from the South Asian subcontinent [41–44]. Previously described risk factors for
cryptosporidiosis in children include close contact with domesticated animals [20–22],
crowded living conditions [12,25,26], and malnutrition [12,14]. We did not find the same asso-
ciation between domesticated animals and infection, likely because C.hominis predominated
in our study population, and spread is anthroponotic. Additionally, we hypothesize that lower
household income is related to overcrowding, and overcrowding is associated specifically with
C.hominis infection [22]. Our study was not able to measure level of overcrowding in house-
holds, but median household size was 5, with a range of 2 to 18 persons per home, and this fig-
ure was not significantly different between groups. We did evaluate malnutrition and
subsequent Cryptosporidium infection, however, there was no significant association. This was
likely due to our study design that enrolled children from birth. We excluded children with
extreme stunting at birth, as we were interested in controlling for peri-natal factors that may
have led to stunting at birth and not potential maternal or prenatal factors. In non-birth cohort
Fig 4. Kaplan Meier curve of the 302 children infected with Cryptosporidium spp. categorized by type
of infection experienced (diarrheal, non-diarrheal, or both). There was no significant difference between
timing of first asymptomatic versus symptomatic Cryptosporidium infection (HR 0.68, 95% CI 0.42, 1.09,
p= 0.11). However, children who went on to develop both symptomatic and asymptomatic infection did get
infected earlier in life (HR = 1.74, 95% CI 1.34, 2.27, p<0.0001).
doi:10.1371/journal.pntd.0004564.g004
Cryptosporidium Infection and Malnutrition in Bangladeshi Children
PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0004564 May 4, 2016 10 / 15
Fig 5. Phylogenetic Relationship of 101 Cryptosporidium parasites isolated in Bangladesh to each other (open circle) and to the reference
sequences (closed circle) gp60Ia (HQ631408), gp60Ib (AY738187), gp60Id (AY738192), gp60Ie (AY738184), gp60If (AF440638). Neighbor-Joining
consensus tree was drawn using the Geneious program (R7). Any apparent diversity is due to ambiguous bases.
doi:10.1371/journal.pntd.0004564.g005
Table 2. Adjusted odds ratio for Cryptosporidium infection among stunted 2-year old children. Polyto-
mous logistic regression was used to assess for risk of Cryptosporidium infection by level of linear growth fal-
tering at 24 months. Children were categorized by HAZ at 24 months: mild stunting HAZ <= -1 and >-2
(n = 111); moderate stunting HAZ <= -2 and >-3 (n = 131); severe stunting HAZ <= -3 (n = 72). Each group
was tested against children with HAZ >-1 at 24 months (n = 51). Children with extreme stunting at birth (HAZ
<-3.49) were excluded (n = 10). Confounding variables were included in the model.
Stunting at 24 months of age Any
Cryptosporidium
infection (n = 302)
Diarrheal
Cryptosporidium
infection (n = 100)
Non-diarrheal
Cryptosporidium
infection (n = 202)
Odds ratio
(95% CI)
pOdds ratio
(95% CI)
pOdds ratio
(95% CI)
p
Severely Stunted HAZ -3
(n = 72)
2.69 (1.17,
6.15)
0.019 2.52 (0.91,
7.03)
0.076 2.78(1.15,
6.72)
0.023
Moderately Stunted HAZ -2 to
>-3 (n = 131)
2.52 (1.23,
5.15)
0.011 2.76 (1.13,
6.76)
0.026 2.38 (1.10,
5.17
0.027
Mildly Stunted HAZ -1 to >-2
(n = 111)
2.27 (1.09,
4.71)
0.028 2.03 (0.80,
5.13)
0.135 2.39 (1.10,
5.26)
0.029
doi:10.1371/journal.pntd.0004564.t002
Cryptosporidium Infection and Malnutrition in Bangladeshi Children
PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0004564 May 4, 2016 11 / 15
designed studies it would be difficult to differentiate between children stunted at birth and
those who developed stunting perinatally.
One of the most significant findings of this study was the predisposition towards linear
growth faltering that occurred in Cryptosporidium spp infected children. While malnutrition at
birth did not predispose to Cryptosporidium spp infection, children who had at least one Cryp-
tosporidium spp infection in the first two years of life had significantly worse nutritional status
at 24 months, independent of income and maternal factors, suggesting that Cryptosporidium
spp infection is associated with downstream growth faltering. Notably, both diarrheal and non-
diarrheal infections were associated with subsequent stunting. This is supported by prior stud-
ies from Peru that have shown that children with asymptomatic and symptomatic Cryptospo-
ridium spp infection had less weight gain in the first month of infection [32], but in contrast to
the Peruvian studies, we found that children infected by Cryptosporidium even after 6 months
of age, do not have “catch up growth”and once infected, are on a trajectory to growth stunting
[45].
Our findings suggest that even a single Cryptosporidium spp infection at any point in the
first two years of life, whether diarrheal or non-diarrheal, can be detrimental to a child’s physi-
cal development, resulting in impaired growth at age two. Therefore, we propose that malnutri-
tion, rather than diarrhea, should be considered the most important outcome of
Cryptosporidium spp infection in children. We have shown that non-diarrheal Cryptosporidium
spp infection is widely prevalent in this cohort. The mechanism between non-diarrheal infec-
tion and malnutrition requires further study. Cryptosporidium infection has been associated
with increased inflammation of the gut and loss of villus architecture [46] and murine models
suggest that immune signaling in the gut may be disrupted resulting in enteropathy and poor
growth [47].
Our study is limited in that we did not assess for multiple enteric pathogens. However, the
aim of our study was to describe the total burden of Cryptosporidium infection in this cohort,
rather than ascribe etiologies of diarrhea. Previous studies in this area have found that children
may carry four or more pathogens in any given stool specimen [48]. It is possible that the pres-
ence of other enteric infections, or even other disease processes that were not evaluated in this
study (e.g. acute respiratory infections) contribute to stunting. However, in this study we did
not find a relationship between total burden of diarrhea and HAZ at 24 months. Therefore, we
would argue that it is the presence of enteric infection, rather than the phenotype of diarrhea,
that is contributing to stunting.
Based on our findings, future studies of cryptosporidiosis should aim to further study geno-
typic differences. We have demonstrated that in our cohort with C.hominis predominance,
risk factors for infection are significantly different than in other populations with potentially
different species. This may also impact means of transmission of infection. And beyond the
species level, there may be additional clinical and immunologic differences between different
subtypes of C.hominis that have not yet been described. Further studies of Cryptosporidium
spp. genotyping will be important for informing strategies for prevention and treatment.
We have demonstrated that poverty, malnutrition, and Cryptosporidium spp. infection
remain intricately connected. Worldwide, an estimated 178 million children under 5 suffer
from stunted growth [40] and stunted growth in the first two years of life leads to irreversible
damage, contributing to poor cognitive development, poor educational performance, and
reduced earning potential in adulthood, trapping individuals in a lifetime of poverty [49,50].
Therefore, in populations like the Mirpur cohort, where cryptosporidiosis is found in 80% of
children less than two years of age, tackling strategies for interrupting spread of infection, vac-
cination, and treatment, may have a staggering impact on human potential. Elimination of
Cryptosporidium Infection and Malnutrition in Bangladeshi Children
PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0004564 May 4, 2016 12 / 15
cryptosporidiosis may be one important step towards improving the condition of impoverished
children around the world.
Supporting Information
S1 Checklist. STROBE Checklist.
(DOC)
S1 Table. Number of diarrheal episodes and HAZ scores at 24 months.
(DOCX)
Acknowledgments
We would like to thank the families and children of Mirpur for participating in this study.
Author Contributions
Conceived and designed the experiments: RH CG PSK WAP. Performed the experiments: CG
SEP DR MK. Analyzed the data: PSK CV FN JZM PD ML. Contributed reagents/materials/
analysis tools: WAP. Wrote the paper: PSK RH PD JZM WAP.
References
1. Kotloff KL, Nataro JP, Blackwelder WC, Nasrin D, Farag TH, Panchalingam S, et al. Burden and aetiol-
ogy of diarrhoeal disease in infants and young children in developing countries (the Global Enteric Mul-
ticenter Study, GEMS): a prospective, case-control study. Lancet. 2013; 382 (9888):209–22. doi: 10.
1016/S0140-6736(13)60844-2 PMID: 23680352
2. Black RE, Brown KH, Becker S. Effects of diarrhea associated with specific enteropathogens on the
growth of children in rural Bangladesh. Pediatrics. 1984; 73(6):799–805. PMID: 6374599
3. Murray CJ, Vos T, Lozano R, Naghavi M, Flaxman AD, Michaud C, et al. Disability-adjusted life years
(DALYs) for 291 diseases and injuries in 21 regions, 1990–2010: a systematic analysis for the Global
Burden of Disease Study 2010. Lancet. 2012; 380(9859):2197–223. doi: 10.1016/S0140-6736(12)
61689-4 PMID: 23245608
4. Cryptosporidium and Cryptosporidiosis. 2nd ed. Fayer R XL, editor. Boca Raton, FL: CRC Press;
2008.
5. Chalmers RM. Waterborne outbreaks of cryptosporidiosis. Ann lst Super Sanita. 2012; 48(4):429–46.
6. Lima AA, Moore SR, Barboza MS Jr., Soares AM, Schleupner MA, Newman RD, et al. Persistent diar-
rhea signals a critical period of increased diarrhea burdens and nutritional shortfalls: a prospective
cohort study among children in northeastern Brazil. J Infect Dis. 2000; 181(5):1643–51. PMID:
10823764
7. Khan WA, Rogers KA, Karim MM, Ahmed S, Hibberd PL, Calderwood SB, et al. Cryptosporidiosis
among Bangladeshi children with diarrhea: a prospective, matched, case-control study of clinical fea-
tures, epidemiology and systemic antibody responses. Am J Trop Med Hyg. 2004; 71(4):412–9. PMID:
15516636
8. Current WL, Reese NC, Ernst JV, Bailey WS, Heyman MB, Weinstein WM. Human cryptosporidiosis in
immunocompetent and immunodeficient persons. Studies of an outbreak and experimental transmis-
sion. N Engl J Med. 1983; 308(21):1252–7. PMID: 6843609
9. Hashmey R, Smith NH, Cron S, Graviss EA, Chappell CL, White AC Jr. Cryptosporidiosis in Houston,
Texas. A report of 95 cases. Medicine (Baltimore). 1997; 76(2):118–39.
10. Bonatti H, Barroso LF 2nd, Sawyer RG, Kotton CN, Sifri CD. Cryptosporidium enteritis in solid organ
transplant recipients: multicenter retrospective evaluation of 10 cases reveals an association with ele-
vated tacrolimus concentrations. Transpl Infect Dis. 2012; 14(6):635–48. doi: 10.1111/j.1399-3062.
2012.00719.x PMID: 22340660
11. Macfarlane DE, Horner-Bryce J. Cryptosporidiosis in well-nourished and malnourished children. Acta
Paediatr Scand. 1987; 76(3):474–7. PMID: 3604664
12. Sarkar R, Kattula D, Francis MR, Ajjampur SS, Prabakaran AD, Jayavelu N, et al. Risk factors for
cryptosporidiosis among children in a semi urban slum in southern India: a nested case-control study.
Am J Trop Med Hyg. 2014; 91(6):1128–37. doi: 10.4269/ajtmh.14-0304 PMID: 25331810
Cryptosporidium Infection and Malnutrition in Bangladeshi Children
PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0004564 May 4, 2016 13 / 15
13. Haque R, Mondal D, Karim A, Molla IH, Rahim A, Faruque AS, et al. Prospective case-control study of
the association between common enteric protozoal parasites and diarrhea in Bangladesh. Clin Infect
Dis. 2009; 48(9):1191–7. doi: 10.1086/597580 PMID: 19323634
14. Mondal D, Minak J, Alam M, Liu Y, Dai J, Korpe P, et al. Contribution of enteric infection, altered intesti-
nal barrier function, and maternal malnutrition to infant malnutrition in Bangladesh. Clin Infect Dis.
2012; 54(2):185–92. doi: 10.1093/cid/cir807 PMID: 22109945
15. Korpe PS, Liu Y, Siddique A, Kabir M, Ralston K, Ma JZ, et al. Breast milk parasite-specific antibodies
and protection from amebiasis and cryptosporidiosis in Bangladeshi infants: a prospective cohort
study. Clin Infect Dis. 2013; 56(7):988–92. doi: 10.1093/cid/cis1044 PMID: 23243179
16. Bhattacharya MK, Teka T, Faruque AS, Fuchs GJ. Cryptosporidium infection in children in urban Ban-
gladesh. J Trop Pediatr. 1997; 43(5):282–6. PMID: 9364126
17. Javier Enriquez F, Avila CR, Ignacio Santos J, Tanaka-Kido J, Vallejo O, Sterling CR. Cryptosporidium
infections in Mexican children: clinical, nutritional, enteropathogenic, and diagnostic evaluations. Am J
Trop Med Hyg. 1997; 56(3):254–7. PMID: 9129526
18. Kirkpatrick BD, Haque R, Duggal P, Mondal D, Larsson C, Peterson K, et al. Association between Cryp-
tosporidium infection and human leukocyte antigen class I and class II alleles. J Infect Dis. 2008; 197
(3):474–8. doi: 10.1086/525284 PMID: 18248305
19. Carmolli M, Duggal P, Haque R, Lindow J, Mondal D, Petri WA Jr., et al. Deficient serum mannose-
binding lectin levels and MBL2 polymorphisms increase the risk of single and recurrent Cryptosporid-
ium infections in young children. J Infect Dis. 2009; 200(10):1540–7. doi: 10.1086/606013 PMID:
19827946
20. Cruz JR, Cano F, Caceres P, Chew F, Pareja G. Infection and diarrhea caused by Cryptosporidium sp.
among Guatemalan infants. J Clin Microbiol. 1988; 26(1):88–91. PMID: 3343318
21. Molbak K, Hojlyng N, Gottschau A, Sa JC, Ingholt L, da Silva AP, et al. Cryptosporidiosis in infancy and
childhood mortality in Guinea Bissau, west Africa. BMJ. 1993; 307(6901):417–20. PMID: 8374453
22. Roy SL, DeLong SM, Stenzel SA, Shiferaw B, Roberts JM, Khalakdina A, et al. Risk factors for sporadic
cryptosporidiosis among immunocompetent persons in the United States from 1999 to 2001. J Clin
Microbiol. 2004; 42(7):2944–51. PMID: 15243043
23. Newman RD, Sears CL, Moore SR, Nataro JP, Wuhib T, Agnew DA, et al. Longitudinal study of Crypto-
sporidium infection in children in northeastern Brazil. J Infect Dis. 1999; 180(1):167–75. PMID:
10353875
24. Chacin-Bonilla L, Barrios F, Sanchez Y. Environmental risk factors for Cryptosporidium infection in an
island from Western Venezuela. Mem Inst Oswaldo Cruz. 2008; 103(1):45–9. PMID: 18345459
25. Katsumata T, Hosea D, Wasito EB, Kohno S, Hara K, Soeparto P, Ranuh IG. Cryptosporidiosis in Indo-
nesia: a hospital-based study and a community-based survery. Am J Trop Med Hyg. 1998; 59(4):628–
32. PMID: 9790442
26. Solarzano-Santos F, Penagos-Paniagua M, Menes-Esquivel R, Miranda-Novales MG, Leanos-
Miranda B, Angulo-Gonzalez D, Fajardo-Gutierrez A. Cryptosporidium parvum infection in wel-lnour-
ished and malnourished children without diarrhea in a Mexican rural population. Rev Invest Clin. 2000;
52 (6): 625–631. PMID: 11256105
27. Pereira MD, Atwill ER, Barbosa AP, Silva SA, Garcia-Zapata MT. Intra-familial and extra-familial risk
factors associated with Cryptosporidium parvum infection among children hospitalized for diarrhea in
Goiania, Goias, Brazil. Am J Trop Med Hyg. 2002; 66(6):787–93. PMID: 12224593
28. Mac Kenzie WR, Hoxie NJ, Proctor ME, Gradus MS, Blair KA, Peterson DE, et al. A massive outbreak
in Milwaukee of cryptosporidium infection transmitted through the public water supply. N Engl J Med.
1994; 331(3):161–7. PMID: 7818640
29. Lake IR, Harrison FC, Chalmers RM, Bentham G, Nichols G, Hunter PR, et al. Case-control study of
environmental and social factors influencing cryptosporidiosis. Eur J Epidemiol. 2007; 22(11):805–11.
PMID: 17891460
30. Nundy S, Gilman RH, Xiao L, Cabrera L, Cama R, Ortega YR, et al. Wealth and its associations with
enteric parasitic infections in a low-income community in Peru: use of principal component analysis.
Am J Trop Med Hyg. 2011; 84(1):38–42. doi: 10.4269/ajtmh.2011.10-0442 PMID: 21212198
31. Bushen OY, Kohli A, Pinkerton RC, Dupnik K, Newman RD, Sears CL, Fayer R, Lima AA, Guerrant RL.
Heavy cryptosporidial infections in children in northeast Brazil: comparison of Cryptosporidium hominis
and Cryptosporidium parvum: Trans R Soc Trop Med Hyg. 2007; 101: 378–84. PMID: 16934303
32. Checkley W, Epstein LD, Gilman RH et al. “Effects of Cryptosporidium parvum infection in Peruvian
children: growth faltering and subsequent catch-up growth”Am J Epidemiol. 1997; 148 (5): 497–506.
33. Black RE, Allen LH, Bhutta ZA, Caulfield LE, de Onis M, Ezzati M et al. Maternal and child undernutri-
tion: global and regional exposures and health consequences. The Lancet. 2008; 371: 243–60.
Cryptosporidium Infection and Malnutrition in Bangladeshi Children
PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0004564 May 4, 2016 14 / 15
34. Liu J, Kabir F, Manneh J, Lertsethtakarn P, Begum S, Gratz J et al. Development and assessment of
molecular diagnostic tests for 15 enteropathogens causing childhood diarrhoea: a multicentre study.
Lancet Infect Dis. 2014; 14(8):716–24. doi: 10.1016/S1473-3099(14)70808-4 PMID: 25022434
35. Haque R, Roy S, Siddique A, et al. Multiplex real-time PCR assay for detection of Entamoeba histoly-
tica, Giardia lamblia and Cryptosporidium spp. Am J Trop Med Hyg. 2007; 76:713–7. PMID: 17426176
36. Hira KG, Mackay MR, Hempstead AD, Ahmed S, Karim MM, O'Connor RM, et al. Genetic diversity of
Cryptosporidium spp. from Bangladeshi children. J Clin Microbiol. 2011; 49 (6): 2307–10. doi: 10.1128/
JCM.00164-11 PMID: 21471344
37. Iqbal A, Lim YA, Surin J, Sim BL. High diversity of Cryptosporidium subgenotypes identified in Malay-
sian HIV/AIDS individuals targeting gp60 gene. PLoS One. 2012; 7(2):e31139. doi: 10.1371/journal.
pone.0031139 PMID: 22347442
38. Meyer M, Kircher M. Illumina sequencing library preparation for highly multiplexed target capture and
sequencing. Cold Spring Harb Protoc. 2010;(6: ):pdb.prot5448
39. World Bank. Poverty and Equity, Country Dashboard, Bangladesh. 2015. Available from: http://
povertydata.worldbank.org/poverty/country/BGD.
40. UNICEF-WHO-The World Bank: Joint child malnutrition estimates—Levels and trends. 2013.
41. Das P, Roy SS, Mitra Dhar K, Dutta P, Bhattacharya MK, Sen A, et al. Molecular characterization of
Cryptosporidium spp. from children in Kolkata, India. J Clin Microbiol. 2006; 44:4246–9. PMID:
16971647
42. Ajjampur SS, Gladstone BP, Selvapandian D, Muliyil JP, Ward H, Kang G. Molecular and spatial epide-
miology of cryptosporidiosis in children in a semiurban community in South India. J Clin Microbiol.
2007; 45: 915–920. PMID: 17251402
43. Nagamani K, Pavuluri PR, Gyaneshwari M, Prasanthi K, Rao MI, Saxena NK. Molecular characterisa-
tion of Cryptosporidium: an emerging parasite. Indian J Med Microbiol. 2007; 25:133–6. PMID:
17582183
44. Ajjampur SS, Liakath FB, Kannan A, Rajendran P, Sarkar R, Moses PD, et al. Multisite study of crypto-
sporidiosis in children with diarrhea in India. J Clin Microbiol. 2010; 48:2075–81. doi: 10.1128/JCM.
02509-09 PMID: 20392919
45. Checkley W, Epstein LD, Gilman RH, Black RE, Cabrera L. Sterling CR. Effects of Cryptosporidium
parvum infection in Peruvian children: Growth faltering and subsequent catch up growth. Am J Epide-
miol. 1998; 148: 497–506. PMID: 9737562
46. Alcantara Warren C
,
Destura RV, Sevilleja JE, Barroso LF, Carvalho H, Barrett LJ et al. Detection of
epithelial-cell injury, and quantification of infection, in the HCT-8 organoid model of cryptosporidiosis. J
Infect Dis. 2008; 198(1):143–9. PMID: 18498239 doi: 10.1086/588819
47. Costa LB, JohnBull EA, Reeves JT, Sevilleja JE, Freire RS, Hoffman PS. “Cryptosporidium-malnutrition
interactions: mucosal disruption, cytokines, and TLR signaling in a weaned murine model. J Parasitol.
2011; 97(6):1113–20. doi: 10.1645/GE-2848.1 PMID: 21711105
48. Taniuchi M, Verwejj JJ, Noor Z, Sobuz S, Lieshout LV, Petri WA Jr. et al. “High throughput multiplex
PCR and probe-based detection with Luminex beads for seven intestinal parasites. Am. J. Trop. Med.
Hyg. 2011; 84(2): 332–337. doi: 10.4269/ajtmh.2011.10-0461 PMID: 21292910
49. Bradshaw, T. Theories of poverty and anti-poverty programs in community development. Rural Poverty
Research Center, Working Paper No. 06-05(2006).
50. Victora CG, Adair L, Fall C, Hallal PC, Martorell R, Richter L, et al. Maternal and child undernutrition:
consequences for adult health and human capital. Lancet. 2008; 371(9609): 340–357. doi: 10.1016/
S0140-6736(07)61692-4 PMID: 18206223
Cryptosporidium Infection and Malnutrition in Bangladeshi Children
PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0004564 May 4, 2016 15 / 15
