Regulation of IGF2 transcript and protein expression by altered methylation in breast cancer

Abstract

Breast Cancer is one of the leading causes of cancer deaths among women worldwide. The role of epigenetics as a distinct mechanism to alter gene expression in a tissue-specific manner has emerged as an important mechanism in the pathophysiology of cancer. Present study was carried out to assess the role of methylation in regulating transcription and protein expression of Insulin-like growth factor 2 (IGF2), an oncogene with parental imprinting.
Paraffin-embedded archival breast tumor and adjacent normal tissue samples were used for carrying out PCR-based methylation assay, genomic PCR, immunohistochemistry and Real-Time Reverse transcriptase PCR.
A significant loss of methylation in exon 9 CpG cluster of IGF2 in breast tumor tissues was observed when compared to normal tissue (P < 0.0001). Expression of IGF2 by immunohistochemistry exhibited a mean twofold increase correlating with the hypomethylation of this specific CpG. Real-Time RT PCR showed increased transcripts in the tumor tissue supporting the IHC and methylation results. A total of 33% of tumor samples heterozygous for the ApaI IGF2 polymorphism exhibited biallelic IGF2 expression due to loss of imprinting; this was not seen in any of the normal breast tissues.
Altered methylation of exonic CpG plays an important role in the enhanced transcription/expression of IGF2 in breast tumors. Methylation analysis of exon 9 CpG can be used as a biomarker for upregulation of IGF2 in breast tumor tissue and maybe developed as a diagnostic test in future.

Full text

ORIGINAL PAPER
Regulation of IGF2 transcript and protein expression
by altered methylation in breast cancer
Preetha J. Shetty •Sireesha Movva •Nagarjuna Pasupuleti •Bhavani Vedicherlla •
Kiran K. Vattam •Sambasivan Venkatasubramanian •Yog R. Ahuja •
Qurratulain Hasan
Received: 26 March 2010 / Accepted: 9 April 2010
ÓSpringer-Verlag 2010
Abstract
Purpose Breast Cancer is one of the leading causes of
cancer deaths among women worldwide. The role of epi-
genetics as a distinct mechanism to alter gene expression in
a tissue-specific manner has emerged as an important
mechanism in the pathophysiology of cancer. Present study
was carried out to assess the role of methylation in regu-
lating transcription and protein expression of Insulin-like
growth factor 2 (IGF2), an oncogene with parental
imprinting.
Methods Paraffin-embedded archival breast tumor and
adjacent normal tissue samples were used for carrying out
PCR-based methylation assay, genomic PCR, immunohis-
tochemistry and Real-Time Reverse transcriptase PCR.
Results A significant loss of methylation in exon 9 CpG
cluster of IGF2 in breast tumor tissues was observed when
compared to normal tissue (P\0.0001). Expression of
IGF2 by immunohistochemistry exhibited a mean twofold
increase correlating with the hypomethylation of this
specific CpG. Real-Time RT PCR showed increased
transcripts in the tumor tissue supporting the IHC and
methylation results. A total of 33% of tumor samples
heterozygous for the ApaI IGF2 polymorphism exhibited
biallelic IGF2 expression due to loss of imprinting; this
was not seen in any of the normal breast tissues.
Conclusions Altered methylation of exonic CpG plays an
important role in the enhanced transcription/expression of
IGF2 in breast tumors. Methylation analysis of exon 9 CpG
can be used as a biomarker for upregulation of IGF2 in
breast tumor tissue and maybe developed as a diagnostic
test in future.
Keywords Epigenetics IGF2 methylation 
Breast cancer Loss of imprinting
Introduction
Breast Cancer (BC) is a debilitating disease that affects one
of nine women in their lifetime and is the leading cause of
morbidity and mortality (Jemal et al. 2003). An estimated
1.15 million cases of BC are reported worldwide every
year. More than half of these are in industrialized countries.
The incidence is more modest in Eastern Europe, South
America, Southern Africa and Western Asia, but it is still
the commonest cancer of women in these geographic
regions (Coughlin and Dkwueme 2009). In India, it is the
second most frequent oncological disease among women,
after cervical cancer (Okonkwo et al. 2008).
BC is either familial or sporadic, and up to 5–10% are
due to the inheritance of mutation in BRCA1 or BRCA2
(Claus et al. 1996); women carrying these mutations have a
P. J. Shetty S. Movva B. Vedicherlla 
Y. R. Ahuja Q. Hasan
Department of Genetics, Vasavi Medical & Research Centre,
Khairatabad, Hyderabad 500004, India
N. Pasupuleti
Kamineni Life Sciences, Moula-Ali, Hyderabad 500040, India
K. K. Vattam Q. Hasan (&)
Department of Genetics and Molecular Medicine,
Kamineni Hospitals, L.B. Nagar, Hyderabad 500068, India
e-mail: qhasan2000@yahoo.com
S. Venkatasubramanian
Department of Genetics, Bhagwan Mahavir Medical Research
Centre, A.C Gaurds, Hyderabad 500001, India
123
J Cancer Res Clin Oncol
DOI 10.1007/s00432-010-0890-z

lifetime risk of 60–80% (Easton et al. 1993; Struewing
et al. 1996). However, several studies including one from
our group did not find any association of BRCA1 mutation
with sporadic BC, but BRCA1 gene silencing by methyl-
ation was found to have an important role in its etiology
(Bhavani et al. 2009; Dobrovic and Simpfendorfer 1997;
Futreal et al. 1994; Merajver et al. 1995).
The role of epigenetics as a distinct and crucial mech-
anism to regulate a variety of genes in a tissue-specific
manner has emerged as an important mechanism in the
pathophysiology of cancer (Yang et al. 2001).DNA
methylation is an essential method for the regulation of
gene expression in mammalian cells (Eden and Cedar
1994).Methylation occurs at cytosine residues within CpG
dinucleotides, and many genes are enriched with these
dinucleotides in their promoters and exons (Yagi et al.
2008). These sequences are non-methylated when the gene
is transcriptionally active and methylated when inactive
(Murrell et al. 2008).
Insulin-like growth factor 2 (IGF2) is a member of the
IGF family. It is a circulating peptide hormone and locally
acting growth factor with both paracrine and autocrine
functions (Elzagheid et al. 2006; Lu et al. 2006). IGF2 gene
is localized at chromosome 11p15.5 and is flanked by the
insulin and H19 genes in a region that is known to have
differential parental methylation. This was the first auto-
somal gene identified to exhibit imprinting. IGF2 gene is
associated with CpG regions that have allele-specific DNA
methylation known as differentially methylated regions
(DMRs).
IGF2 consists of nine exons in humans; the first few are
non-coding leader exons, while exons 6–9 encode pre-pro-
IGF2 polypeptide. There are four CpG islands within the
IGF2 gene: the first CpG island maps between the first two
untranslated exons and is found to be fully methylated on
both alleles in all tissues. The second and third CpG islands
(DMR0) map to the promoter 2, 4 (P2-P4) and the IGF2
antisense (IGF2-AS) transcripts, and this region is fully
unmethylated in all tissues; however, a subsequent study
showed that the paternal DMR0 is fully methylated con-
tradicting the previous studies (Murrell et al. 2008; Cui
et al. 2003). The final CpG island maps to exon 9, which
has previously been defined as DMR in both human and
mouse, with the paternal allele being more methylated than
the maternal allele (Feil et al. 1994). The present study is
the first to assess the methylation status of the exon 9 CpG
cluster in samples from BC and neighboring normal breast
tissue by PCR-based methylation assay. The IGF2
expression was evaluated by immunohistochemistry (IHC)
and Real-time Reverse Transcriptase (RT) PCR. RT PCR
was carried out in samples identified as ApaI heterozygotes
to determine loss of imprinting (LOI) of the maternal IGF2
allele.
Materials and methods
Samples
A total of 93 archival paraffin-embedded breast cancer
tissue that had more than 70% of tumor cells on visuali-
zation with H&E staining and adjacent normal tissue
blocks with no tumor cells on H&E examination were
obtained from the pathology department of Kamineni
Hospitals, L.B. Nagar, Hyderabad, India, after obtaining
institutional ethical clearance. Consecutive tissue sections
of 4 lM were cut from paraffin blocks for DNA and RNA
isolation, as well as for carrying out IHC.
Genomic DNA isolation
DNA was isolated from the paraffin-embedded tissue sec-
tions as per the established method from our laboratory
(Mohan et al. 2006). The paraffin wax was first removed
and treated with cell lysis buffer (10 mM Tris–HCl,
10 mM KCl, 10 mM MgCl2, 2 mM EDTA, 0.4 M NaCl),
10% SDS and proteinase K solution (1 mg/ml) (Merck,
Germany). At the end of 30-min incubation, 6 M NaCl was
added to precipitate the proteins, and DNA was precipi-
tated using isopropanol. The DNA obtained was dissolved
in 100 ll of Tris EDTA (TE) buffer and was stored at
-20°C until processed.
PCR-based methylation assay
Approximately 0.5 lg of DNA obtained was incubated
with 20 units of the methylation-specific restriction endo-
nuclease HpaII (cat # ER0511; MBI, Fermentas, USA),
which recognizes the methylated sequence 50-C
;
CGG -30,
at 37°C for 14 h. The digested DNA was subjected to PCR
amplification with the primer sets designed by using Primer
3 plus Software (SourceForge, Inc., USA) encompassing
the CpG clusters in the exon 9 region of IGF2 gene. The
Forward Primer: 50- GAAGATGCTGCTGTGCTTCC -30
and the Reverse Primer: 50- AGTGAGCAAAACTGCCG
C-3
0were synthesized commercially at Bioserve Biotech-
nologies, Hyderabad (India). Genomic PCR without HpaII
digestion for each sample was used as internal control.
A three-step PCR by the method reported from our
group (Mohan et al. 2006) was carried out using XP ther-
mal cycler (UV Gene, UK). The PCR conditions included
an initial denaturation at 94°C for 5 min, followed by
35 cycles of denaturation at 94°C for 30 s, annealing at
57°C for 30 s and extension at 72°C for 45 s, final exten-
sion at 72°C for 5 min. The PCR products were then
electrophoresed on 2% agarose gel, and amplified bands
were analyzed in UV I Tech gel documentation system
(Cambridge, UK). Undigested DNA of each sample was
J Cancer Res Clin Oncol
123

used as an internal control. All other appropriate controls
were set up with each batch of BC samples processed.
Immunohistochemistry (IHC)
The IGF2 expression was analyzed using IHC in 40 paired
tumor and adjacent normal tissue samples. A total of 80
slides were processed for IHC using the commercially
available anti-IGF2 antibody (Cat # ab9764; Abcam, Ber-
lin, Germany; 1:1000 dilutions). Staining was performed
manually by the method recently published by our group
(Movva et al. 2009). Briefly, slides were deparaffinized
using xylene and graded ethyl alcohols and then rinsed in
water. After 3% hydrogen peroxidase block for 30 min,
antigen retrieval was performed by boiling slides in antigen
retrieval solution in a microwave oven at maximum power
for 4 min and at half maximum power for 12 min, followed
by a 30-min cool-down and rinsing in wash buffer. Slides
were then sequentially treated with the following reagents
in a humidified chamber at room temperature: 10% normal
goat serum for 30 min, anti-IGF2 antibody overnight,
secondary antibody for 30 min, signal amplification and
chromogen development for 30 min each (wash buffer
steps were included between each step). Stained slides
were then counterstained with hematoxylin. Each run
included appropriate controls.
Slides were then analyzed for IGF2 expression. Semi
quantitative scoring was performed at a magnification of
9400. From each section, five regions were captured using
a charge-coupled device camera attached to Nikon E400
microscope (Japan). Expression was scored on the basis of
intensity as follows: 0, absent or no expression; 0.5, mild
expression; 1, moderate expression; 2, high expression and
3, intense expression. Two independent, unbiased scorers
who were blinded to the origin of the histological specimen
performed the analysis. Different sections from each tumor
and normal sample were scored, and a mean of that was
taken for analysis. Any discrepancies in scores were
resolved by discussion with a pathologist as described
earlier (Movva et al. 2009).
Genomic PCR and RFLP
The patient tissue DNA was used for screening heterozy-
gous samples. Genomic DNA PCR was carried out using
IGF2 exon 9 ApaI polymorphism-specific primers; For-
ward primer: 50- CTTGGACTTTGAGTCAAATTGG -30;
Reverse primer 50- GGTCGTGCCAATTACATTTCA -30
(Dai et al. 2007) followed by RFLP using ApaI Restriction
Enzyme. The A allele (not digested by ApaI) and B alleles
(Digested by ApaI) are 292 and 229 bp, respectively.
Samples that were heterozygous A/B at the ApaI poly-
morphism were selected for RNA isolation.
RNA extraction and purification
Total RNA was isolated from eleven tumor and normal
formalin-fixed paraffin-embedded tissue sections heterozy-
gous for ApaI polymorphism using a Quick Extract FFPE
RNA Extraction Kit (cat #QFR82805, Epicentre Biotech-
nologies, Madison, Wisconsin, USA). Paraffin was removed
by extracting two times with 1 ml of xylene for 10 min
followed by rehydration through subsequent washes with
100, 90 and 70% ethanol diluted in RNase-free water. After
each step, the tissue was collected by centrifugation at
16,0009gfor 5 min. After the final 70% ethanol wash, the
pellet was dried, resuspended in 100 ll of Quick Extract
FFPE RNA Extraction solution. Then, the tubes were vor-
texed and heated in a thermocycler for 30 min at 56°C and
then for 2 min at 98°C. RNA obtained was given DNase I
treatment with the solutions provided in the kit.
Real-time reverse transcriptase PCR
(real-time RT–PCR)
RNA obtained was converted to cDNA with M-MuLV
reverse transcriptase enzyme (Fermentas, Glen Burnie,
MD, USA) using poly T primers (Bioserve Biotechnologies
Pvt. Ltd, Hyderabad, India). A total of 2 ll of cDNA
obtained was subjected to real-time PCR using SYBR
Green master mix (Eurogentec, Seraing,Belgium) accord-
ing to manufacturer’s instructions using b-actin primers
(Forward Primer: 50- CTGGAACGGTGAAGGTGACA -30
Reverse Primer: 50- AAGGGACTTCCTGTAACAATG
CA -30), which were used as a control to check the quality
of RNA as well as specific exonic primers for IGF2 (For-
ward primer: 50- GAAGATGCTGCTGTGCTTCC -30and
the Reverse Primer: 50- AGTGAGCAAAACTGCCGC -30),
which were synthesized by Bioserve Biotechnologies
(Hyderabad, India). A relative curve quantitation method
was used to determine levels of RNA among the tissue
specimens. The resulting Standard curves were used to
calculate concentrations of IGF2 based on Ct values in
different tissue specimens. Appropriate controls were used
in all the experiments.
Allele-specific IGF2 expression analysis
RNAs from the specimen found to be heterozygous were
analyzed for allele-specific Apa-I site polymorphism by
performing RT–PCR. Oligonucleotide primers used were
Forward primer: 50- CTTGGACTTTGAGTCAAATTGG -30;
Reverse primer 50- GGTCGTGCCAATTACATTTCA -30
(Dai et al. 2007). The RT–PCR products were salt-precipi-
tated and dissolved in 10 ll of TE buffer. This was followed
by ApaI digestion for assessing the biallelic transcription of
IGF2 in the samples.
J Cancer Res Clin Oncol
123

Statistics
Mean, Standard Deviation, percentages and paired t-test
were carried out using appropriate software.
Results
The study comprised of a total 93 patients with BC, which
included 66.66% Invasive Duct Cell Carcinoma (IDC),
19.35% Ductal Carcinoma In Situ (DCIS), 10.75% Infil-
trating Lobular carcinoma (ILC) and 3.22% other types of
BC (Table 1). The mean age of the patients was 46.37
(SD ±9.18) years: 73% were premenopausal, while 27%
belonged to the post-menopausal group (Table 1).
IGF2 PCR-based methylation assay for exon 9 CpG
cluster gave a 214-bp fragment, which indicates methyla-
tion, while the absence of the band indicates hypomethy-
lation (Fig. 1). A total of 84.9% (79/93) tumor samples
analyzed showed no band on the agarose gel, suggesting
that there was absence of methylation, whereas 15%
exhibited methylation (Table 2). While 96.77% (90/93)
adjacent normal breast tissues showed normal pattern of
methylation. The normal breast tissue samples were sig-
nificantly methylated (P\0.0001) when compared to
tumor tissue (85% of the tumor tissues show unmethyla-
tion) by the paired t-test (Table 2).
The IGF2 protein expression analyzed by immunohis-
tochemistry (IHC) showed cytoplasmic staining (Fig. 2).
For each section, the mean was calculated after analysis of
five areas by two independent scorers. The IGF2 expres-
sion in tumor tissue was found to range between 1 and 3,
while the adjacent normal tissue range was between 0.5
and 3. An overall mean for tumor sections was
2.189 ±0.8797, which was 1.004-fold higher than the
adjacent normal breast tissue section that had a mean of
1.185 ±0.6212. When individual pairs of tumor and nor-
mal tissues were considered, the tumor showed higher
expression in 82.5% (33/40) when compared to adjacent
normal tissue, while 12.5% (5/40) showed same expression
and 5% (2/40) normal sections had a higher expression
than the tumor sample (Fig. 3). This clearly correlated with
the results of PCR-based methylation assay but is not
correlating with any clinical aspects such as age, meno-
pausal status and type of cancer. However, it is more
commonly seen in higher grade of breast cancer and none
of the lower grade. To evaluate whether the increased
expression of IGF2 in tumor tissue observed by IHC was
due to hypomethylation of exon 9 CpG cluster, real-time
RT PCR was carried out. RT–PCR with b-actin indicated
that the RNA obtained from all the samples was of good
quality (Fig. 4a). The overall IGF2 transcript in the tumor
tissues was about 1.3-fold higher when compared to the
adjacent normal breast tissues. On further analysis, 22.3%
tumor samples were methylated and showed a mean
increase about one, while the rest of the samples (77.7%)
were unmethylated and had a mean of 1.71-fold increase.
This clearly indicates the role of methylation in the
expression of IGF2 protein. To further assess whether this
is due to LOI, RT–PCR was performed in 11 samples,
which were identified as heterozygotes for ApaI polymor-
phism. IGF2 ApaI-amplified RT–PCR products indicated
that 33.33% of the tumor samples had biallelic transcrip-
tion, confirming LOI (Fig. 4b).
Table 1 Types and menopausal status of patients with breast cancer included in the study
Type of cancer (n=93) IDC (n=62) DCIS (n=18) ILC (n=10) Others (n=3)
Menopausal status Pre Post Not known Pre Post Pre Post Pre Post
Number of women/percentage (%) 43 (69.35%) 15 (24.19%) 4 (6.45%) 11 (61.1%) 7 (38.8%) 8 (80%) 2 (20%) 3 (100%) 0 (0%)
Overall percentage (%) (66.6%) (19.35%) (10.75%) (3.22%)
Majority of breast cancer cases are in premenopausal stage, and the most common type is IDC
IDC infiltrating ductal carcinoma, DCIS duct cell carcinoma insitu, ILC infiltrating lobular carcinoma
Fig. 1 Ethidium bromide–stained IGF2 PCR products after methyl-
ation-specific PCR on 2% agarose gel. Lane 3 100-bp DNA ladder,
Lanes 1 and 4show presence of bands, which indicates methylation
of the IGF2 gene at exon 9 CpG cluster. Lanes 2 and 5absence of
bands indicate that there is no methylation of the IGF2 gene at exon 9
CpG cluster
Table 2 Methylation status of IGF2 exon 9 CpG cluster in breast
tumor as well as adjacent normal tissues indicates that most of tumors
are unmethylated
Methylation status Tumor (n=93) Normal (n=93)
Methylated 14 (15%) 90 (97%)
Unmethylated 79 (85%) 3 (3%)
J Cancer Res Clin Oncol
123

Discussion
BC is a major health problem affecting millions of women
worldwide. With industrialization and urban development,
delayed or reduced fertility, increased longevity and altered
lifestyle, the incidence of BC is rising steadily even in
developing countries. The risk of BC is higher for women
in the older age group or in the post-menopausal period,
with a considerable increase above 50 years (Cummings
et al. 2009). However, in our study, 69% of the patients
with BC belonged to the premenopausal group and had a
mean age of 46.37 ±9 years. This is similar to the report
of Okonkwo et al.who indicated that majority of breast
cancers in India occur during the premenopausal period,
which is an alarming finding (Okonkwo et al. 2008).
The most common BC is invasive duct cell carcinoma
(IDC), and reports from both India and abroad indicate that
70–89% of breast cancers are of this type (Toikkanen et al.
1997; Saxena et al. 2005; Correa 1975). In our study,
66.6% of BCs were IDC; this decreased percentage could
be because our cases were sporadic, whereas other studies
have included both familial and sporadic cases (Saxena
et al. 2005). This may indicate that the incidence of other
types of BC is more in sporadic forms.
Mounting evidence implicates that several genes
including IGF2 are involved in the etiology of breast
cancer. IGF2, a growth-promoting, mitogenic and anti-
apoptotic factor, plays a key role in the initiation and
progression of several cancers (Rosen et al. 1991). A
number of epidemiological studies have shown consistently
high circulating levels of potent mitogens such as IGFs,
which are associated with increased risk of several com-
mon cancers, including those of the prostate, lung, colo-
rectal and breast (Yu and Rohan 2000). Our study exhibits
an elevated IGF2 expression by IHC in 93% of tumor
tissue when compared to only 7% of normal tissue. This
observation supports the earlier findings of Giani et al. who
also showed an increased expression of IGF2 protein by
IHC in BC (Giani et al. 2002).
In our study, the breast tumor tissues had 1.85 mean fold
higher IGF2 expression compared to the adjacent normal
tissue. To evaluate whether this increase in expression was
due to elevated transcripts of IGF2, RT RT–PCR was
carried out. The results indicated that all the tumor samples
(mean CT =27.15) had increased levels of IGF2
Fig. 2 Breast tumor and adjacent normal tissue sections after immunohistochemistry showing localization of IGF2. Cytoplasmic expression of
IGF2 was enhanced in tumor tissue (a) when compared to the adjacent normal breast tissue (c). band dare the respective negative controls
Fig. 3 Expression profiles of
breast tumor tissues and the
adjacent normal breast tissues of
40 samples analyzed by
immunohistochemistry.
X-axis—samples Y-axis
intensity of the IGF2 protein
expression, which was found to
be increased in tumor tissues
when compared to the adjacent
normal samples in 92.5% cases
Fig. 4 Ethidium bromide–stained RT–PCR products on 2% Agarose
gel. ab-actin transcripts of 140 bp after RT–PCR indicating that equal
amount of RNA from each sample was used for analysis. bbiallelic
transcription of IGF2 confirming loss of imprinting in tumor tissues in
lanes 1, 3, 4 and lanes 2, 5 showing monoallelic expression
J Cancer Res Clin Oncol
123

transcripts when compared to the adjacent normal breast
tissue samples (mean CT =29.29).
Altered methylation of IGF2 gene has been associated
with increased IGF2 expression in osteosarcoma, glio-
blastoma and adrenocortical tumors (Li et al. 2009;
Soroceanu et al. 2007; Soon et al. 2009). Since IGF2 is
known to exhibit maternal imprinting, increased IGF2
expression has been associated with LOI in both human
tumors and experimental animal models (Chen et al. 2000).
The present study reveals a significant (P\0.0001) loss of
methylation at the exon 9 CpG cluster of IGF2 gene in 85%
of breast tumor tissues when compared to 3% of adjacent
normal breast tissue. This is the first study evaluating exon
9 CpG cluster methylation in cancer. Ito et al. earlier
demonstrated that IGF2 DMR0 hypomethylation was seen
in 33% of breast cancer tissues when compared to normal
tissue from the same patient (Ito et al. 2008). This dis-
crepancy in result may be because of the different CpG
cluster selected, as well as the difference in the method
used for evaluating methylation.
In the present study, a low expression of IGF2 was seen
in all the normal breast tissue samples, despite the exon 9
CpG region being methylated; this may be due to the
paternal allele expression, which is commonly seen for
genes known to exhibit parental imprinting. The first clear
evidence that altered imprinting, leading to LOI, plays a
role in tumorigenesis was demonstrated in IGF2 and H19
genes in Wilm’s tumors (Ogawa et al. 1993; Steenman
et al. 1994). Enhanced IGF2 expression has been correlated
with LOI by altered methylation in several diseases and
adult cancers (Takano et al. 2000). It was still unclear
whether altered methylation of IGF2 gene increases its
expression because of LOI or enhanced expression of the
paternal allele in the present study.
Hence, to assess whether the increased expression was
due to LOI or due to increased paternal allele transcrip-
tion, BC samples heterozygous for ApaI polymorphism
were selected for evaluating biallelic expression of IGF2.
Samples heterozygous for ApaI polymorphism exhibited
biallelic expression of IGF2 in 33.33% of breast tumor
tissues, which was not seen in normal tissue. This clearly
indicates that LOI of the maternal allele plays a role in
the etiology of BC. Similar to our study, an earlier paper
reported biallelic expression of IGF2 predominantly in the
BC samples, while monoallelic expression was seen in
normal breast tissue (van Roozendaal et al. 1998); how-
ever, the exact percentage of BC with LOI was not
reported by them. Our results suggest that apart from LOI,
enhanced paternal allele transcription might be responsible
for the increased IGF2 transcription and expression in BC.
The present study is the first one to evaluate the meth-
ylation status of IGF2 exon 9 CpG cluster along with IHC
and RT–PCR, suggesting that this region may play a cru-
cial role in the etiology of breast cancer. The strength of the
present study is that the comparisons were made between
paired tumor and normal tissues taken from the same
patient. The importance of this study is that methylation of
exon 9 CpG cluster, which is close to/within DMR2 region,
may be used as a biomarker for the enhanced expression of
IGF2 in breast tumor tissue.
Acknowledgments We would like to acknowledge the Pathology
Department of Kamineni Hospitals, L.B.Nagar, Hyderabad, India, for
providing the archival paraffin blocks. This work was supported by
Department of Science & Technology, Government of India [Grant #
SR/WOS-A/LS-120/2007 and Grant # SR/SO/HS-89/2004], and
Fellowship from Council of Scientific and Industrial Research,
Government of India to SM [09/959(0001)/2009].
Conflict of interest statement We declare that we have no conflict
of interest.
References
Bhavani V, Srinivasulu M, Ahuja YR, Hasan Q (2009) Role of
BRCA1, HSD17B1 and HSD17B2 methylation in breast cancer
tissue. Cancer Biomark 5(6):279–287
Chen CL, Ip SM, Cheng D, Wong LC, Ngan HYS (2000) Loss of
Imprinting of the IGF-II and H19 Genes in Epithelial Ovarian
Cancer. Clin Cancer Res 6:474–479
Claus EB, Schildkraut JM, Thompson WD, Risch NJ (1996) The
genetic attributable risk of breast and ovarian cancer. Cancer
77:2318–2324
Correa P (1975) The epidemiology of cancer of the breast. Am J Clin
Pathol 64:720–727
Coughlin SS, Dkwueme DU (2009) Breast cancer as a global health
concern. Cancer Epidemiol 33:315–318
Cui H, Cruz-Correa M, Giardiello FM, Hutcheon DF, Kafonek DR,
Brandenburg S et al (2003) Loss of IGF2 imprinting: a potential
marker of colorectal cancer risk. Science 299:1753–1755
Cummings SR, Tice JA, Bauer S, Browner WS, Cuzick J, Ziv E et al
(2009) Prevention of breast cancer in postmenopausal women:
approaches to estimating and reducing risk. J Natl Cancer Inst
101:384–398
Dai Y, Wang Z, Li J, Gu X, Zheng M, Zhou J et al (2007) Imprinting
status of IGF2 in cord blood cells of Han Chinese newborns. Int J
Mol Sci 8:273–283
Dobrovic A, Simpfendorfer D (1997) Methylation of the BRCAI gene
in sporadic breast cancer. Cancer Res 57:3347–3350
Easton DF, Bishop DT, Ford D, Crockford GP (1993) Genetic linkage
analysis in familial breast and ovarian cancer: results from 214
families. The breast cancer linkage consortium. Am J Hum
Genet 52(4):678–701
Eden S, Cedar H (1994) Role of DNA methylation in the regulation of
transcription. Curr Opin Genet Dev 4(2):255–259
Elzagheid A, Kuopio T, Pyrhonen S, Collan Y (2006) Review lymph
node status as a guide to selection of available prognostic
markers in breast cancer: the clinical practice of the future?
Diagnostic Pathol 1:41
Feil R, Charlton J, Bird AP, Walter J, Reik W (1994) Methyla-
tion analysis on individual chromosomes: improved protocol for
bisulphite genomic sequencing. Nucleic Acids Res 22:695–696
J Cancer Res Clin Oncol
123

Futreal PA, Liu Q, Shattuck-Eidens D, Cochran C, Harshman K,
Tavtigian S et al (1994) BRCAI mutations in primary breast and
ovarian carcinomas. Science (Washington DC) 266:120–122
Giani C, Campani D, Rasmussen A, Fierabracci P, Miccoli P,
Bevilacqua G (2002) Insulin-like growth factor II (IGF-II)
immunohistochemistry in breast cancer: relationship with the
most important morphological and biochemical prognostic
parameters. Int J Biolog Mark 17(2):90–95
Ito Y, Koessler T, Ibrahim AE, Rai S, Vowler SL, Abu-Amero S et al
(2008) Somatically acquired hypomethylation of IGF2 in breast
and colorectal cancer. Hum Mol Genet 17(17):2633–2643
Jemal A, Murray T, Samuels A, Ghafoor A, Ward E, Thun MJ (2003)
Cancer statistics. CA Cancer J Clin 53(1):5–26
Li Y, Meng G, Huang L, Qiao-Nan G (2009) Hypomethylation of the
P3 promoter is associated with up-regulation of IGF2 expression
in human osteosarcoma. Hum Pathol 40(10):1441–1447
Lu L, Katsaros D, Wiley A, Rigault de la Longrais IA, Risch HA,
Puopolo M et al (2006) The relationship of insulin-like growth
factor-II, insulin-like growth factor binding protein-3, and
estrogen receptor-a expression to disease progression in epithe-
lial ovarian cancer. Clin Cancer Res 12:1208–1214
Merajver SD, Pham TM, Caduff RF, Chen M, Poy EL, Cooney KA
et al (1995) Somatic mutations in the BRCAI gene in sporadic
ovarian tumours. Nat Genet 9:439–443
Mohan V, Ponnala S, Gujjari K, Boddu P, Ahuja YR, Hasan Q et al
(2006) DNA methylation in esophageal diseases including
cancer: special reference To hMLH1 gene promoter status.
Tumori 92(2):155–162
Movva S, Sambasivan V, Vattam K, Radha S, Ahuja YR, Hasan Q
(2009) Revelance of insulin-like growth factor 2 in the
etiopathophysiology of diabetic nephropathy: possible roles of
phosphatase and tensin homolog on chromosome 10 and secreted
protein acidic and rich in cysteine as regulators of repair.
J Diabetes 1:118–124
Murrell A, Ito Y, Verde G, Huddleston J, Woodfine K, Silengo MC
et al (2008) Distinct methylation changes at the IGF2–H19 locus
in congenital growth disorders and cancer. PLoS ONE
3(3):e1849. doi:10.1371/journal.pone.0001849
Ogawa O, Becroft DM, Morison IM, Eccles MR, Skeen JE, Mauger
DC (1993) Constitutional relaxation of insulin—like growth
factor II gene imprinting associated with Wilms’ tumour and
gigantism. Nat Genet 5:408–412
Okonkwo QL, Draisma G, der Kinderen A, Brown ML, de Koning HJ
(2008) Breast cancer screening policies in developing countries:
a cost-effectiveness analysis for India. J Natl Cancer Inst
100:1290–1300
Rosen N, Yee D, Lippman ME, Paik S, Cullen KJ (1991) Insulin-like
growth factors in human breast cancer. Breast Cancer Res Treat
18(Suppl 1):S55–S62
Saxena S, Rekhi B, Bansal A, Bagga A, Chintamani, Murthy NS
(2005) Clinico-morphological patterns of breast cancer including
family history in a New Delhi hospital, India-A cross-sectional
study. World J Surg Oncol 3:67
Soon PS, Gill AJ, Benn DE, Clarkson A, Robinson BG, McDonald
KL (2009) Microarray gene expression and immunohistochem-
istry analyses of adrenocortical tumors identify IGF2 and Ki-67
as useful in differentiating carcinomas from adenomas. Endocr
Relat Cancer 16(2):573–583
Soroceanu L, Kharbanda S, Chen R, Soriano RH, Aldape K, Misra A
(2007) Identification of IGF2 signaling through phosphoinosi-
tide-3-kinase regulatory subunit 3 as a growth-promoting axis in
glioblastoma. PNAS 104(9):3466–3471
Steenman MJC, Rainier S, Dobry CJ, Grundy P, Horon IL, Feinberg
AP (1994) Loss of imprinting of IGF2 is linked to reduced
expression and abnormal methylation of H19 in Wilms’ tumour.
Nat Genet 7:433–439
Struewing JP, Tarone RE, Brody LC, Li FP, Boice JD (1996) BRCA1
mutations in young women with breast cancer. Lancet
347(9013):1493
Takano Y, Shiota G, Kawasaki H (2000) Analysis of genomic
imprinting of insulin-like growth factor 2 in colorectal cancer.
Oncology 59(3):210–216
Toikkanen S, Pylkkanen L, Joensuu H (1997) Invasive lobular
carcinoma of the breast has better short- and long-term survival
than invasive ductal carcinoma. Br J Cancer 76(9):1234–1240
van Roozendaal CEP, Gillis AJM, Klijn JGM, van Ooijen B, Claassen
CJC, Eggermont AMM et al (1998) Loss of imprinting of IGF2
and not H19 in breast cancer, adjacent normal tissue and derived
fibroblast cultures. Febs Lett 137(1–2):107–111
Yagi S, Hirabayashi K, Sato S, Li W, Takahashi Y, Hirakawa T et al
(2008) DNA methylation profile of tissue-dependent and differ-
entially methylated regions (T-DMRs) in mouse promoter
regions demonstrating tissue-specific gene expression. Genome
Res 18:1969–1978
Yang X, Zhang Y, Huang Y, Yang F (2001) Variations in
transmembrane Ca2 ?gradient and apoptosis of macrophages
induced by oxidized low density lipoprotein. Biosci Rep 21:667–
681
Yu H, Rohan T (2000) Role of the insulin-like growth factor family
in cancer development and progression. J Natl Cancer Inst
92:1472–1489
J Cancer Res Clin Oncol
123