Phenotypic and genotypic characterization of some virulence factors in Pseudomonas aeruginosa strains isolated from different clinical sources in Mansoura University Hospitals

Abstract

The present study aims to determine the extent of production of some virulence factors and antimicrobial resistance of P. aeruginosa isolated from different clinical sources in Mansoura University Hospitals. In addition, this research was done to characterize five bacterial genes that encode virulence determinants on both chromosomal and plasmid DNA using PCR technique.
Ninety eight isolates of P. aeruginosa from diverse clinical sources were employed. . Isolates were mainly recovered from endotracheal tube parts, urine, burns and wounds. In this study, the susceptibility to 10 antimicrobials was determined and analyzed among isolates. The antimicrobial susceptibility test showed that amikacin and imipenem were the most active antibiotics against tested isolates. All isolates were resistant to amoxicillin- clavulanic acid, cefadroxil, cefotaxime and cefepime, they manifested different degrees of sensitivity to the rest antimicrobials.
The phenotypic detection of virulence factors revealed that pyocyanin was produced by all isolates, but higher amounts were produced by urine isolates. High percent of haemolysis was manifested by 77% of isolates, where urine and burn isolates exhibited higher hemolysis percent. Regarding total protease and staphylolytic activity, 82% of isolates were positive protease producers where higher protease and staphylolysis activity were noticed among blood and endotracheal isolates. Most of isolates (92.8%) were positive lipase producers and both wound and endotracheal isolates were shown to have higher production levels. Strong biofilm formation was observed for 18% of isolates and the highest level of biofilm production was noticed for endotracheal isolates as twelve out of twenty six gave OD <0.2. For genotypic detection, it was observed that among the fifty tested isolates, 100% were positive for toxA, aprA and lasB genes. A high percentage constituting of 74% and 94% were positive for exoS and exoU genes respectively. Plasmid extraction showed that 93% of tested isolates contained plasmids and the tested virulence genes were harbored by most of them (toxA, lasB and exoU genes were carried by 92% of tested isolates while aprA and exoS genes were carried by 84.6% and 61.5% respectively).
The present study confirmed previous observations that the virulence of P. aeruginosa is multifactorial and resistance to antimicrobials was not generally associated with the level of production of the pathogenicity factors. Plasmid studies confirmed their crucial role in the horizontal transfer of virulence.

Full text

1
Phenotypic and genotypic characterization of some virulence
factors in Pseudomonas aeruginosa strains isolated from
different clinical sources in Mansoura University Hospitals.
Dina Eid, , Wael El-Naggar, Rasha Barwa. and Mohammed A. El-
Sokkary.
Microbiology Department, Faculty of Pharmacy, Mansoura University, Egypt.
Abstract
The present study aims to determine the extent of production of some
virulence factors and antimicrobial resistance of P. aeruginosa isolated
from different clinical sources in Mansoura University Hospitals. In
addition, this research was done to characterize five bacterial genes that
encode virulence determinants on both chromosomal and plasmid DNA
using PCR technique.
Ninety eight isolates of P. aeruginosa from diverse clinical sources
were employed. . Isolates were mainly recovered from endotracheal tube
parts, urine, burns and wounds. In this study, the susceptibility to 10
antimicrobials was determined and analyzed among isolates. The
antimicrobial susceptibility test showed that amikacin and imipenem were
the most active antibiotics against tested isolates. All isolates were
resistant to amoxicillin- clavulanic acid, cefadroxil, cefotaxime and
cefepime, they manifested different degrees of sensitivity to the rest
antimicrobials.
The phenotypic detection of virulence factors revealed that pyocyanin
was produced by all isolates, but higher amounts were produced by urine
isolates. High percent of haemolysis was manifested by 77% of isolates,
where urine and burn isolates exhibited higher hemolysis percent.
Regarding total protease and staphylolytic activity, 82% of isolates were
positive protease producers where higher protease and staphylolysis
activity were noticed among blood and endotracheal isolates. Most of
isolates (92.8%) were positive lipase producers and both wound and
endotracheal isolates were shown to have higher production levels.
Strong biofilm formation was observed for 18% of isolates and the
highest level of biofilm production was noticed for endotracheal isolates
as twelve out of twenty six gave OD >0.2. For genotypic detection, it was
observed that among the fifty tested isolates, 100% were positive for
toxA, aprA and lasB genes. A high percentage constituting of 74% and
94% were positive for exoS and exoU genes respectively. Plasmid
extraction showed that 93% of tested isolates contained plasmids and the
tested virulence genes were harbored by most of them (toxA, lasB and

2
exoU genes were carried by 92% of tested isolates while aprA and exoS
genes were carried by 84.6% and 61.5% respectively).
The present study confirmed previous observations that the virulence
of P. aeruginosa is multifactorial and resistance to antimicrobials was not
generally associated with the level of production of the pathogenicity
factors. Plasmid studies confirmed their crucial role in the horizontal
transfer of virulence.
Introduction:
Pseudomonas aeruginosa is an opportunistic pathogen that causes
severe infections in cystic fibrosis patients, burn patients, and
immunocompromized hosts. The reason for this bacterium to have such a
wide range of attacking mode is due to the presence of several virulence
factors. Virulence of P. aeruginosa is multifactorial and has been
attributed to cell-associated factors like alginate, lipopolysaccharide ,
flagellum, pilus and non-pilus adhesins as well as with exoenzymes or
different virulence factors like proteases, pyocyanin, exotoxin A,
exoenzyme S, hemolysins (rhamnolipids and phospholipase C) and
siderophores (Mittal et al., 2009).
Pyocyanin is the principal phenazine produced by P. aeruginosa and
it has been shown to contribute to the unusual persistence of P.
aeruginosa infections. Pyocyanin toxicity is largely due to its ability to
engage in oxidation-reduction reactions that deplete cells of NADH,
glutathione, and other antioxidants. The redox activity of pyocyanin
generates oxidants such as superoxide and peroxides (Parsons et al.,
2008).
Two hemolysins, phospholipase C and rhamnolipid, produced by P.
aeruginosa, synergistically act to break down lipids and lecithin. Both
may contribute to tissue invasion by their cytotoxic effects (Van Delden
and Iglewski, 1998).
P. aeruginosa secretes several proteases; including lasB elastase, lasA
elastase and alkaline protease; that play a role in the pathogenic
interaction between bacterium and host. LasB elastase is a zinc
metalloprotease that acts on a number of proteins including elastin. LasB
elastase is highly efficient, with a proteolytic activity
approximately 10 times that of P. aeruginosa alkaline protease and an
activity toward casein approximately four times that of trypsin
(Galloway, 1991).
Elastase A (LasA), also known as staphylolysin, is a zinc
metalloprotease that has both low elastolytic and high staphylolytic
activities (Kessler et al., 1997).
The alkaline protease (AprA), also known as aeruginolysin, is one of
the secreted zinc-dependent metallo-endopeptidase of P. aeruginosa. It

3
was shown that AprA cleaves a large number of physiological substrates
in vitro such as fibrin, fibrinogen, different complement factors,
especially C3 (Matsumoto, 2004).
The capacity of P. aeruginosa to form biofilms is an important
requirement for chronic colonization of human tissues and for persistence
in implanted medical devices. These microbial communities then develop
unique characteristics and properties that protect them from external
influences, most significant of which is the enhanced resistance of
bacteria within the biofilm to antibiot ics and host defenses (Mah and
O’Toole, 2001).
Pseudomonas exotoxin A is the most toxic substance in P. aeruginosa
(Liu, 1974). It belongs to a family of enzymes termed mono-ADP-
ribosyltranferases, Its importance for the toxicity of the bacterium became
apparent in the study by Iglewski and Kabat (1975). They discovered that
exotoxin A catalyzes the ADP ribosylation of the eukaryotic elongation
factor 2 (eEF-2), leading to inhibition of protein synthesis and cell death
(Wolf and Elsasser-Beile, 2009).
The type III secretion system (TTSS) of P. aeruginosa is a complex
pilus-like struc-ture allowing the translocation of effector proteins from
the bacteria, across the bacterial membranes and into the eukaryotic
cytoplasm through a needle-like appendage forming a pore in the
eukaryotic membrane. There are four known toxins, variably expressed in
different strains and isolates of P. aeruginosa: ExoY, ExoS, ExoT and
ExoU.
ExoS is a bifunctional cytotoxin with two active domains, a C-
terminal ADP-ribosyltranferase domain and an N-terminal GTPase-
activating protein (GAP) domain. The pathogenic role of ExoS is mainly
attributable to the ADP-ribosyltranferase activity leading to disruption of
normal cytoskeletal organization, although GAP activity also plays a
similar role (Kipnis et al., 2006).
ExoU possesses phospholipase A2-like activity with broad substrate
specificity (Sitkiewicz et al., 2007). The extensive tissue destruction
induced by ExoU combined with the modulation of the host inflammatory
response, particularly its ability to induce localized immunosuppression,
probably explains its prominent role in the pathogenesis of severe acute
P. aeruginosa infections (Engel and Balachandran, 2009).
The present study aimed to detect phenotypically some virulence
factors and determine whether the level of virulence factors produced by
P. aeruginosa varied within the type of infection and resistance to
antimicrobials. Moreover, genotypic detection of some other virulence
determinants on both chromosomal and plasmid DNA was also
performed.

4
Materials and Methods
I- Clinical strains:
Ninety eight clinical P. aeruginosa strains were recovered from
endotracheal tube part and aspirate (26 isolates), urinary tract infections
(18 isolates), burns (16 isolates) , wound (13 isolates), blood (6 isolates),
ear swabs (5 isolates), sputum (5 isolates), cerebrospinal fluid (3
isolates) and others (3 isolates) from patients in Mansoura University
Hospitals (MUH), Mansoura, Dakahlia governorate, Egypt.
The specimens were immediately processed using standard procedures
according to Blair et al. (1970) and were identified according to Sutter
(1968) and Govan (1996).
II- Antimicrobial susceptibility testing:
All isolates were screened for susceptibility to ten antimicrobial discs
namely; amikacin (30 µg), gentamicin (10 µg), amoxicillin/clavulanic
acid (30 µg), cefotaxime (30 µg), cefadroxil (30 µg), cefepime (30 µg),
levofloxacin (5 µg), ofloxacin (5 µg), imipinem (10 µg) and azithromycin
(15 µg) using the standard disc diffusion method of NCCLS (2003) All
discs were supplied from Bioanalyse Company, Turkey.
III- Phenotypic detection of virulence factors:
1) Pyocyanin assay:
Pyocyanin was removed from the supernatant fraction of P. aeruginosa
isolates grown in King’s A liquid medium for 24 hrs (King et al., 1954).
A five ml volume of supernatant was mixed with a 3 ml chloroform layer.
A volume of 1 ml of 0.2 M HCl was added to this layer and the
pyocyanin-rich organic layer was extracted. The amount of pyocyanin
within the collected sample layer was determined through measuring the
absorbance at 520 nm. Microgram quantities of pyocyanin were
calculated by multiplying the absorbance at 520 nm by 17.072 (Ralli et
al., 2005).
2) Hemolysin assay:
Cells were grown in nutrient broth for about 48 hrs at 28°C with
shaking and the enzymatic activity of the culture supernatant was
assessed. Human erythrocytes were washed 3X with saline and
resuspended in 10 mM Tris HCl (pH 7.4)-160 mM NaCl
(hemolysin assay buffer) to a final
concentration of 2% (v/ v). A volume of 600 µl of a 2% suspension of
erythrocytes was combined with 600 µl of supernatant and this mixture
was incubated for 2 hr at 37°C. Control experiments for spontaneous lysis
or complete lysis were carried out without hemolysin and with 0.2%
sodium dodecyl sulfate, respectively. The suspension was centrifuged at

5
10,000 rpm for 8 min at 4°C, and released hemoglobin was assessed by
determining absorbance at 540 nm. The percentage (%) of cells lysed was
calculated as follows: % = [(X-B)/ (T-B)] × 100 where B (baseline) is a
negative control consisting of 600 µl nutrient broth and 600 µl of a 2%
suspension of erythrocytes, T is a positive control corresponding to the
total lysis and X is absorbance of tested sample (Nakazawa et al., 1987
and Rossignol et al., 2008).
3) Proteases enzymes studies
a- Screening for proteases activity:
Protease producing strains were detected by inoculating 5% skimmed
milk agar plates with the isolates. After incubation for 24 hrs at 37oC,
Proteolysis was shown as a clear zone around the growth (Sokol et al.,
1979).
b- Total proteases assay
The method of Snell et al. (1978) was adopted with a little
modification. The method is based on the diffusion of protease from wells
cut in casein agar medium and its subsequent digestion of casein as
detected by clear zone around the well. Supernatants from Brain Heart
Infusion (BHI) cultures were dropped in wells cut in 12 cm casein agar
plates which then were incubated for 24 hrs at 37oC. The diameters of
clear zones around wells were measured to the nearest mm using a
caliper.Protease activity of tested strains was calculated from the
calibration curve constructed by plotting arbitrary units against the
diameter of clear zones in mm of two fold serial dilutions of the highest
protease producing strain's aliquot.
c- Staphylolytic assay:
The staphylolytic activity of the Pseudomonas extracellular proteases
was determined by measuring the percent of lysis of a Staphylococcus
aureus cell suspension. A modified method of Kessler et al. (1993) was
carried out. Staphylococcus aureus strain (S 25) obtained from
department of microbiology, faculty of pharmacy, Mansoura University
was cultured in nutrient broth overnight at 37°C, centrifuged. The pellet,
was resuspended in 0.02 M Tris-HC1, pH 8.5, boiled for 10 min and
diluted with the same buffer to an OD595 of 0.8. The assay was carried out
at 37°C by adding 200 µl enzyme aliquots to 800 µl heat-killed cells.
Staphylolysis was determined by measuring the change in OD595 after 90
min and percent of lysed cells was calculated.
4) Lipase assay
Qualitative assays of lipase activity were performed by plating solid
bacterial cultures on tween agar plates. Lipase-releasing colonies were
identified by the formation of precipitates of water-insoluble fatty acids
from hydrolyzed tween surrounding them.

6
Lipase activity was assayed by a colorimetric method. A stock
solution of p-nitrophenyl palmitate (p-NPP) was prepared in HPLC grade
of isopropanol. The reaction mixture contained 75 µl of p-NPP stock
solution, 5µl of supernatants from BHI culture and 0.1 M Tris buffer (pH
8.5) to make a final volume of 3 ml. The reaction mixture was incubated
at 37 oC for 10 min then chilled at -20 oC for 8 min to stop the reaction.
The absorbance of released p-nitrophenol was measured at 410 nm
(Kumar et al., 2005).
Lipase activity of tested strains was calculated from the calibration
curve constructed by plotting arbitrary units against absorbance of two
fold serial dilutions of the highest lipase producing strain's supernatant.
5) Biofilm Formation:
Microtiter plate assay was used to determine biofilm formation
according to Stepanovic et al. (2000) and Abdi-Ali et al. (2006). Briefly,
cells from overnight culture on trypticase soy agar supplemented with
0.25% glucose were suspended in trypticase soy broth + 0.25 % glucose
and adjusted at OD600 of 0.25. One-hundred µl of the suspension was then
used to inoculate 96-wells of flat bottomed polystyrene microtiter plate,
at least in triplicate, and incubated (18 hr, 37 °C) without shaking. After
the bacterial cultures were poured out, wells were 3times washed with
PBS, fixed in the air (15 min) and stained with 0.1 % crystal violet
solution (20 min). The unbound dye was removed by rinsing 3times with
PBS. After drying the plates (15 min), crystal violet was solubilized by
150 μl per well of 33% (V/V) of glacial acetic acid (10 min). The optical
density of each well was measured at 492 nm using a microtiter plate
reader. For each strain, the mean OD of the three wells was calculated
(ODT). The cut-off OD (ODc) was defined as three standard deviations
above the mean OD of the negative control wells.
IV- Genotypic detection of some virulence factors:
1) Genomic DNA extraction:
The genomic DNA of 50 of highly virulent P. aeruginosa isolates were
prepared using QIA amp® DNA mini kit Cat. No. 51304 supplied by
Qiagen Inc. according to the manufacturer's instructions for bacteria
2009. DNA was eluted by adding 50 µl Qiagen EB buffer (10 mM Tris-
HCl, pH 8.5) and visualized by electrophoresis on horizontal gels
containing 1% agarose and Fermentas 100bp DNA ladder.
2) Plasmid DNA extraction:
The plasmid content of 14 isolates was prepared using QIAprep Spin
Miniprep DNA purification system Kit cat. No. 27106 supplied by
Qiagen protocol 2009. Plasmid DNA was eluted by addition of 50 µl
buffer EP (10 mM Tris HCl, pH 8.5) or water to the center of each
QIAprep spin column.

7
3) PCR detection of specific gene sequences
Virulence genes (toxA, lasB, aprA, exoS and exoU) were detected and
amplified using the following reaction: 3µl DNA extract, 1µl of forward
primer (10 µM), 1 µl of reverse primer (10 µM) (Table 1), 12.5 µl of
DreamTaq™ Green PCR master mix and 7.5 µl of nuclease-free water.
The PCR conditions were started with initial denaturation step at
95°C for 2 min, followed by 35 cycles of denaturation at 95°C for 30 sec,
annealing temperature (65 ºC for toxA, 60 ºC for apr , lasB, exoS and
exoU) for 40 sec, and extension at 72°C for 1 min and final extension at
72°C for 5 min.
Table (1): Specific amplification primer sets for the tested virulence
genes among P. aeruginosa isolates.
Gene
name Type Sequence
toxA Fw 5`…GACAACGCCCTCAGCATCAACAGC
Rv 5`…CGCTGGCCCATTCGCTCCAGC
lasB
Fw 5'… TCATCACCGTCGACATGAAC
Rv 5`… TGCCCTTCTTGATGTCGTAG
aprA Fw 5`…AGTTGTCGCTGCAATCCTGG
Rv 5`…AGCTCATCACCGAATAGGCG
exoS
Fw 5'… AGGCATTGCCCATGACCTTG
Rv 5`… ATACTCTGCTGACCTCGCTC
exoU Fw 5'… CTAGAAGAGAAAGGCATGCTCG
Rv
5`… CTATGCGTGGGAGTACATTGAG
Fw: forward primer Rv: reverse primer
The generated amplicons were visualized on 1.2% agarose gel
electrophoresis stained with ethidium bromide and illuminated under UV
transilluminator.
Results
I- Antimicrobial susceptibility testing:
A total of 98 isolates of P. aeruginosa were isolated from specimens
collected from different clinical sources. It was observed that all isolates
were resistant to amoxicillin- clavulanic acid, cefadroxil, cefotaxime and
cefepime. On the other hand, they showed different levels of resistance to
the other 6 antimicrobials. Where 48 strains were resistant to gentamicin,

8
46 strains were resistant to ofloxacin, 36 strains were resistant to
levofloxacin. A number of 29 strains were resistant to azithromycin, 21
strains were resistant to imipenem and 14 strains were resistant to
amikacin.
II-Phenotypic detection of virulence factors:
The isolates were investigated for their possession of virulence factors
including pyocyanin production, hemolysin production, proteases (total
proteases and staphylolytic activity of elastase A), lipase production and
biofilm formation.
In the present study, the range for production of each virulence factor
was arbitrarily selected and isolates were categorized as low or high
producer (Table 2).
A wide range of pyocyanin was produced. An amount more than 100
µg / ml was produced by five strains, while a similar number produced
amounts less than 1 µg / ml. It was noticed that the highest level (≥ 40 µg
/ ml) of pyocyanin production was produced by 6 urine isolates which
gave amounts that ranged between 86 µg / ml and 131.5 µg / ml.
Regarding other sources, lower production levels were noticed. The level
of pyocyanin expressed by the number of the strains was higher in the
group of strains resistant to azithromycin and ciprofloxacin (in
comparison with the sensitive strains) (Table3).
On the average, most isolates in this study produced high percent of
hemolysis. A number of seventy six strains produced more than 50%
hemolysis including twenty strains that produced complete (100%)
hemolysis. This included four endotracheal isolates, five burn isolates,
four blood isolates, three urine and three wound isolates. Regarding the
isolation site, a high level of hemolysis (≥ 50%) was produced by 94% of
urine isolates, 93 % of burn isolates, 87.5 % of blood isolates and 84 % of
wound isolates.

9
Table (2): Distribution of different production level of virulence factors
among different clinical sources.
Percent of strains producing high level of different virulence factors
Clinical source
(Number) Biofilm
(OD ˃
0.2)
Lipase
≥20 unit
Staphylolysis
≥20%
Total
p
rotease
≥18 units
Haemolysis
≥ 50%
Py
ocyanin
≥ 40
µg/ml
46 57.7 38.5 38.5
57.7
30
(26)
Endotracheal
22.2 16.7 0 11.1
94.4
33.3
(18)
Urine
12.5 37.5 12.5 31.3
93.3
25
(16)
Burn
30.8 76.9 15.4 23
84.6
23
(13)
Wound
25 37.5 50 62.5
87.5
37.5
(8)
Blood
16.7 16.7 16.7 16.7
50
33.3
(6)
Ear
0 20 20 20
60
0
(5)
Sputum
0 33.3 33.3 0
100
33.3
(3)
CSF
Table (3): Relationship between resistance and/ or sensitivity to
antimicrobials and virulence factors production.
Percent of strains producing
Number of
strains
Antibiotic
Biofilm (OD
˃ 0.2)
Lipase ≥
20 units
Total protease
≥18 units
Haemolysin
≥ 50%
Pyocyanin≥ 40
µg/ml
S,I R
25
21.4
41.6
42.8
84.5
71.4
75
92.9
27.3
35.7
84
14
Amikacin
32
16
40
74.5
78
87.5
76
79.1
26
31.25
50
48
Gentamicin
9.6
50
48.3
30.5
80.6
86.1
75.8
80.5
27.4
30.5
62
36
Levofloxacin
33.3
14.8
49
34
80.3
85.1
78.4
76.5
27.4
29.7
51
47
Ofloxacin
24.3
25
41
45
80.7
90
80.7
65
26.9
35
78
20
Imipenem
26
20.6
40.5
44.8
82.6
82.7
79.7
72.4
20.2
48.2
69
29
Azithromycin
R: resistant S: sensitive I: intermediate
In the present study, 17 isolates did not show proteolysis on skimmed
milk ager. It was observed that a high level of protease activity (≥ 18
units) was manifested by higher number of blood and endotracheal

10
isolates followed by burn isolates. On the other hand, other sources
exhibited lower protease activity.
The majority (65%) of isolates manifested low levels of
staphylolytic activity (≤ 10% staphylolysis). Higher staphylolytic activity
(≥ 20% staphylolysis) was detected in twenty two strains as compared to
the rest of tested strains.
The level of staphylolysis varied with the site of isolation. Ten out of
twenty six endotracheal isolates produced high staphylolytic activity that
ranged between 23% and 53%. A number of 4 blood isolates exhibited a
range of 25% to 41% staphylolysis.
Regarding lipase activity, only 5 isolates were negative lipase
producers. It was observed that 76.9% of wound and 57.7% of
endotracheal isolates showed higher lipase activity (≥ 20 units) . High
percentage of strains resistant to gentamicin was high lipase producer.
As indicated in figure (1), thirty nine strains exhibited moderate
adherence (0.115 < OD ≤ 0.229) while only eighteen strains were strong
adherent (OD > 0.229). The remaining forty one strains were either weak
or non-adherent. Regarding the source, the highest level of biofilm
production was produced by endotracheal isolates as twelve out of twenty
six gave OD > 0.2. On the other hand, no strong adherence was detected
in sputum or CSF isolates. High percentage of strains in the groups
sensitive to gentamicin (32%) and/ or ofloxacin (33.3%) and resistant to
levofloxacin (50%) was strong biofilm producer (in comparison with the
sensitive strains).
Fig. (1): Level of biofilm formation by P. aeuruginosa isolates

11
II- Genotypic detection of some virulence genes:
toxA, apr , lasB, exoS and exoU genes were amplified from genomic
DNA of 50 highly virulent P. aeruginosa isolates. PCR detection of
toxA, apr and lasB genes showed that they were harbored by
chromosomal DNA of all tested isolates with amplicon size of 390 bp,
315 bp and 490 bp respectively as shown in figure (2).
Fig. (2): Agarose gel electrophoresis of
a) toxA gene amplicones. Lanes from 1 to 15 represent isolates No. 27, 32, 40,
42, 43, 47, 48, 54, 55, 58, 59, 61, 65, 66 and 67 respectively. Lane C was
negative control. Lane M was 100 bp DNA marker
b) apr gene amplicones. Lanes from 1 to 16 represent isolates No. 2, 3, 4, 5,
6, 7, 8, 10, 12, 14, 15, 17, 21, 22, 23 and 25 respectively.
Lane C was negative control. Lane M was 100 bp DNA marker.
c) lasB gene amplicones. Lanes from 1 to 11 represent isolates No. 14, 15, 17,
21, 22, 23, 25, 88, 92, 93 and 94 respectively.
Lane C was negative control. Lane M was 100 bp DNA marker
a)
c)
390 bp
315 bp
490 bp
b)

12
Regarding exoS gene, only 37 isolates gave amplicon size of 372 bp.
On the other hand, only three isolates did not harbor exoU gene (fig. 3).
Of the 50 P. aeruginosa isolates examined, 13 contained the
exoU(amplicon size of 274 bp) but not the exoS gene, 34 isolates
contained both genes, and only 3 isolates contained the exoS but not the
exoU gene.
The plasmid DNA was isolated from 14 highly virulent P.
aeruginosa isolates. Only one strain (No. 93) did not harbor any
plasmid. Screening for the presence of the studied virulence genes on
the isolated plasmids of these strains displayed the presence of toxA
gene on all of them (Data not shown).
Concerning apr gene, it was harbored by 10 strains while lasB and
exoU genes were harbored by 12 strains. For exoS gene, 8 strains were
found to carry it on their plasmids (Data not shown).
Fig. (3): Agarose gel electrophoresis of
a) exoS gene amplicones. Lanes from 1 to 15 represent
isolates No. 1, 2, 3, 4, 5, 6, 7, 8, 10, 12, 14, 15, 17, 21 and
22 respectively. . Lane C was negative control. Lane M
was 100 bp DNA marker.
b) exoU gene amplicones. Lanes from 1 to 15 represent
isolates No. 27, 32, 40, 42, 43, 47, 48, 54, 55, 58, 59, 61,
65, 66 and 67 respectively.
Lane C was negative control. Lane M was 100 bp DNA
marker.
a)
b)
372 bp
274 bp

13
Discussion
P. aeruginosa is a major cause of nosocomial infections. This
organism shows a remarkable capacity to resist antibiotics, either
intrinsically (because of constitutive expression of β-lactamases and
efflux pumps, combined with low permeability of the outer-
membrane) or following acquisition of resistance genes (e.g., genes for
β -lactamases, or enzymes inactivating aminoglycosides or modifying
their target), over-expression of efflux pumps, decreased expression of
porins, or mutations in quinolone targets. Worryingly, these mechanisms
are often present simultaneously, thereby conferring multiresistant
phenotypes. Susceptibility testing is therefore crucial in clinical practice
(Mesaros et al., 2007). Poor sensitivity to cefalosporins was observed as
all isolates were resistant to amoxicillin- clavulanic acid, cefadroxil,
cefotaxime, cefepime. A comparable level of resistance to cefotaxime but
a different response to cefepime was found by Hoštacka et al. (2006).
In our study, a notable resistance (20%) of P. aeruginosa was
observed against imipenem. For fluorouinolones, 47% of the isolates
were resistant to ofloxacin and 36% were resistant to levofloxacin. A
similar result to that of imipenem, but a higher percent of resistance to
ofloxacin and levofloxacin (69% and 62% respectively) was reported by
Javiya et al. (2008) and Olayinka et al. (2009). The resistance to
imipeneme, especially in P. aeruginosa, results from reduced levels of
drug accumulation or increased expression of pump efflux (Gupta et al.,
2006).
Among the aminoglycosides, amikacin has the highest activity against
P. aeruginosa (86%), which was in accordance with Smitha et al. (2005)
and Javiya et al. (2008). A comparable level of resistance of our isolates
to gentamicin (48 %) was also found by Hoštacka et al., 2006.
Resistance patterns of the current isolates to the 10 tested antimicrobials
indicated that these isolates are multiple resistant. This could be
explained by the extensive use of these antimicrobials in the treatment of
P. aeruginosa infection (McGowan, 2006)
P. aeruginosa produces several extracellular products that after
colonization can cause extensive tissue damage, bloodstream invasion,
and dissemination (Van Delden and Iglewski, 1998). It was noticed that
isolates of the same source varied greatly in the amount produced of each
studied virulence factors. So, we based our discussion on the number of
isolates from each source giving high production level.
Pyocyanin production by P. aeruginosa suppresses the acute
inflammatory response by pathogen-driven acceleration of neutrophil
apoptosis and by reducing local inflammation, and that this is
advantageous for bacterial survival (Allen et al., 2005). Our study
revealed that all P. aeruginosa isolates produced pyocyanin pigment

14
on King’s A medium at different amounts. This results support the
work achieved by Essar et al., (1990) and Ra'oof and Latif (2010), who
found that P. aeruginosa isolates which were used in their researches
produced different amounts of pyocyanin. In the present study, a
positive association was found only between pyocyanin as expressed by
the higher number in the groups of strains resistant to aminoglycosides,
quinolones, imipenem and azithromycin.
All of the strains tested produced RBCs hemolysis, a result similar to
that of Ra'oof and Latif (2010). This may be attributed to production of
two hemolysins. One of the hemolysins is a heat-labile phospholipase C
and the other is a heat-stable glycolipid. Both hemolysins are produced
during stationary phase. The proposed physiological role of these
hemolysins in the organism is to act cooperatively with alkaline
phosphatase in liberating inorganic phosphate from phospholipid (Berka
et al., 1981). Poor association between resistance to antimicrobials and
hemolysins production was noticed as high percentages of both sensitive
and resistant strains produced hemolysins. However, aminoglycosides
showed a positive association between resistance and high hemolysin
production , where a high percentage in the resistant groups gave an
elavated production level.
In the present study, the majority of urinary tract isolates produced a
higher level of haemolysis than other sources which is in accordance with
the results revealed by Berka et al. (1981) and Mittal et al. (2006), who
indicated a direct association between haemolysin production and renal
colonization.
Regardless of whether measured as total protease or elastase A
activity, the frequency of protease production as well as the number of
high level producers were elevated in the groups of strains isolated from
blood, endotracheal aspirates and burn when compared with the protease
production by strains isolated from other sites. This result was in
accordance with Woods, et al. (1986) and Furuya et al. (1993).
Biofilms are resistant to antimicrobial agents as well as to host defense
mechanisms and hence are dif
ficult to eradicate. Biofilms
contribute towards pathogenicity of P. aeruginosa as these often lead to
persistent and recurrent infections (Mittal et al., 2009). Biofilm formation
was determined using microtitre plate assay. Our data revealed that
higher number of endotracheal isolates produced substantially more
biofilms compared with isolates of other sources. Fricks-Lima et al.
(2011) reported a similar result concerning high biofilm production by
intubated patients.
Lipases of microbial origin are known to be very useful in a palette of
industrial applications. But it becomes more obvious that extracellular
lipases also play a role during microbial infections (Stehr et al., 2003). It

15
was found that high production level was observed for 76.7% and 57.7%
of wound and endotracheal isolates respectively. This may explain the
important role of this enzyme in P. aeruginosa colonization of human
skin and the respiratory tract which is correlated with an increase in lung
destruction of patients suffering from cystic fibrosis (Stehr et al., 2003).
Our data indicates that the resistance to antibiotics was not always
associated with changes in the production of the pathogenicity factors
such as hemolysins and biofilm. A positive association between
aminoglycosides resistance and pyocyanin, hemolysins and lipase
production was noticed as high percentage in the resistant group exhibited
high production levels of these virulence factors. Another association
between resistance and / or sensitivity to quinolones with pyocyanin,
protease and lipase production also was noticed. A similar result was
reported by Hoštacka et al. (2006).
We used PCR to assess the prevalence of five virulence genes among
50 of highly producer isolates. All isolates investigated in this study
possessed toxA, aprA and lasB genes. These findings were in accordance
with those from comprehensive studies carried out by Khan and Cerniglia
(1994), who used toxA amplification to detect a low level of P.
aeruginosa from environmental and clinical samples. Lanotte et al.
(2004) and Bradbury et al. (2010) reported that these genes (toxA, aprA
and lasB) to be universally present.
In contrast, the exoS and exoU genes were variable traits. exoS gene
was detected in 37 isolates (74 %), while exoU gene was detected in 47
isolates (94%). This result partially differs from those of Feltman et al.
(2001), who revealed that 72% of examined isolates contained the exoS
gene and only 28% contained the exoU gene.
The results reported by Bradbury et al. (2010) and Feltman et al.
(2001) demonstrated low prevalence (5 %) of the exoU+ exoS+ genotype
in the population tested. Unlikely, our results revealed that 68% of
examined isolates harbored both exoS and exoU genes. The difference
between the current results and those previously reported may be
attributed to the different environmental and geographical sources.
To assess the relation between plasmids and virulence genes, plasmid
extraction from the selected isolates was carried out and analyzed on 1%
agarose gel. Except for one, all isolates were harboring plasmids. Almost
all of studied virulence genes were harbored by these plasmids. toxA,
lasB and exoU genes were carried by 92% of tested isolates while aprA
and exoS genes were carried by 84.6% and 61.5% respectively.
According to previous studies, it is well known that most Gram
negative bacteria are harboring plasmids (Helling et al., 1981, Parkhill et
al., 2001 and Vivre et al., 2004). It is well known that plasmids are major

16
vectors for the dissemination of both antibiotic resistance and virulence
determinants among bacterial populations (Martínez and Baquero, 2002).
In conclusion, the present study confirmed previous observations that
the virulence of P. aeruginosa is multifactorial and relative contribution
of each of the many exoproducts implicated in virulence of P. aeruginosa
may vary depending on the site and type of infection. Resistance to
antimicrobials by P. aeruginosa isolates was not generally associated
with the level of production of the pathogenicity factors. The presence of
virulence genes (toxA, aprA and lasB) were found to be highly conserved
across the genome of P. aeruginosa, regardless of the secretion system to
which their products belonged. While a small number (26% and 6%) of
individual isolates did show absence of some of the specific virulence
factor genes tested (exoS and exoU respectively), no pattern was observed
with regard to the source of their isolation.
The high percentage of plasmids carrying many virulence genes of P.
aeruginosa may confirm their crucial role in horizontal transfer of
virulence.
Finally, further investigations are required to determine the post
antibiotic effect as well as the influence of successive subculturing on
sub-bacteriostatic concentration of chemical agents and antimicrobials on
virulence factors production. As we learn more about pathogenesis and
the mechanisms used in different sites of infection, evidence will
accumulate to better direct drug discovery efforts towards these targets.
References
• Abdi-Ali, M. Mohammadi-Mehr,
Y. Agha Alaei, (2006):
Bactericidal activity of various
antibiotics against biofilm-
producing Pseudomonas
aeruginosa. International Journal
of Antimicrobial Agents; 27:
196–200.
• Allen, L., Dockrell, D. H.,
Pattery, T., Lee, D. G.,
Cornelis, P., Hellewell, P. G.
and Whyte, M. K. B. (2005):
pyocyanin production by
Pseudomonas aeruginosa induces
neutrophil apoptosis and impairs
neutrophil-mediated host
defenses in vivo. The J. of
Immunol. ; 174: 3643-3649.
• Berka, R. M., Gray, G. L. and
Vasil, M. L. (1981): Studies of
Phospholipase C (Heat-Labile
Hemolysin) in Pseudomonas
aeruginosa. Infection and
Immunity; 34(3): 1071-1074.
• Blair, J.E., Lennette, E.H. and
Truant, J.P. (1970): Manual of
clinical microbiology. American
society for microbiology,
Bethesda, M.D. pp: 300–303.
• Bradbury, R. S., Roddam, L. F.,
Merritt, A., Reid, D. W. and
Champion, A. C. (2010):
Virulence gene distribution in

17
clinical, nosocomial and
environmental isolates of
Pseudomonas aeruginosa. J. of
Med. Microbiol.; 59: 881–890.
• Engel, J. and Balachandran, P.
(2009): Role of Pseudomonas
aeruginosa type III effectors in
disease. Current Opinion in
Microbiology; 12: 61–66.
• Essar, D.W., Eberly, L., Hadero,
A. and Crawford, I.P. (1990):
Identification and
characterization of genes for
second anthranilate synthase in
Pseudomonas aeruginosa:
interchangeability of the two
anthranilate synthases and
evolutionary implications. J. of
bacteriol.; 172 (2): 884-900.
• Feltman, H., Schulert, G.,
Khan, S., Jain, M., Peterson, L.
and Hauser, A. R. (2001):
Prevalence of type III secretion
genes in clinical and
environmental isolates of
Pseudomonas aeruginosa.
Microbiol. ; 147: 2659–2669
• Fricks-Lima, J., Hendrickson, C.
M., Allgaier, M., Zhuo, H.,
Wiener-Kronish, J. P., Lynch,
S.V. and Yang, K. (2011):
Differences in biofilm formation
and antimicrobial resistance of
Pseudomonas aeruginosa isolated
from airways of mechanically
ventilated patients and cystic
fibrosis patients. Int. J. of
Antimicrob. Agents; 37: 309-315.
• Furuya, N., Hirakata, Y.,
Tomono, K., Matsumoto, T.,
Tateda, K. Kaku, M. and
Yamaguchi, K. (1993):
Mortality rates amongst mice
with endogenous septicemia
caused by Pseudomonas
aeruginosa isolates from various
clinical sources. J. Med.
Microbiol.; 39: 141-146.
• Galloway, D. R. (1991):
Pseudomonas aeruginosa elastase
and elastolysis revisited:
recent developments.
Molecular Microbiology. 5:2315-
21.
• Govan, J. R. W. (1996):
Pseudomonas aeruginosa,
Stronotrophomonas,
Burkholderia. Mackie and
McCartney practical Medical
Microbiology. 14th ed., vol. I
Churchill- Livingstone, New
York, P: 413- 424.
• Gupta, E., Mohanty, S., Sood,
S., Dhawan, B., Das, B. K.,
Kapil, A. (2006): Emerging
resistance to Carbapenems in a
tertiary care hospital in North
India. Indian J Med Res.;124: 95–
98.
• Helling, R. B., Kinney, T. and
Adams, J. (1981): The
maintenance of plasmid-
containing organisms in
populations of Escherichia coli.
J. Gen. Microbiol.; 12: 129-41.
• Hostacká A, Majtán V,
Hybenová D. (1995):
Antimicrobial efficacy of
quaternary bisammonium salts and
the effect of their sub-MICs on
Pseudomonas aeruginosa virulence
factors. Folia Microbiol.;
40(3):283- 287.
• Iglewski, B.H. and Kabat, D.
(1975): NAD-dependent

18
inhibition of protein synthesis by
Pseudomonas aeruginosa toxin.
Proc. Natl. Acad. Sci.USA; 72:
2284–2288.
• Javiya, V. A., Ghatak, S. B.,
Patel, K. R. and Patel, J. A.
(2008): Antibiotic susceptibility
patterns of Pseudomonas
aeruginosa at a tertiary care
hospital in Gujarat, India. Indian
J. Pharmacol.; 40(5): 230–234.
• Kessler, E., Safrin, M., Olson, J.
C. and Ohman, D. E. (1993):
Secreted LasA of Pseudomonas
aeruginosa is a staphylolytic
protease. J Biol Chem.;
268:7503-7508.
• Kessler E, Safrin M, Abrams
WR, Rosenbloom J, Ohman
DE. (1997): Inhibitors and
Specificity of Pseudomonas
aeruginosa LasA. J. Biol. Chem.;
272:9884-9889.
• Khan, A. A. and Cerniglia, C. E.
(1994): Detection of
Pseudomonas aeruginosa from
clinical and environmental
samples by amplification of the
exotoxinA gene using PCR.
Applied and Environmental
Microbiology; 60: 3739-3745.
• King, E. O., Ward, M. and
Pianey, D. (1954): Two simple
media for the demonstration of
pyocyanin fluorescin
.J.Lab.Clin.Med.; 44: 301.
• Kipnis, E., Sawa, T. and Wiener-
Kronish, J. (2006): Targeting
mechanisms of Pseudomonas
aeruginosa pathogenesis.
Médecine et maladies
infectieuses; 36: 78–91
• Kumar, S., Kilon, K., Upadhyay,
A., Kanwar, S.S. and Gupa, R.,
(2005): Production, purification
and characterization of lipase
from thermophilic and
alkaliphilic Bacillus coagulans
BTS-3. Protein Expression and
Purification; 41: 38-44.
• Kurachi, M. (1958): Studies of
the biosynthesis of pyocyanin
(II). Bull Inst Chem Res., Kyoto
University. 36, 174-87.
• Lanotte, P., Watt, S., Mereghetti,
L., Dartiguelongue, N.,
Rastegar-Lari, A., Goudeau, A.
and Quentin, R. (2004): Genetic
features of Pseudomonas
aeruginosa isolates from cystic
fibrosis patients compared with
those of isolates from other
origins. J. of Med. Microbiol.;
53: 73–81
• Liu, P.V. (1974): Extracellular
toxins of Pseudomonas
aeruginosa. J. Infect. Dis.;
130(Suppl.): 94–99.
• Mah, T. F. and O’Toole. G. A.
(2001): Mechanisms of biofilm
resistance to antimicrobial agents.
Trends Microbiol.; 9:34–39.
• Martínez, J. L., and Baquero, F.
(2002): Interactions among
Strategies Associated with
Bacterial Infection: Pathogenicity,
Epidemicity, and Antibiotic
Resistance. Clinical Microbiology
Reviews; 15: 647–679.
• Matsumoto, K. (2004): Role of
bacterial proteases in
pseudomonal and serratial

19
keratitis. Biol. Chem.; 385:1007-
1016.
• McGowan, J. E., Jr. (2006):
Resistance in non-fermenting
Gram-negative bacteria:
Multidrug resistance to the
Maximum. Amer. J. Med.,
119(6A): 529-536.
• Mesaros N., Nordmann, P.,
Ple´siat, P., Roussel-Delvallez,
M., Van Eldere, J.,
Glupczynski, Y., Van Laethem,
Y., Jacobs, F., Lebecque, P.,
Malfroot, A., Tulkens, P. M.
and Van Bambeke, F. (2007):
Pseudomonas aeruginosa:
resistance and therapeutic options
at the turn of the new millennium.
Clin. Microbiol. Infect.; 13: 560–
578.
• Mittal, R., Aggarwal, S.,
Sharma, S., Chhibber, S. and
Harjai, K. (2009): Urinary tract
infections caused by
Pseudomonas aeruginosa: A
minireview. J. of Infect. and
Public Health; 2: 101—111.
• Mittal, R., Khandwaha, R. K.,
Gupta,V., Mittal, P.K. and
Harjai, K. (2006): Phenotypic
characters of urinary isolates of
Pseudomonas aeruginosa & their
association with mouse renal
colonization. Indian J. Med. Res.;
123: 67-72
• Nakazawa, T., Yamada, Y. and
Ishibashi, M. (1987):
Characterization of hemolysin in
extracellular products of
Pseudomonas cepacia. J.Clin.
Microbiol., 25:195-198.
• NCCLS, (2003): Performance
standards for antimicrobial disk
susceptibility tests, 8th ed.
Approved standard M2-A8.
National Committee for Clinical
Laboratory Standards, Wayne,
Pa.
• Olayinka, A. T. , Olayinka, B.
O. and Onile, B. A. (2009):
Antibiotic susceptibility and
plasmid pattern of Pseudomonas
aeruginosa from the surgical
unit of a university teaching
hospital in north central Nigeria.
International Journal of
Medicine and Medical Sciences;
1(3): 079-083.
• Parkhill, J., Dougan, G., and
James, K. D. (2001): Complete
genome sequence of a
multiple drug resistant
Salmonella enterica serovar
Typhi CT18. Nature 413:848-52.
• Parsons, J. F., Greenhagen, B.
T., Shi , K., Calabrese, K.,
Robinson, H. and Ladner, J. E.
(2008): Structural and functional
analysis of the pyocyanin
biosynthetic protein PhzM from
Pseudomonas aeruginosa.
Biochem.; 46(7): 1821–1828.
• Ralli, P. and O’Donovan. G. A.
(2005): Impaired virulence factor
production in a dihydroorotate
dehydrogenase mutant (pyrD) of
Pseudomonas aeruginosa.
Dissertation Prepared for the
Degree of Doctor of Philosophy,
North Texas University, Denton,
Tex.: 22-23
• Ra'oof, W. M. and Latif, I. A.
(2010): In vitro study of the

20
swarming phenomena and
antimicrobial activity of
pyocyanin produced by
Pseudomonas aeruginosa isolated
from different human infections.
Eur. J. of Sci. Research; 47: 405-
421
• Rossignol, G., Merieau, A.,
Guerillon, J., Veron, W.,
Lesouhaitier, O., Feuilloley, M.
G. and Orange, N. (2008):
Involvement of a phospholipase
C in the hemolytic activity of a
clinical strain of Pseudomonas
fluorescens. BMC Microbiol.;
8:189- 203.
• Sitkiewicz, I., Stockbauer, K. E.
and Musser, J. M. (2007):
Secreted bacterial phospholipase
A2 enzymes: better living
through phospholipolysis. Trends
Microbiol.; 15: 63-69.
• Smitha, S., Lalitha, P., Prajna, V.
N. and Srinivasan, M. (2005):
Susceptibility trends of
Pseudomonas species from
corneal ulcers. Indian J Med
Microbiol.; 23:168–71.
• Snell, K., Holder, I., Leppla, S.
and Sealinger, S. B. (1978):
Role of exotoxin and protease as
possible virulence factor in
experimental infections with
Pseudomonas aeruginosa. J.
Infec. Immun.; 16: 839-845.
• Sokol, P. A., Ohman, D. E. and
Iglewski, B. H. (1979): A more
sensitive plate assay for detection
of protease production by
Pseudomonas aeruginosa. J. of
clin. microbiol.; 9 (4): 538-540.
• Stehr, F., Kretschmar, M.,
Kröger, C., Hube, B. and
Schäfer, W. (2003): Microbial
lipases as virulence factors. J. of
Molecular Catalysis B:
Enzymatic; 22: 347–355.
• Stepanovic', S., Vukovic, D.,
Dakic, I., Savic B. and Svabic-
Vlahovic, M. (2000): A modified
microtiter-plate test for
quantification of staphylococcal
biofilm formation. J. Microbiol.
Methods, 40: 175-179.
• Sutter, V. (1968): Identification of
Pseudomonas species isolated
from hospital environment and
human sources. Appl. Microbiol.,
16: 1532-1538.
• Van Delden, C. and Iglewski, B.
H. (1998): Cell-to-Cell Signaling
and Pseudomonas aeruginosa
Infections. Emerging Infectious
Diseases; 4: 551-560
• Wolf, P. and Elsasser-Beile, U.
(2009): Pseudomonas exotoxin
A: From virulence factor to anti-
cancer agent. International J. of
Med. Microbiol. 299: 161–176
• Woods, D., Schaffer, D. S.,
Rabin, H. R., Campbell, G. D.
and Sokol, P. A. (1986):
Phenotypic comparison of
Pseudomonas aeruginosa strains
isolated from a variety of clinical
sites. J. of Clin. Microbiol.; 24:
260-264.

21
ﺱﺎﻧﻮﻣﻭﺩﻮﺴﻟﺍ ﺕﺍﺮﺘﻌﻟ ﺓﻭﺍﺮﻀﻟﺍ ﻞﻣﺍﻮﻋ ﺾﻌﺒﻟ ﺔﻴﺛﺍﺭﻮﻟﺍﻭ ﺔﻳﺮﻫﺎﻈﻟﺍ ﺹﺍﻮﺨﻟﺍ ﺪﻳﺪﺤﺗ
ﻝﺍ ﺍﺯﻮﻨﻴﺠﻳﻭﺭﺍ ﻦﻣ ﺔﻟﻭﺰﻌﻣ ﺔﻌﻣﺎﺟ ﺕﺎﻴﻔﺸﺘﺴﻣ ﻦﻣ ﺔﻔﻠﺘﺨﻣ ﺔﻴﻜﻴﻨﻴﻠﻛﺍ ﺭﺩﺎﺼﻣ
.ﺓﺭﻮﺼﻨﻤﻟﺍ
ﺪﻴﻋ ﺎﻨﻳﺩ
ﻭ ﺭﺎﺠﻨﻟﺍ ﻞﺋﺍﻭ ﻭ ﻯﺮﻜﺴﻟﺍ ﻝﺩﺎﻋ ﺪﻤﺤﻣ ﻭ ﺓﻭﺮﺑ ﺎﺷﺭ
ﺔﻟﺪﻴﺼﻟﺍ ﺔﻴﻠﻛ - ﻲﺟﻮﻟﻮﻴﺑﻭﺮﻜﻴﻤﻟﺍ ﻢﺴﻗ–.ﺓﺭﻮﺼﻨﻤﻟﺍ ﺔﻌﻣﺎﺟ
ﻝﻭﺎﻨﺘﻳ ﺍﺬﻫ ﺔﺳﺍﺭﺩ ﺚﺤﺒﻟﺍ ﺔﻴﺑﻭﺮﻜﻴﻤﻟﺍ ﺔﻳﻮﻴﺤﻟﺍ ﺔﻘﺒﻄﻟﺍ ﻦﻳﻮﻜﺗﻭ ﺓﻭﺍﺮﻀﻟﺍ ﻞﻣﺍﻮﻋ ﺾﻌﺒﻟ ﺔﻧﺭﺎﻘﻣ
ﺔﻌﻣﺎﺟ ﺕﺎٮﻔﺸﺘﺴﻣ ﻦﻣ ﺔﻔﻠﺘﺨﻣ ﺔﻴﻜﻴﻨﻴﻠﻛﺍ ﺭﺩﺎﺼﻣ ﻦﻣ ﺎﻬﻟﺰﻋ ﻢﺗ ﻰﺘﻟﺍ ﺍﺯﻮﻨﻴﺠﻳﺭﻭﺍ ﺱﺎﻧﻮﻣﻭﺩﻮﺴﻟﺍ ﺎﻳﺮﻴﺘﻜﺒﻟ
ﻦﻋ ﺔﻟﻮﺌﺴﻤﻟﺍ ﺕﺎﻨﻴﺠﻟﺍ ﺪﻳﺪﺤﺘﻟ ﺔﻴﻨﻴﺠﻟﺍ ﺔﻘﻳﺮﻄﻟﺎﺑ ﻭ ﺕﺍﺮﺘﻌﻟﺍ ﻞﻜﻟ ﻱﺮﻫﺎﻈﻟﺍ ﺪﻳﺪﺤﺘﻟﺍ ﻖﻳﺮﻁ ﻦﻋ ﺓﺭﻮﺼﻨﻤﻟﺍ
.ﺓﻭﺍﺮﺿ ﺮﺜﻛﻷﺍ ﺕﺍﺮﺘﻌﻟﺍ ﻚﻠﺗ ﻦﻣ ﺾﻌﺒﻟ ﺮﺧﻷﺍ ﺾﻌﺒﻟﺍ ﻝﺰﻋ ﻢﺗ ﺪﻘﻟ ﻭ 98 ﻦﻣ ءﺍﺰﺟﺃ ﻦﻣ ﺓﺫﻮﺧﺄﻣ ﺕﺎﻨﻴﻋ ﻞﻤﺸﺗ ﺍﺯﻮﻨﻴﺠﻳﺭﻭﺍ ﺱﺎﻧﻮﻣﻭﺩﻮﺴﻟﺍ ﻦﻣ ﻩﺮﺘﻋ
ﻕﻭﺮﺤﻟﺍ ﻭ ﻝﻮﺒﻟﺍ ﻭ ﺔﻴﺋﺍﻮﻬﻟﺍ ﺔﺒﺼﻘﻠﻟ ﻰﻠﺧﺍﺪﻟﺍ ﺏﻮﺒﻧﻷﺍ ﻰﻋﺎﺨﻨﻟﺍ ﻞﺋﺎﺴﻟﺍ ﻭ ﻕﺎﺼﺒﻟﺍﻭ ﻡﺪﻟﺍ ﻭ ﻥﺫﻷﺍ ﻭ ﺡﻭﺮﺠﻟﺍﻭ
. ﻯﺮﺧﺃ ﺭﺩﺎﺼﻣ ﻭ
ﻡﺍﺪﺨﺘﺳﺎﺑ ﺔﻴﺑﻭﺮﻜﻴﻣ ﺕﺍﺩﺎﻀﻣ ﺮﺸﻋ ﺩﺪﻌﻟ ﺔﻟﻭﺰﻌﻤﻟﺍ ﺕﺍﺮﺘﻌﻟﺍ ﺔﻴﺳﺎﺴﺣ ﺔﺳﺍﺭﺩ ﻢﺗ ﺔﺳﺍﺭﺪﻟﺍ ﻩﺬﻫ ﻲﻓﻭ
ﻞﻛ ﺖﻧﺎﻛ ,ﺔﻴﻠﻋﺎﻓ ﺮﺜﻛﻻﺍ ﻢﻨﻴﺒﻴﻣﻹﺍ ﻭ ﻦﻴﺳﺎﻜﻴﻣﻷﺍ ﻥﺎﻛ ﺎﻤﻨﻴﺑ ﻭ .ﻲﺑﻭﺮﻜﻴﻤﻟﺍ ﺩﺎﻀﻤﻟﺍ ﺹﺮﻗ ﻦﻣ ﺭﺎﺸﺘﻧﻻﺍ ﺔﻘﻳﺮﻁ
ﻲﻗﺎﺑ ﺎﻣﺃ .ﻢﻴﺒﻴﻔﻴﺴﻟﺍﻭ ﻢﻴﺴﻛﺎﺗﻮﻔﻴﺳ ﻭ ﻞﻴﺴﻛﻭﺭﺩﺎﻔﻴﺳ ﻭ ﻚﻴﻧﻻﻮﻴﻓﻼﻜﻟﺍ ﺾﻤﺣ -ﻦﻴﻠﻴﺳﺎﺴﻛﻮﻣﻸﻟ ﺔﻣﻭﺎﻘﻣ ﺕﻻﺰﻌﻟﺍ
.ﺔﻴﺳﺎﺴﺤﻟﺍ ﺕﺎﺟﺭﺩ ﻲﻓ ﺔﺗﻭﺎﻔﺘﻣ ﺎﺒﺴﻧ ﺕﺮﻬﻅﺃ ﺪﻘﻓ ﺕﺍﺩﺎﻀﻤﻟﺍ
ﻦﻴﻧﺎﻴﺳﻮﻴﺒﻟﺍ ﺔﻐﺒﺻ ﺖﺠﺘﻧﺃ ﺪﻗ ﺕﻻﺰﻌﻟﺍ ﻞﻛ ﻥﺃ ﺓﻭﺍﺮﻀﻟﺍ ﻞﻣﺍﻮﻌﻟ ﻱﺮﻫﺎﻈﻟﺍ ﺪﻳﺪﺤﺘﻟﺍ ﺞﺋﺎﺘﻧ ﺖﺘﺒﺛﺃﺪﻘﻟ ﻭ
ﺖﻄﻋﺃ ﻚﻟﺬﻛ ﻭ.ﺮﺒﻛﺃ ﺕﺎﻴﻤﻛ ﺖﻄﻋﺍ ﻝﻮﺒﻟﺍ ﻦﻣ ﺔﻟﻭﺰﻌﻤﻟﺍ ﺕﺍﺮﺘﻌﻟﺍ ﻦﻜﻟﻭ76 ﺕﺍﺮﻛ ﺮﻴﺴﻜﺗ ﻦﻣ ﺔﻴﻟﺎﻋ ﺔﺒﺴﻧ ﺔﻟﺰﻋ
ﺞﺋﺎﺘﻨﻟﺍ ﺖﻧﺎﻛ ﺪﻘﻓ ﻯﺩﻮﻘﻨﻌﻟﺍ ﺭﻮﻜﻤﻠﻟ ﻞﻠﺤﻤﻟﺍ ﻁﺎﺸﻨﻟﺍ ﻭ ﻰﻠﻜﻟﺍ ﺯﺎﻴﺗﻭﺮﺒﻟﺍ ﺝﺎﺘﻧﺎﺑ ﻖﻠﻌﺘﻳ ﺎﻤﻴﻓ ﻭ . ءﺍﺮﻤﺤﻟﺍ ﻡﺪﻟﺍ
ﻰﻓ ﺔﻴﺑﺎﺠﻳﺍ81 ﺔﺒﺼﻘﻟﺍ ﻭ ﻡﺪﻟﺍ ﻦﻣ ﺔﻟﻮﺼﻔﻤﻟﺍ ﺕﻻﺰﻌﻟﺍ ﻦﻴﺑ ﻦﻣ ﻥﺎﻛ ﻚﻟﺬﻟ ﻁﺎﺸﻧ ﻰﻠﻋﺃ ﻥﺃ ﻆﺣﻮﻟ ﻭ ﺔﻟﺰﻋ
ﻼﻛ ﻦﻣ ﺔﻟﻮﺼﻔﻤﻟﺍ ﺕﻻﺰﻌﻟﺍ ﺖﻧﺎﻛ ﺚﻴﺣ ﺯﺎﺒﻴﻠﻟﺍ ﻢﻳﺰﻧﺍ ﺝﺎﺘﻧﻻ ﺔﺒﺴﻨﻟﺎﺑ ﺔﻴﺑﺎﺠﻳﺍ ﺕﻻﺰﻌﻟﺍ ﻢﻈﻌﻣ ﺖﻧﺎﻛ ﻭ .ﺔﻴﺋﺍﻮﻬﻟﺍ
ﻥﺎﻛ ﺔﻳﻮﻴﺤﻟﺍ ﺔﻴﺑﻭﺮﻜﻴﻤﻟﺍ ﺔﻘﺒﻄﻟﺍ ﻦﻳﻮﻜﺗ ﻥﺃ ﺞﺋﺎﺘﻨﻟﺍ ﺕﺮﻬﻅﺃﻭ .ﺔﻴﺟﺎﺘﻧﺍ ﻰﻠﻋﺃ ﺔﻴﺋﺍﻮﻬﻟﺍ ﺔﺒﺼﻘﻟﺍ ﻭ ﺡﻭﺮﺠﻟﺍ ﻦﻣ
ﻰﻓ ﺓﻮﻘﺑ ﺎﻅﻮﺤﻠﻣ18.ﺔﻴﺋﺍﻮﻬﻟﺍ ﺔﺒﺼﻘﻟﺍ ﺕﻻﺰﻋ ﺔﻄﺳﺍﻮﺑ ﻥﺎﻛ ﺎﻬﻨﻳﻮﻜﺗ ﻦﻣ ﻯﻮﺘﺴﻣ ﻰﻠﻋﺃ ﻥﺃﻭ ﺔﻟﺰﻋ
ﻰﻓ ﺕﺎﻨﻴﺟ ﺔﺴﻤﺨﻟ ﻯﺮﺧﻷﺍ ﺓﻭﺍﺮﻀﻟﺍ ﻞﻣﺍﻮﻋ ﺾﻌﺑ ﻦﻋ ﺔﻟﻮﺌﺴﻤﻟﺍ ﺕﺎﻨﻴﺠﻟﺍ ﻰﻠﻋ ﻑﺮﻌﺘﻟﺍ ﻢﺗ ﻚﻟﺬﻛ50 ) ﻞﺴﻠﺴﺘﻤﻟﺍ ﺓﺮﻤﻠﺒﻟﺍ ﻞﻋﺎﻔﺗ ﺔﻘﻳﺮﻄﺑ ﺓﻭﺍﺮﺿ ﺮﺜﻛﻷﺍ ﺕﻻﺰﻌﻟﺍ ﻦﻣ ﺔﻟﺰﻋPCR ﺔﺒﺴﻨﻟﺎﺑ ﺞﺋﺎﺘﻨﻟﺍ ﺕﺮﻬﻅﺃﻭ ( ﻦﻴﺠﻟ(toxA) ﻰﺟﺭﺎﺨﻟﺍ ﻦﻴﺗﻭﺮﺒﻟﺍ ﺝﺎﺘﻧﺍ ﻦﻋ ﻝﻮﺌﺴﻤﻟﺍ A ﻭ (aprA) ﺯﺎﻴﺗﻭﺮﺒﻟﺍ ﻢﻳﺰﻧﺍ ﺝﺎﺘﻧﺍ ﻦﻋ ﻝﻮﺌﺴﻤﻟﺍ
ﻭ ﻯﺪﻋﺎﻘﻟﺍlasB) ﺰﻴﺘﺴﻟﻻﺍ ﻢﻳﺰﻧﺍ ﺝﺎﺘﻧﺍ ﻦﻋ ﻝﻮﺌﺴﻤﻟﺍ ( B ﺔﺒﺴﻨﺑ ﺓﺪﺟﺍﻮﺘﻣ ﺎﻬﻧﺍ 100 ﻦﻴﺟ ﻰﻟﺇ ﺔﺒﺴﻨﻟﺎﺑﻭ % )exoS) ﺝﺎﺘﻧﺍ ﻦﻋ ﻝﻮﺌﺴﻤﻟﺍ (exoenzyme S ﻝﺪﻌﻤﺑ ﺪﺟﺍﻮﺗ ﺪﻘﻓ (74ﻦﻴﺟﻭ % )exoU ﻦﻋ ﻝﻮﺌﺴﻤﻟﺍ ( ) ﺝﺎﺘﻧﺍexoenzyme U ﺔﺒﺴﻨﺑ ﺍﺪﺟﺍﻮﺘﻣ ﻥﺎﻛ (94 ﻦﻣ ﺕﺍﺪﻴﻣﺯﻼﺒﻟﺍ ﺹﻼﺨﺘﺳﺍ ﺮﻬﻅﺃ ﺪﻘﻟ ﻭ. %14 ﺔﻟﺰﻋ
ﻰﻓ ﺕﺎﻨﻴﺠﻟﺍ ﻚﻠﺗ ﺩﻮﺟﻭ13.ﺎﻬﺘﻴﺒﻟﺎﻏ ﻰﻓ ﺓﺩﻮﺟﻮﻣ ﺓﺮﺒﺘﺨﻤﻟﺍ ﺕﺎﻨﻴﺠﻟﺍ ﺖﻧﺎﻛ ﻚﻟﺬﻛ ﻭ ﺎﻬﻨﻣ
ﻞﻣﺍﻮﻌﻟﺍ ﺓﺩﺪﻌﺘﻣ ﺍﺯﻮﻨﻴﺠﻳﺭﻭﺍ ﺱﺎﻧﻮﻣﻭﺩﻮﺴﻟﺍ ﺓﻭﺍﺮﺿ ﻥﺄﺑ ﺔﻘﺑﺎﺴﻟﺍ ﺕﺎﻈﺣﻼﻤﻟﺍ ﺔﺳﺍﺭﺪﻟﺍ ﻩﺬﻫ ﺕﺪﻛﺃﻭ
ﻉﻮﻧﻭ ﻊﻗﻮﻤﻟﺍ ﺐﺴﺣ ﻒﻠﺘﺨﺗ ﺪﻗ ﺓﻭﺍﺮﻀﻟﺍ ﻩﺬﻫ ﻲﻓ ﺔﻌﻟﺎﻀﻟﺍ ﺔﻴﺟﺭﺎﺨﻟﺍ ﺞﺗﺍﻮﻨﻟﺍ ﻦﻣ ﻞﻜﻟ ﺔﻴﺒﺴﻨﻟﺍ ﺔﻤﻫﺎﺴﻤﻟﺍﻭ
.ﻯﻭﺪﻌﻟﺍ.ﺓﻭﺍﺮﻀﻟﺍ ﻞﻣﺍﻮﻌﻟ ﻰﻘﻓﻷﺍ ﻝﺎﻘﺘﻧﻻﺍ ﻰﻓ ﻡﺎﻬﻟﺍ ﺭﻭﺪﻟﺍ ﺪﻛﺆﺗ ﺕﺍﺪﻴﻣﺯﻼﺒﻟﺎﺑ ﺔﺻﺎﺨﻟﺍ ﺕﺎﺳﺍﺭﺪﻟﺍ ﻥﺃ ﻭ